Contributed equally
Colorectal cancer (CRC) is a common human malignant tumor, and the fourth most common cause of cancer-associated mortality in China. However, the pathogenesis of CRC is not yet fully understood. The present study aimed to investigate the expression and clinical significance of microRNA (miR)-126 and insulin receptor substrate-1 (IRS-1), as well as the role of miR-126 in the prognosis of patients with CRC. A total of 86 colorectal tissue specimens, including 40 CRC and adjacent normal tissue, 26 colorectal adenoma tissue and 20 normal colorectal tissue samples, were collected for the present study. Reverse transcription-quantitative PCR analysis was performed to determine miR-126 and IRS-1 mRNA expression levels, while western blotting and immunohistochemistry (IHC) analyses were performed to determine IRS-1 protein expression levels. The correlation between miR-126 and IRS-1 expression, as well as the association between altered miR-126 and IRS-1 expression levels and clinicopathological characteristics, and the overall survival time of patients with CRC were assessed. The results demonstrated that miR-126 expression was significantly downregulated, while IRS-1 protein expression was upregulated in CRC tissues compared with that in adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues, respectively. IHC analysis exhibited strong positive staining of IRS-1 protein in CRC tissues, while absent or weak staining of IRS-1 protein was detected in adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues. miR-126 expression was inversely correlated with IRS-1 protein expression in CRC tissues (r=−0.420; P<0.05). Furthermore, downregulated miR-126 expression was associated with advanced clinicopathological characteristics of the disease and a shorter overall survival time in patients with CRC. Taken together, the results of the present study suggest that miR-126 downregulation may be a candidate molecular marker predictive of poor prognosis of patients with CRC.
Colorectal cancer (CRC) is a common human malignancy worldwide and its incidence has significantly increased in recent years, accounting for 8% of all new cancer diagnoses in 2016; it has become the third most common cancer in the United States (
Previous studies have demonstrated the essential roles of genetic alterations and aberrant expressions of several oncogenes or tumor suppressor genes in the development of CRC (
Mature miRNAs are a class of small, non-coding RNAs, with a length of ~22 nucleotides. miRNAs mediate the binding of the RNA-induction silencing complex with the 3′-untranslated region (UTR) of target mRNAs and regulate their degradation or translational inhibition (
IRS-1, a member of the IRS family, is the principle substrate of the insulin-like growth factor I receptor and the insulin receptor, and plays an essential role in cytokine signaling (
The present study aimed to investigate the expression statuses of miR-126 and IRS-1 in primary CRC tumors, and to determine the clinical significance of altered miR-126 expression in patients with CRC. The findings would help to determine whether the downregulation of miR-126 expression may play an important role in the pathogenesis and progression of human CRC.
A total of 126 colorectal specimens were collected from patients who underwent surgical resection or colonoscopy biopsy at the Affiliated Hospital of Guangdong Medical University (Zhanjiang, China) between July 2011 and December 2012. The specimens included samples from primary CRC and adjacent normal tissues from 40 patients with CRC, colorectal adenoma tissues from 26 patients who underwent resection of adenomas, and colonoscopy biopsy samples from 20 healthy volunteers. Among the 40 patients with CRC, 20 were men and 20 were women, with a mean age of 56.2 years (age range, 32–73 years). There were 16 men and 10 women, with a mean age of 46 years (age range, 29–65 years) in the colorectal adenoma group. A total of 20 healthy people, including 11 men and 9 women were selected as the control group, with a mean age of 47.5 years (age range, 28–60 years). Adjacent normal colorectal epithelial tissues were 5 cm away from the edge of the primary tumor. Diagnoses were confirmed via pathological analysis. The specimens were immediately frozen in liquid nitrogen and subsequently stored at −80°C until further experimentation. All specimens were obtained prior to chemotherapy or radiotherapy, and the clinicopathological data of all patients, including sex, age, tumor size, tumor location, pathological data, distant metastasis, Tumor-Node-Metastasis (TNM) staging (
