In all, 107 human HCC tissue specimens were acquired from patients (aged between 19 and 73 years old, and 93 male, 14 female) between January 2011 and December 2013 at the Department of Hepatobiliary Surgery of Southwest Hospital, Army Medical University (Chongqing, China). All patients provided written informed consent and this study obtained approval from the Ethics Committee of Southwest Hospital. All patients used in this study were followed up for 5 years since their cancer diagnosis. Upon acquisition, HCC and paracancerous liver tissues (free of tumor to the eye) were conventionally 10% formalin-fixed for 48 h on a rotator at room temperature, paraffin-embedded and cut into 10-µm sections.

To perform IHC staining, sections were first deparaffinized, rehydrated and then boiled for 2.5 min in 100°C 0.01 mol/l sodium citrate solution for antigen retrieval. Then the IHC detection kit (SP-9001; ZSGB-Bio, Beijing, China) was employed from blockage of peroxidase to incubation of secondary antibodies according to the manufacturer's instructions. Briefly, 3% H₂O₂ was used to block the endogenous peroxidase at room temperature for 15 min. After blocking with 5% goat serum at room temperature for 30 min, tissues were incubated with specific antibodies: Anti-IκBα (sc-945; 1:50 dilution; Santa Cruz Biotechnology, Inc.) and anti-Erbin (22438–1-AP; 1:50 dilution; ProteinTech Group, Inc.) overnight at 4°C. The following day the sections were incubated with horseradish peroxidase-conjugated secondary antibody, before positive signals were detected using 3,3′-diaminobenzidine and nuclei were stained with hematoxylin at room temperature for 20 sec. After dehydration, representative images were captured with an Olympus BX41 microscope under bright field (magnification, ×100). Histological grading was referred to clinical standards (20).

Huh7 and HCCLM3 cells were purchased from Fudan Cell Bank (Shanghai, China). Cells were maintained in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin solution (Gibco; Thermo Fisher Scientific, Inc.), and cultured at 37°C with 5% CO₂.

Cell transfection with plasmids (HA-tagged IκBα, Flag-tagged NF-κB p65 and corresponding empty vector as control; all Shanghai GeneChem Co., Ltd.) or small interfering RNAs (siRNAs; Shanghai Genepharma Co., Ltd.) was performed using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. In total, 400,000 cells/well were seeded into 6-well plates 1 day before transfection. Plasmids or siRNAs were diluted in Opti-MEM (Gibco; Thermo Fisher Scientific, Inc.) before mixing with Lipofectamine^® 2000. Overexpression vector plasmids were pcDNA3.1 (Shanghai GeneChem Co., Ltd.). Each well of the 6-well plate was added with 2 µg plasmid for transfection. The sequences of siRNA oligos were: siIκBα, 5′-CUCCGAGACUUUCGAGGAATT-3′; siNF-κB p65, 5′-GAUUGAGGAGAAACGUAAAdTdT-3′; and siErbin, 5′-CACACUGUUGUAUGAUCAACCAU-3′. Each well of a 6-well plate was added with 8 µl siRNA (20 µmol/l) for transfection. After 48 h, cells were harvested for successive experiments.

Cell proliferation was assessed using CCK-8 according to the instructions of the manufacturer (Bimake). Then, 24 h after transfection, cells were trypsinized and counted manually. Cells (2,000-3,000 cells/well) were seeded into a 96-well plate and after another 24 h, 10 µl CCK-8 solution was added into each well. The cells were incubated at 37°C for another 2–4 h. A spectrophotometer was then used to measure absorbance at 450 nm.

Transfected cells in DMEM with 10% FBS were seeded into 6-well plate, ~500 cells per well. After 10–14 days, cells that formed visualized colonies were stained with 0.1% crystal violet staining solution (Beijing Solarbio Science & Technology Co., Ltd.) at room temperature for 30 min and images were captured. Colonies with >50 cells were counted manually.

