Contributed equally
To the best of our knowledge, the vertebrate apolipoprotein L (APOL) family has not previously been ascribed to any definite pathophysiological function, although the conserved BH3 protein domain suggests a role in programmed cell death or an interference with mitochondrial processes. In the present study, the human APOL1 was expressed in the yeast
Apolipoprotein L (APOL) belongs to the high-density lipoprotein (HDL) family and is present in a number of species, including all mammals (
The network of these regulators is complex, containing eight BH3-only and at least 20 Bcl2 family members in humans, and is known to be involved in numerous types of cell death. As this machinery remains much simpler in yeast, involving only one Bcl2 family member, yBH3 (
The
For APOL1 expression, the human APOL1 was cloned into the centromeric p416Gal.1 (HA) (
The mutant APOL1-∆BH3 (BH3 domain deletion) was sequenced by Beckman Coulter (Illumina HiSeq) to verify the introduction of the desired substitution. pYX232-mtGFP (TRP1), encoding green fluorescent protein (GFP) fused to the mitochondrial pre-sequence subunit 9 of the F0-ATPase (mt-GFP) under the control of the constitutive triosephosphate isomerase promoter was used to monitor mitochondrial structure and morphology. pYX232-mtGFP was kindly provided by Professor Benedikt Westermann (Universität Bayreuth, Germany) (
Total protein extracts were performed as previously described (
For growth in liquid medium, yeast were grown overnight at 29°C in MGlu or MGal medium and diluted to an OD (λ=660 nm) of 0.2 in MGlu and MGal, respectively. OD was measured repeatedly over 9 days. In order to test the proliferation of cells grown on agar plates, yeast previously grown in liquid MGlu or MGal were spotted at a final concentration of 103 cells on MGlu or MGal solid media. In parallel, aliquots were collected for immunostaining for the detection of APOL1/APOL1-∆BH3 expression in inducible conditions.
Cells were cultured in MGal overnight at 29°C and then diluted in fresh media to an OD (λ=660 nm) of 0.2. Cell aliquots were collected, washed twice in PBS and re-suspended at 1×107 cells/ml in 1 ml of 2.5 µg/ml dihydroethidium (DHE) (37291, Sigma-Aldrich) in PBS and incubated for 15 min in the dark at room temperature. Then, cells were washed with 1 ml PBS and analyzed via flow cytometry. Flow cytometric analysis was performed on a Canto II (BD Biosciences) and results were analyzed with the FlowJo program (V10.5.0, FlowJo LLC).
Yeast strain cell cultures were collected at OD=0.2 (λ=660 nm) of the exponential phase in MGal medium. Cells were incubated with 50 pM TMRE (TMRE-Mitochondrial Membrane Assay Kit, ab113852, Abcam) for 10 min at 4°C, washed twice with PBS 1X, then cells were harvested, centrifuged (1,600 × g for 4 min at 4°C) and suspended (~1×106 cells ml−1) in PBS, in order to be analyzed by flow cytometry, according to the manufacturer's protocol, on a Canto II (BD Biosciences). Carbonilcyanide
For vacuole staining, cells were collected at OD=0.2 (λ=660 nm) of the exponential phase in MGAl growth medium and resuspended in 1 ml of pre-heated medium and 80 nM FM4-64 (T3166, Invitrogen, Thermo Fisher Scientific, Inc.). Cells were incubated at 29°C for 15 min, centrifuged (5,000 × g at room temperature for 5 min), collected and resuspended in 5 ml of medium and incubated at 29°C for 120 min. For fixed (1.1 ml of 37% formaldehyde incubated at 29°C for 30 min) or live cells, mt-GFP was monitored at a wavelength of 510 nm (magnification, ×63 and ×100).
Yeast strains were cultured at 29°C overnight in MGal media until they reached the log growth phase. At OD=0.2 (λ=660 nm), cell aliquots of 9 ml were fixed with 1.1 ml of formaldehyde 37% and incubated at 29°C for 30 min. Cells were collected, washed and resuspended in Buffer B [Sorbitol (1 M), K2HPO4, 3H2O (1 M) and KH2PO4 (1 M) at pH 7.5]. A total of 5 µl of lyticase (10,000 u/ml) and 2 µl of β-mercaptoethanol were added. After 30 min incubation at 29°C, cells were collected, washed and suspended in 1 ml of PBS 1X. A total of 20 µl of yeast culture was seeded on 10-well slides (MP Biomedicals, LLC.). Cells were stained for APOL1/APOL1-∆BH3 expression levels with mouse anti-HA (1:100, cat. no. 26183, Molecular Probes; Thermo Fisher Scientific, Inc.) overnight at room temperature in a humidified chamber. A series of PBS washes preceded the secondary anti-mouse antibody (1:1,500, A-11001; Invitrogen; Thermo Fisher Scientific, Inc.) incubation for 1 h at room temperature in a humid chamber. DAPI (cat. no. D9542; Sigma Aldrich) was used to stain the nuclei of yeast cells. The revelation of APOL1/APOL1-∆BH3 expression was assessed using a Zeiss inverted fluorescence microscope (magnification, ×63 and ×100).
