MicroRNAs (miRNAs) exert critical roles in the majority of biological and pathological processes. Recent studies have associated miR-150 with a number of different cancer types. However, little is known about miR-150 targets in cervical cancer. In the present study, the HeLa human cervical cancer cell line was transfected with hsa-miR-150-5p mimics, hsa-miR-150-5p inhibitors or miRNA controls. miR-150 was predicted to bind the 3′untranslated region (3′UTR) of the
Cervical cancer is a frequent diagnosis in women worldwide; however, its incidence is decreasing in developed countries thanks to early diagnosis (
We predicted that miR-150 binds the 3′UTR of
The HeLa human cervical cancer cell line was obtained from the RIKEN Cell Bank (Tsukuba, Japan) and cultured in complete Dulbecco's Modified Eagle's medium (Sigma-Aldrich; Merck KGaA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) and 1% antibiotic/antimycotic solution (Thermo Fisher Scientific, Inc.) at 37°C in a humidified 5% CO2 incubator.
To explore the mechanism through which miR-150 promotes tumor progression, we used TargetScan as a miRNA target prediction algorithm. Based on the frequencies of miR-150 sites in the 3′UTRs of mRNAs, more than 100 mRNAs were predicted to be regulated by miR-150. In this study, we focused on
HeLa cells were transfected with 100 nM hsa-miR-150-5p mimics (miR-150 mimics), 100 nM hsa-miR-150-5p inhibitors (miR-150 inhibitors), or 100 nM miRNA control (Bioneer) for 72 h using Lipofectamine RNAiMAX Transfection reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions.
The expression level of miR-150 and
Transfected HeLa cells were homogenized in cold EzRIPA Lysis buffer (ATTO). A 100-µg protein extract was separated by SDS-PAGE using a 10% polyacrylamide gel, and the proteins were transferred onto polyvinylidene difluoride membranes (Merck Millipore). After blocking with 5% non-fat dry milk at room temperature for 1 h, the membranes were incubated with primary antibodies against p27Kip1 (1:1,000; cat. no. 3686; Cell Signaling Technology, Inc.) and β-actin (1:1,000; cat. no. 8457; Cell Signaling Technology, Inc.) overnight at 4°C. Subsequently, the membranes were washed and exposed to goat anti-rabbit-IgG HRP (1:1,000; cat. no. 7074, Cell Signaling Technology, Inc.) for 1 h at room temperature, which was followed by imaging with a chemiluminescent substrate. This assay was performed in triplicate.
To analyze the cell cycle, transfected cells were collected, washed with phosphate-buffered saline (PBS), and fixed in cold 70% ethanol at 4°C overnight. Fixed cells were washed with PBS and incubated with 250 µg/ml RNase A and 50 µg/ml propidium iodide for 30 min. The DNA content was determined using a Cell Lab Quanta SC flow cytometer (Beckman Coulter) and the cell cycle profile was determined with ModFit LT, which is the most comprehensive flow cytometric DNA cell cycle analysis software available (Verity Software House). This assay was performed in triplicate.
Cell proliferation of transfected HeLa cells was determined using the 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) assay with the Cell Counting Kit-8 (CCK-8; Dojindo Laboratories) every 24 h according to the manufacturer's instructions. CCK-8 solutions were added to the cell culture, and cells were incubated at 37°C for 2 h. Later, the absorbance was measured at 450 nm. This assay was performed in triplicate.
Results are expressed as the mean ± standard deviation. Statistical significance for the experiments was determined using Dunn's test, a Mann-Whitney's
miRNAs repress the expression of target genes by binding the 3′UTR of target genes. The target sites of miRNA-150 were investigated using the TargetScan miRNA target prediction database.
To investigate the molecular details of miR-150 effects, HeLa cells were transfected with miR-150 mimics, miR-150 inhibitors, or miRNA control. Firstly, qPCR for miRNA showed that miR-150 expression levels were significantly higher and lower in the miR-150 mimic-transfected and miR-150 inhibitor-transfected cells, respectively, relative to the controls (
To investigate the role of miR-150 in cervical cancer cells, we analyzed cell cycle progression in transfected HeLa cells using a flow cytometer (
We hypothesized that miR-150 levels are involved in cell proliferation in cervical cancer. The proliferation of transfected HeLa cells was determined by measuring the absorbance at 450 nm based on a colorimetric assay. Our results showed that the overexpression of miR-150 led to a significant increase in cell proliferation, whereas expressing miR-150 inhibitors led to a significant decrease in HeLa cell proliferation (
miRNAs play critical roles in many diverse biological and pathological processes, such as cell proliferation, migration, apoptosis, and the pathogenesis of cancer (
In the present study, we analyzed the effect of miR-150 on cervical cancer cells
To investigate the role of miR-150 in HeLa cells, we analyzed cell cycle progression by flow cytometry. In miR-150 mimic-transfected cells, a higher proportion of cells was in the S phase. Moreover, the transfection of miR-150 inhibitors induced cell cycle arrest at the G1/G0 phase. These results suggested that miR-150 promotes cell cycle progression from the G0/G1 to S phase in cervical cancer cells by suppressing the p27Kip1 function.