Targetscan (
Total RNA was extracted from tissue specimens, including primary CRC and adjacent normal tissues, colorectal adenoma tissues and normal samples, using RNAiso Plus (Takara Bio, Inc.), according to the manufacturer's protocol, and the purified RNA was stored at −80°C until further use. Total miRNA and mRNA were reverse transcribed into cDNA using the Mir-X miRNA First-Strand Synthesis kit (cat. no. 638315; Clontech Laboratories, Inc.) and PrimeScript® RT Master Mix Perfect Real Time (Takara Bio, Inc.), respectively. The following temperature protocol was used for RT: The tube was incubated for 1 h (miR-126) or 15 min (IRS-1 mRNA) at 37°C, then terminated at 85°C for 5 min (miR-126) or 5 sec (IRS-1 mRNA) to inactivate the enzymes. qPCR was subsequently performed using TB Green Premix Ex Taq II (Tli RNaseH Plus; Takara Bio, Inc.), on a LightCycler® (Roche Diagnostics). The universal reverse primer for miR-126 and U6 PCR amplification, mRQ 3′ Primer, was included in the Mir-X miRNA First-Strand Synthesis kit, while the remaining primer sequences for miRNA and mRNA were synthesized by Sangon Biotech Co., Ltd. The primer sequences used for qPCR are listed in
Western blotting was performed according to the standard protocol (
IHC staining was performed according to the standard protocol (Santa Cruz Biotechnology, Inc.). All tissues were fixed in 4% paraformaldehyde for at least 24 h at 4°C and embedded in paraffin. Paraffin-embedded tissues were cut into 4-µm thick sections and placed onto positively charged slides pretreated with polylysine (Wuhan Boster Biological Technology, Ltd.). The tissue sections were subsequently deparaffinized in xylene, rehydrated in a descending ethanol series (90, 80 and 70% for 5 min, respectively) and distilled water, and subjected to heat-induced antigen retrieval in 10 mM citrate buffer (pH=6.0) (Beijing Solarbio Science and Technology Co., Ltd.) for 5 min at room temperature. The slides were blocked with 10% goat serum (Wuhan Boster Biological Technology, Ltd.) for 10 min at room temperature, prior to incubation with 3% H2O2 for 10 min at room temperature to inhibit endogenous peroxidase activity. Tissue sections were incubated with rabbit anti-human IRS-1 primary antibody (1:50; cat. no. SC-559; Santa Cruz Biotechnology, Inc.) overnight at 4°C. The slides were washed three times with PBS (Wuhan Boster Biological Technology, Ltd.), prior to incubation with the MaxVision™ HRP-polymer goat anti-rabbit secondary antibody in the IHC kit (Fuzhou Maixin Biotech Co., Ltd.) for 30 min at room temperature. The slides were subsequently stained with 3,3′-diaminobenzidine for 10 min at room temperature to visualize IRS-1 expression and counterstained with hematoxylin for 2 min at room temperature, prior to mounting in permanent mounting medium. The stained tissue sections were observed under a confocal microscope (magnification, ×400; Leica Microsystems, Ltd.). Tissues incubated with PBS instead of the primary antibody were used as negative controls. All experiments were performed in triplicate.
Statistical analysis was performed using SPSS software version 13.0 (SPSS, Inc.). All experiments were performed in triplicate and data are presented as the mean ± standard deviation. One-way analysis of variance, followed by Bonferroni's post-hoc test, was used for multiple intergroup comparisons between miR-126 and IRS-1 mRNA or protein expression levels. Associations between miR-126 or IRS-1 expression and clinicopathological characteristics of patients with CRC were analyzed using the χ2 test. Kaplan-Meier curves and the log-rank test were generated to assess the survival data, while Pearson's correlation analysis was performed to determine the correlation between miR-126 and IRS-1 protein expression. P<0.05 was considered to indicate a statistically significant difference.