The procedure was performed as previously described (
Exponentially MGal-growing cells at a final density of 103 cells were spread onto MGly agar plates or MGal in parallel, incubated at 29°C for three days. At the end of the incubation, cells were observed and counted manually, and. the IRC was calculated as colony number observed on MGly plates divided by the number of colonies on MGal plates.
PRISM (version 6.0 GraphPad Prism software, Inc.) was used to perform statistical data analysis and plot the graphs. Data are presented as the mean ± standard error of the mean (SEM). A minimum of three experiments were performed for statistical analysis. One-way ANOVA followed by Tukey's post hoc test and Student's t-test were used to determine statistically significant differences between the different experimental conditions. P<0.001 was considered to indicate a statistically significant difference.
In order to investigate the action of human APOL1 in yeast, a sequence covering the whole APOL1 open reading frame was inserted in the yeast vector (pGAL1) allowing expression induction by galactose and repression by glucose. As the BH3 domain is one of the primary features of APOL1 and has been associated with the pro-apoptotic function of Bcl2 family proteins, the activity of the BH3-deleted version of APOL1 (∆BH3) was tested. Cells were cultured in a medium containing glucose (MGlu-repressive conditions, negative control) or galactose (MGal-induced conditions) as carbon sources. In order to test cell proliferation, cells expressing APOL1 variants and control cells were plated on MGlu and MGal. No significant differences were observed in the number of colonies between cells expressing or not expressing APOL1 (
In the presence of a fermentable carbon source such as glucose or galactose, yeast cells preferentially generate energy by undergoing fermentation, and can grow normally with a minimal level of mitochondrial respiration, generating ethanol as the end product of fermentation. When fermentable carbon sources become limiting, genes required for respiration are induced, and ATP is generated by metabolizing non-fermentable carbon sources such as glycerol, ethanol or lactate in the mitochondria (
In order to determine whether human APOL1 could interfere with mitochondrial function, cells initially grown on MGal to induce APOL1 expression were transferred to an MGly medium, containing glycerol, a non-fermentable carbon source. As presented in
As mitochondria are primarily involved in respiration, the present study assessed the IRC in cells expressing or not APOL1 variants. This index measures the percentage of viable respiration-competent cells and reflects the fraction of cells that can grow on non-fermentable (glycerol) carbon sources compared with the fraction of cells growing on fermentable (galactose) carbon sources (
As a result of the cell proliferation inhibition observed on MGly media and the drop in respiratory index, the present study investigated whether the mitochondrial membrane potential (∆ψm) of yeast is affected by APOL1 induction. Maintenance of the membrane potential is key for mitochondrial functions (
As APOL1 induction provoked mitochondrial membrane depolarization, the present study investigated a potential direct APOL1 interaction within the yeast mitochondria. In order to assess the subcellular localization of APOL1 in yeast, APOL1-expressing cells were grown on galactose medium for 24 h and mitochondria enrichment was performed using these cells. A fraction of HA-APOL1 was consistently found in the mitochondrial-enriched fraction (enriched mitochondria) as validated by the detection of the outer membrane mitochondrial channel-forming protein porin in this fraction (
As APOL1 localizes in the mitochondria and interferes with proper function, the present study investigated whether their morphology was also affected. Morphology was visualized using mt-GFP, a mitochondria-targeted GFP protein. Cells co-expressing native APOL1 or APOL1-∆BH3 with mt-GFP were grown in MGal. In control cells not expressing APOL1, a normal branched tubular mitochondrial network located below the cell cortex (
In order to test if this morphological change was accompanied by a change in mitochondrial content, cells were grown on non-inducible and non-repressive medium (raffinose) and APOL1 was induced in a time-dependent manner by the addition of galactose to the growth medium. Using western blotting, the present study observed the stability of two mitochondrial components after inducing APOL1 for 4 h in the cells.