We then measured transfected HeLa cell numbers using CCK-8, via a sensitive colorimetric assay for the determination of cell proliferation. The cells transfected with miR-150 mimics proliferated faster than control cells, whereas the cells transfected with miR-150 inhibitors grew slower than control cells. These findings suggest that miR-150 promotes cell cycle progression and cell proliferation by suppressing p27Kip1 expression. Our results validated previously reported direct targets of miR-150 in cervical cancer, namely
In conclusion, our results indicate that miR-150 promotes cell cycle progression and cell proliferation of HeLa human cervical cancer cells by directly suppressing p27Kip1 expression. We identified
Not applicable.
No funding was received.
The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.
WO conceived and designed all the experiments. WO and KH performed the experiments. HT, KI, YY, AK, TN and NY analyzed the experimental data. TN and NY contributed to writing of the manuscript. All authors read and approved the final manuscript.
The present study was approved by the Ethics Committee of Kagawa Prefectural University of Health Sciences, Japan.
Not applicable.
The authors declare that they have no competing interests.
Predicted binding site between miR-150 and 3′UTR of
miR-150 directly targets the 3′-UTR of
miR-150 downregulates
miR-150 promotes cell cycle progression. HeLa cells were transfected with miR-150 mimics, miR-150 inhibitors or miRNA controls for 72 h, and the number of cells in each phase of the cell cycle was measured using a flow cytometer and determined with ModFit LT software. (A) Representative DNA content graphic profiles of the cell cycle are presented. ModFit LT program allows to scan the histogram for peaks and to determine the number of cell cycles based on the sizes and positions. Debris is excluded from cell cycle determination by ModFit LT algorithm. The X-axis shows the DNA content. The red region, diagonal line, and green area indicate the G0/G1 phase, S phase, G2/M phase, respectively. (B) The percentages of cells in different cell cycle phases were analyzed and presented as a histogram. Significant differences were assessed using Dunn's test. **P<0.01. Bars represent the mean ± standard deviation of three experiments. miR, microRNA.
miR-150 promotes cell proliferation. HeLa cells were transfected with miR-150 mimics, miR-150 inhibitors or miRNA controls for 72 h, and then, cell proliferation was determined using CCK-8 every 24 h. Significant differences were assessed using a one-way factorial ANOVA test. **P<0.01. Bars represent the mean ± standard deviation of three experiments. miR, microRNA.
Chemically synthesized sequences for dual-luciferase reporter assay
Sequence | 3′UTR of |
||||
---|---|---|---|---|---|
WT-1 (5′-3′) | GG | CTCGAG | AAGUUUAUUCUCAUUUGGGAGA | GCGGCCGC | GG |
WT-1 (3′-5′) | CC | GAGCTC | UUCAAAUAAGAGUAAACCCUCU | CGCCGGCG | CC |
MUT-1 (5′-3′) | GG | CTCGAG | AAGUUUAUUCUCAUAACCCUCU | GCGGCCGC | GG |
MUT-1 (3′-5′) | CC | GAGCTC | UUCAAAUAAGAGUAUUGGGAGA | CGCCGGCG | CC |
WT-2 (5′-3′) | GG | CTCGAG | AAAAUCCGAGGUGCUUGGGAGU | GCGGCCGC | GG |
WT-2 (3′-5′) | CC | GAGCTC | UUUUAGGCUCCACGAACCCUCA | CGCCGGCG | CC |
MUT-2 (5′-3′) | GG | CTCGAG | AAAAUCCGAGGUGCAACCCUCU | GCGGCCGC | GG |
MUT-2 (3′-5′) | CC | GAGCTC | UUUUAGGCUCCACGUUGGGAGA | CGCCGGCG | CC |
WT, wildtype; MUT, mutant; UTR, untranslated region.
Primer sequences for reverse-transcription quantitative PCR.
Gene name | Orientation | Primer sequences |
---|---|---|
Forward | 5′-GGCCTCAGAAGACGTCAAAC-3′ | |
Reverse | 5′-CAGGATGTCCATTCCATGAAG-3′ | |
Forward | 5′-GCACCGTCAAGGCTGAGAAC-3′ | |
Reverse | 5′-TGGTGAAGACGCCAGTGGA-3′ |