In order to determine the status of miR-126 expression in CRC, RT-qPCR analysis was performed to assess miR-126 expression in 40 primary CRC tissues and their adjacent normal tissues, in 26 colorectal adenomas and in 20 normal colorectal tissues without concomitant CRC. The results demonstrated that miR-126 expression was significantly downregulated in CRC tissues compared with that in matched adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues, respectively (P<0.05;
The
Pearson's correlation analysis was performed to demonstrate the potential regulatory role of miR-126 in IRS-1 expression. The results demonstrated a significantly inverse correlation between miR-126 and IRS-1 protein expression levels (r=−0.420; P<0.05;
In order to understand the clinical significance of altered miR-126 expression in patients with CRC, the association between miR-126 and IRS-1 protein expression levels and clinicopathological characteristics of patients with CRC was assessed. Of the 40 patients with CRC, decreased miR-126 expression and increased IRS-1 expression levels were observed in 29 and 27 cases compared with the levels in the matched adjacent normal tissues, respectively. As presented in
The association between miR-126 expression and overall survival time was analyzed using the Kaplan-Meier method to determine the prognostic value of miR-126 in patients with CRC. Follow-up survival data was recorded up to 60 months for all 40 patients with CRC. The results demonstrated that patients with CRC, with downregulated miR-126 expression exhibited a significantly shorter overall survival time than those with high miR-126 expression (P=0.0172;
Altered expression of miRNAs has been reported in several types of human cancer, including CRC (
Diagnostic and prognostic molecular biomarkers have revolutionized clinical strategies for the management of patients with cancer. While the majority of previous studies have primarily focused on genetic and expression markers of protein-coding genes (
The present study assessed miR-126 expression in a small cohort of patients with CRC, with recorded pathological characteristics and clinical outcomes. The results demonstrated that miR-126 was downregulated in CRC tumors, which was significantly associated with advanced TNM and Dukes stages of tumor, positive lymph node status and distant metastasis. Furthermore, Kaplan-Meier survival analysis indicated that downregulation of miR-126 expression was significantly associated with a shorter overall survival time of patients with CRC. Taken together, the results of the present study suggest that miR-126 expression may be a potential candidate molecular marker predictive of the progression and prognosis of patients with CRC.
Previous studies have investigated the functional and mechanical roles of miRNAs in different types of human cancer (
The mechanistic roles of miR-126 in CRC tumorigenesis and progression have not yet been fully investigated. A previous study used
In conclusion, the results of the present study demonstrated that miR-126 expression was significantly downregulated in CRC tissues and inversely correlated with IRS-1 protein expression. Furthermore, downregulation of miR-126 expression was associated with advanced stages of the disease and a poor prognosis in patients with CRC. Taken together, these results suggest that miR-126 may function as a tumor suppressor and play an important role in CRC carcinogenesis and progression.
The authors of the present study would like to thank Professor Zhe Wang from the Department of Gastrointestinal Surgery at the Affiliated Hospital of Guangdong Medical University (Zhanjiang, China) for providing the surgical specimens and collecting the clinical information.
No funding was received.
The datasets used and/or analyzed during the current study are available from the corresponding author upon reasonable request.
YZ designed the present study. SY, CY, GZ, FS, YC, JY and WW performed the experiments. SY, CY, WW and YZ performed the statistical analysis and drafted the initial manuscript, while WW and YZ critically revised the manuscript for important intellectual content. All authors read and approved the final manuscript.
The present study was approved by the Ethics Committees of the Affiliated Hospital of Guangdong Medical University (Zhanjiang, China; approval no. NPJ2011005), and written informed consent was provided by all participants prior to the study.
Not applicable.
The authors declare that they have no competing interests.
Reverse transcription-quantitative PCR of miR-126 and IRS-1 mRNA expression levels in colorectal tissues. (A) miR-126 expression was significantly downregulated in CRC tissues compared with adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues, while no significant differences in miR-126 expression levels were observed between adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues. (B) No significant differences in IRS-1 mRNA expression levels were observed between CRC tissues, adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues. Data are presented as the mean ± standard deviation of three independent experiments. *P<0.05 vs. the other three groups, respectively. miR, microRNA; IRS-1, insulin receptor substrate-1; CRC, colorectal cancer.