To compare the difference of cell migration after different transfection, 5×10⁴−1.5×10⁵ transfected cells were plated into an 8 µm-pore Transwell chamber, fit for a 24-well plate, with serum free-DMEM. The lower section of the chamber, a 24-well plate, contained normal medium with 10% FBS. FBS acted as attractant to stimulate cell migrate through the membrane of chambers. After incubating for 24 h, cells were fixed by 4% paraformaldehyde for 15 min at room temperature and stained with 0.1% crystal violet staining solution (Beijing Solarbio Science & Technology Co., Ltd.) at room temperature for 30 min. Three different fields were captured under bright field and cells were counted manually (magnification, ×40).

RNA extraction, reverse transcription (RT) and real-time PCR were performed using RNAiso Plus, PrimeScript™ RT reagent kit with gDNA Eraser (Perfect Real Time) and TB Green Premix Ex Taq (Tli RNaseH Plus) (all Takara Bio, Inc.), following the manufacturer's instructions. Temperature and duration for reverse transcription were 37°C for 15 min and 85°C for 5 min. The thermocycling conditions were as follows: Activation of enzyme at 95°C for 30 sec; 30 cycles of denaturation and annealing at 95°C for 5 sec and 60°C for 30 sec. GAPDH was used as the reference gene. The quantitative method to analyze relative gene expression was 2^−ΔΔCq (21). The 5′-3′sequences of primers used in RT-qPCR were as follows: GAPDH forward, TGGCACCGTCAAGGCTGAGAA and reverse, TGGTGAAGACGCCAGTGGACTC; NF-κB p65 forward, CGCTGCATCCACAGTTTCCA and reverse, AGGGGTTGTTGTTGGTCTGG; Erbin forward, TGTGGGTGTGAAGACCTCAG and reverse, GTCGCATCTCCGCCATTTTC; c-Rel forward GGTTGGTCCTGCCTCCTTAC, and reverse, GCTGGAGTCCCAATGACGAA; and enhancer of zeste 2 polycomb repressive complex 2 subunit (Ezh2) forward, GGACCACAGTGTTACCAGCAT and reverse, GTGGGGTCTTTATCCGCTCAG.

Proteins were extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology) with complete protease inhibitor cocktail tablet (Bimake). Protein concentration was calculated by a BCA protein concentration kit (Beyotime Institute of Biotechnology) and 5X SDS loading buffer (Shanghai Shenggong Biology Engineering Technology Service, Ltd.) was added for extraction. The samples were gently vortexed and boiled at 100°C for 10 min before 30 µg was loaded onto 10% polyacrylamide gel (EpiZyme, Inc.). Following electrophoresis, proteins were transferred to nitrocellulose membranes. The membranes were blocked in 5% non-fat milk solution at room temperature for at least 1 h, incubated with primary antibodies at 4°C overnight and then HRP-conjunct secondary antibodies at room temperature for 1 h. Protein blots were detected using the super ECL kit (Nanjing KeyGen Biotech Co., Ltd.). Antibodies used in this study were: Anti-IκBα (sc-945, 1:600 dilution, Santa Cruz Biotechnology, Inc.); anti-NF-κB p65 (#8242, 1:1,000 dilution, Cell Signaling Technology, Inc.); anti-GAPDH (10494-1-AP, 1:5,000 dilution, ProteinTech group, Inc.) and anti-Erbin (22438-1-AP, 1:500 dilution, ProteinTech group, Inc.).

Data are presented as the mean ± SEM, which represented ≥3 independent trials. Comparison between two different groups was performed using unpaired Student's t-test. Comparison among multiple groups was performed using one-way ANOVA and least significance difference was used as the post hoc test. χ² test was used to detect associations between protein expression and clinical characteristics. Survival analysis was performed using Kaplan-Meier method and comparisons with the log-rank test. Statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, Inc.) and SPSS software (22.0 version; IBM Corp.). P<0.05 was considered to indicate a statistically significant difference.