In order to further analyze these different structural patterns, the present study used a fluorescence microscopy assay during APOL1 induction kinetics. Cells were grown in MRaf and galactose was added at time (T)=0 to induce HA-APOL1 expression. At different times after the induction, cell aliquots were collected for mitochondrial visualization using mt-GFP as a marker and for immunoblot analysis. The present study identified different categories of the mitochondrial morphological structures that are consistent with what has been previously described (
As APOL1 uptake by African trypanosomes promotes lysosome swelling (
Previous studies have suggested an association between certain APOL family members and PCD of neutrophils in chronically ill patients and murine dendritic cells (
Not applicable.
The present study has been funded by research programs of the FNRS-FRS (Belgian National Fund for Scientific Research), Azm and Saadé Association (grant no. 110617) and AUF (Agence Universitaire de la Francophonie; grant no. 140909). Additional funding was provided by the Bureau of International Relations (grant no. bric98156) of the Université Libre de Bruxelles (ULB).
All data generated or analyzed during this study are included in this published article.
MC, JD, MB and PP were involved in performing the experiments and analyzing the results. MC drafted the original manuscript. JD and LV wrote the manuscript. JD, MB, BB, AMM, LV and RK reviewed the manuscript. JD, LV and RK edited the manuscript. AMM and LV developed the methodology. LV and BB conceptualized the study. RK interpreted the data. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
LV is Director of Research at the FNRS. AMM is Senior Research Associate at the FNRS and WELBIO investigator. MB is a scientific research worker supported by WELBIO.
APOL1 expression levels, cell proliferation and intracellular ROS. (A) HA tagged wild type APOL1 and BH3-deleted APOL1 (∆BH3) expression was induced in cells from a galactose inducible vector and revealed by immunoblotting assay using an anti-HA antibody; cells transfected with the empty vector (pGAL1) were used as negative control; loading control was made by immunoblotting analysis using an anti-Pma1 antibody. (B) APOL1 had no effect on yeast proliferation as measured using clonogenic assay: Cells analyzed in panel A were grown on solid media containing glucose or galactose and counted. (C) APOL1 had no effect on yeast proliferation as measured using liquid growth assay: Cells analyzed in panel A were inoculated in liquid media containing either glucose or galactose and proliferation was assessed by OD measurement. (D) Cells were treated with the ROS detecting reagent (dihydroethidium) and analyzed by flow cytometry. (E) Quantification of the flow cytometry analysis performed in D. Data are presented as the average of three independent cultures. Error bars represent the standard error of the mean. APOL1, apolipoprotein L 1; ROS, reactive oxygen species; OD, optical density.
APOL1 expression levels and cell proliferation on non-fermentable media. (A) APOL1 inhibited yeast proliferation in non-fermentable media: HA tagged wild type and BH3-deleted (∆BH3) APOL1 expression was induced by galactose and cells were then shifted in liquid glycerol containing MGly media at T=0. Error bars represent standard errors on three independent experiments. (B) APOL1 protein expression levels after 15.5 h: Cell lysates were analyzed using immunoblotting with an anti-HA antibody. Loading control was made using immunoblotting analysis with an anti-Pma1 antibody. (C) APOL1 interfered with the respiratory competence. The capability of carbon sources to support proliferation was analyzed by plating cells (at 103 density) on solid media containing galactose or glycerol. Viable colonies on MGly plates were counted and compared with viable colonies under fermentable conditions. (D) APOL1 and BH3 deleted-APOL1 (∆BH3) proteins were expressed during the index of respiratory competence assay (days 1, 3, 5 and 7). Cell extracts taken at the indicated time points were analyzed using immunoblotting with the indicated antibodies. Loading control was made using immunoblotting analysis with an anti-Pma1 antibody. APOL1, apolipoprotein L 1; MGly, glycerol-containing medium; OD, optical density; T, time.
APOL1 expression levels and mitochondrial membrane depolarization. (A) APOL1 depolarized the mitochondrial membrane. Cells were incubated with TMRE; total fluorescent and non-fluorescent cells were analyzed using flow cytometry assays and the percentage of non-fluorescent cells in the population was plotted. Experiments were performed in liquid MGal media. Error bars represent standard errors of the mean in three independent experiments. (B) Simultaneously with flow cytometry assays, cell lysates were prepared and analyzed using immunoblotting with an anti-HA antibody. Loading control was made using immunoblotting analysis with an anti-Pma1 antibody. (C) Cells were incubated with TMRE and analyzed using flow cytometry. FCCP was used as a positive control. P<0.001 (***) was considered statistically significant. APOL1, apolipoprotein L 1; TMRE, tetramethylrhodamine, ethyl ester; MGal, galactose-containing medium; FCCP, carbonilcyanide p-triflouromethoxyphenylhydrazone.