Expression and location of IRS-1 protein in colon tissues. (A) Western blot analysis depicting IRS-1 protein expression in CRC tissues, adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues. (B) Relative IRS-1 protein expression levels were normalized to GAPDH and presented as the mean ± standard deviation of three independent experiments. IRS-1 protein expression levels were significantly higher in CRC tissues compared with adjacent normal tissues, colorectal adenoma tissues and normal colorectal tissues. (C-F) Immunohistochemical staining of IRS-1 in colorectal tissues. (C) IRS-1 protein was strongly expressed in the cytoplasm of CRC tissues, and weakly expressed or absent in (D) normal colorectal tissues, (E) adjacent normal tissues and (F) colorectal adenoma tissues. Magnification, ×400. *P<0.05 vs. the other three groups, respectively. IRS-1, insulin receptor substrate-1; CRC, colorectal cancer.
Pearson's correlation analysis between miR-126 and IRS-1 expression levels in human colorectal tissues. (A) miR-126 expression was significantly inversely correlated with IRS-1 protein expression in colorectal cancer tissues. (B) No significant correlation was observed between miR-126 and IRS-1 mRNA expression levels. miR, microRNA; IRS-1, insulin receptor substrate-1.
Kaplan-Meier survival analysis of patients with CRC, based on miR-126 expression level. Downregulated miR-126 expression was associated with a significantly shorter overall survival time of patients with CRC. CRC, colorectal cancer; miR, microRNA.
Primer sequences used for quantitative PCR.
Name | Direction | Primer (5′→3′) |
---|---|---|
miRNA qPCR | ||
miR-126 | Forward | TCGTACCGTGAGTAATAATGCG |
U6 snRNA | Forward | CTCGCTTCGGCAGCACA |
Universal qPCR | Reverse | mRQ 3′ Primer included in the Mir-X miRNA First-Strand Synthesis kit |
mRNA qPCR | ||
IRS-1 | Forward | AGTCCTAACCGCAACCAGAGT |
Reverse | CCTCAGCCACACATTCTCAA | |
β-actin | Forward | GGCGGCAACACCATGTACCCT |
Reverse | AGGGGCCGGACTCGTCATACT |
qPCR, quantitative PCR; miRNA/miR, microRNA; snRNA, small nuclear RNA; IRS-1, insulin receptor substrate-1.
Association between miR-126 and IRS-1 protein expression levels and clinicopathological characteristics in patients with CRC (n=40).
miR-126 expression, n | IRS-1 expression, n | |||||
---|---|---|---|---|---|---|
Characteristic | Upregulated | Downregulated | P-value | Upregulated | Downregulated | P-value |
Total number of patients | 11 | 29 | 27 | 13 | ||
Age, years | ||||||
60 | 7 | 16 | 0.900 | 14 | 9 | 0.484 |
<60 | 4 | 13 | 13 | 4 | ||
Sex | ||||||
Male | 5 | 15 | 0.723 | 15 | 5 | 0.311 |
Female | 6 | 14 | 12 | 8 | ||
TNM stage | ||||||
Tis, T1, T2 | 8 | 8 | 0.025 | 5 | 11 | <0.001 |
T3, T4 | 3 | 21 | 22 | 2 | ||
Diameter, cm | ||||||
≥5 | 4 | 14 | >0.999 | 12 | 6 | 0.919 |
<5 | 7 | 15 | 15 | 7 | ||
Tumor location | ||||||
C, A, T | 5 | 16 | 0.583 | 16 | 5 | 0.217 |
D, S, R | 6 | 13 | 11 | 8 | ||
Histological type | ||||||
Well and moderate | 3 | 12 | 0.648 | 13 | 2 | 0.098 |
Poor | 8 | 17 | 14 | 11 | ||
Lymph node metastasis | ||||||
Positive | 2 | 20 | 0.012 | 20 | 2 | 0.002 |
Negative | 9 | 9 | 7 | 11 | ||
Distant metastasis | ||||||
Positive | 2 | 19 | 0.020 | 18 | 3 | 0.025 |
Negative | 9 | 10 | 9 | 10 |
miR, microRNA; IRS-1, insulin receptor substrate-1; TNM, Tumor-Node-Metastasis; C, cecum; A, ascending colon; T, transverse colon; D, descending colon; S, sigmoid colon; R, rectum.