The results indicated that IκBα protein expression was markedly decreased in HCC tissues compared with adjacent tissues (Fig. 1A). In total, 77.6% (83/107) of HCC cases exhibited low expression compared with the matched peri-tumor tissues. Kaplan-Meier survival analysis demonstrated that patients with HCC with low expression of IκBα had a significantly shorter survival time compared with patients with high expression (Fig. 1B). In addition, the association between the expression of IκBα and cancer recurrence was statistically significant (Table I).

To determine the tumor suppressive function of IκBα, CCK-8, clonogenic survival and Transwell migration assays were used to detect proliferation and migration of HCC cells. Knockdown of IκBα significantly promoted cell proliferation and migration, whereas overexpression of IκBα significantly inhibited cell proliferation and migration (Fig. 1C-H). These findings suggested that IκBα was downregulated in HCC tissues and that knockdown of IκBα was positively associated with poor prognosis of patients with HCC.

Although it has been reported that elevated Erbin promotes HCC tumorigenesis (18), the underlying mechanism via which Erbin is upregulated in HCC remains unknown. The results indicated that Erbin expression was upregulated in the HCC tissues from 107 patients in southwest of China (Fig. 2A). Kaplan-Meier survival analysis demonstrated that high expression of Erbin was positively associated with short survival time of patients with HCC (Fig. 2B). Moreover, expression of Erbin was associated with malignant characteristics of HCC, such as TNM stage, existence of vascular tumor thrombi and cancer recurrence (Table II). As both IκBα and Erbin are associated with poor survival of patients with HCC, it was determined whether there was an association between IκBα and Erbin. It was found that knockdown of IκBα promoted Erbin protein expression, while overexpression of IκBα reduced this expression (Fig. 2C and D).

NF-κB/Rel transcription factors present in the cytosol in an inactive state form a complex with inhibitory IκB proteins (7). It has been suggested that NF-κB p65 is released from combination with IκBα and nuclear translocation occurs when IκBα is downregulated in HCC (6). The results indicated that knockdown of IκBα increased NF-κB p65 expression (Fig. 2E), while overexpression of IκBα inhibited NF-κB p65 expression (Fig. 2F). Subsequently, NF-κB activation upon IκB knockdown was examined, as indicated by activation of canonical and non-canonical transcriptional targets of NF-κB, c-Rel and Ezh2 after transfection of siIκBα (Fig. 2G).

To assess whether the transcription factor NF-κB regulates Erbin, the effect of knockdown or overexpression of NF-κB on Erbin at the mRNA and protein levels was measured. In contrast to IκBα, overexpression of NF-κB enhanced both mRNA and protein expression levels of Erbin, whereas knockdown of NF-κB inhibited these expression levels (Fig. 2H-K). Collectively, the results indicated that reduced IκBα promoted NF-κB-mediated Erbin expression at both mRNA and protein levels.

To further evaluate the association between IκBα and Erbin, the expression levels of IκBα and Erbin were analyzed in 107 HCC tissues using IHC staining. It was determined that 77.6% of HCC samples were IκBα-negative or low expression, demonstrating active NF-κB signaling in the majority of cases (Fig. 3A and B). In line with this finding, Erbin protein expression in 58.9% (63/107) of cases was upregulated compared with the adjacent tissues. Thus, there was a negative association between IκBα and Erbin expression levels in HCC tissues (Fig. 3).

Based on the oncogenic function of NF-κB (22) and its positive regulation over Erbin, it was evaluated whether Erbin was responsible for NF-κB-mediated cell proliferation and migration. Overexpression of NF-κB upregulated Erbin expression, and overexpression of Erbin exerted oncogenic effects on the proliferation and migration of HCC cells. However, knockdown of Erbin attenuated the aforementioned cellular abilities (Fig. 4A-F). In addition, increased proliferation and migration of HCC cells by NF-κB overexpression was reversed by Erbin knockdown (Fig. 4G-I), indicating that NF-κB promoted its activities via Erbin signaling. In healthy liver tissues, expression of IκBα limited the activity of NF-κB (6) and, in turn, its downstream target Erbin according to the present results. However, in HCC, NF-κB was abnormally activated due to the absence of IκBα, and transcriptionally upregulated expression of Erbin stimulated the proliferation and migration of HCC cells.