APOL1 subcellular localization. Extracts taken from cells transformed with the pGAL-1 vector expressing wild type APOL1 or the empty vector were fractionated. The UM and EM fractions are shown. These fractions were analyzed using western blotting with the following antibodies: Anti-HA, anti-Dpm1, anti-porin, anti-Pma1 and anti-PGK1. The UM fraction contains the endoplasmic reticulum, plasma membrane and mitochondrial fragments. The EM fraction is enriched for intact mitochondria. The figure shows non-adjacent bands from the same blot that were cut, adjusted and joined in order to avoid including non-relevant wells in the results. APOL1, apolipoprotein L 1; UM, unpurified mitochondria; EM, enriched mitochondria.
APOL1 expression levels and mitochondrial alterations. (A) APOL1 expression levels modified mitochondrial morphology as visualized by a mitochondrial marker. Cells were transformed by the plasmid pYX232-mtGFP, which expresses GFP fused to a mitochondrial matrix targeting sequence (mtGFP) alone (CTL) or together with plasmids expressing wild type APOL1 or BH3-deleted APOL1. Aliquots from cultures in MGal growth medium were then taken at OD 0.2 and treated with an anti-HA antibody (red), and stained with DAPI (blue). Magnification, ×100. (B) Cells transformed by pYX232-mtGFP (with a constitutive promoter) and APOL1 expression vector were induced by galactose added to MRaf growth medium for the indicated times [time-dependent kinetics (0, 1, 3 and 4 h)]. (C) Immunoblot analysis of cell extracts from (B) demonstrated the expression levels of APOL1 (anti-HA), porin (Sc anti-porin) and GFP (anti-GFP). Scale bar, 5 µm. Magnification, ×63. APOL1, apolipoprotein L 1; GFP, green fluorescent protein; MGal, galactose-containing medium; OD, optical density; MRaf, raffinose-containing medium.
APOL1 expression levels and mitochondrial morphology. (A) APOL1 expression levels were induced using galactose for the indicated times [time-dependent kinetics (0, 1, 3 and 4 h)] in exponentially growing yeast cells expressing mt-GFP. This resulted in different mitochondrial morphologies: Tubular, fragmented and aggregated mitochondria. APOL1, apolipoprotein L 1; mt-GFP, mitochondria-targeted green fluorescent protein. Scale bar, 5 µm. Magnification, ×100.
APOL1 expression levels and vacuole morphology. APOL1 expression levels were associated with vacuole fragmentation. APOL1 expression was induced (using galactose) in exponentially growing yeast cells for 12 h. Cells were then stained with the vacuole-targeted dye FM 4–64. Representative images of control yeast cells (single large vacuoles) and cells expressing APOL1 (two to four medium-sized vacuoles) are shown. Scale bar, 5 µm. Magnification, ×63. APOL1, apolipoprotein L 1.
Model of APOL1-induced death. A model of intracellular APOL1 induced death that is associated with mitochondrial membrane permeabilization as well as changes in lysosomal and vacuolar acidification. (A) In yeast (and human kidney cells), APOL1 (orange) may cause changes in mitochondrial membrane potential and vacuolar acidification, ultimately resulting in cell hypertrophy and death. (B) In trypanosomes, during the course of trypanolysis, APOL1 localizes to the lysosomal membrane causing lysosomal membrane permeabilization and to the mitochondrial membrane causing depolarization of the mitochondria. The two processes result in cell lysis and death. APOL1, apolipoprotein L 1; HDL, high-density lipoprotein; ER, endoplasmic reticulum.
Primers used for construction of plasmids.
Oligonucleotides or primers | Sequence, 5′-3′ | Purpose |
---|---|---|
APOL1-F | GTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAACTATAGGTACCTAGATGGAGGGAGCTGCTTTGC3 | Plasmid construction |
APOL1-R | CAGCACCGGCTGCTCCTGCTCCTGCTCCTGCTCCTGCTCCCTCGAGCAGTTCTTGGTCCGCC | Plasmid construction |
APOL1-∆BH3-F | TTGTGGACCTTCCTTCTTATGTTATCCTCAAGC | Plasmid construction |
APOL1-∆BH3-R | ATAAGAAGGCTCAAGGTCCACAAAGGCACCAC | Plasmid construction |
Cells were counted on the basis of different mitochondrial morphology: Mean count (%) of yeast cells presenting the mitochondrial morphologies illustrated in
+APOL1 | Time | Normal % | Fragmented % | Aggregated % | No structure % |
---|---|---|---|---|---|
T=0 h | 92 | – | – | 8 | |
T=1 h | 67.2 | 5.1 | 12.9 | 14.6 | |
T=3 h | 42.9 | 6 | 10.1 | 40.9 | |
T=4 h | 26 | 12.2 | 19.1 | 42.5 |