Renal carcinoma specimens (n=10) and the corresponding adjacent normal tissues were obtained by surgical excision from the Department of Urological Surgery in the Fifth Hospital of Xiamen (Xiamen, China) between March 2017 and March 2018. The inclusion criteria were as follows, histologically confirmed renal carcinoma and having adjacent normal tissues as a control. Patients with prior history of RCC that was resected within the past 5 years were excluded from the present study. Patients provided written informed consent in accordance with the legal and institutional ethical guidelines defined by the hospital by the Ethics Committee of the Fifth Hospital of Xiamen (Xiamen, China). The age of patients ranged from 36–85 years, the overall median age was 60.2 years. Adjacent normal tissues were taken from at least 2 cm apart from the tumor border.

Human RCC cell lines ACHN and TK-1 (American Type Culture Collection) were cultured in Dulbecco's modified Eagle's medium (Thermo Fisher Scientific, Inc.) supplemented with 10% (v/v) fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin (Thermo Fisher Scientific, Inc.) and 100 U/ml streptomycin (Thermo Fisher Scientific, Inc.) at 37°C in 5% CO₂.

Tissue sections were dehydrated in gradient concentration of ethanol solution and fixed with 4% paraformaldehyde at room temperature for 30 min, and then paraffin embedded. Consecutive 4-µm sections were used for analysis. Antigen retrieval was performed by microwaving sections in citrate buffer (pH 6.0). Subsequently, slides were incubated overnight with anti-USP22 (cat. no. ab71732; Abcam; 1:1,000) and anti-SURVIVIN (cat. no. 2808; Cell Signaling Technology, Inc.; 1:1,000) antibodies at 4°C. Subsequently, slides were block with goat serum (cat. no. AR0009; Wuhan Boster Biological Technology, Ltd; 1:20) at room temperature for 1 h and then incubated with goat anti-rabbit second antibody (cat. no. ab6721; Abcam; 1:2,000) at RT for 1 h. Streptococcal avidin-biotinylated peroxidase system (Thermo Fisher Scientific, Inc.) was used to develop the color according to the manufacturer's instructions. Tissue sections were visualized using an Olympus microscope IX50 at ×20 magnification and the images were analyzed using ImageJ 1.49 version software (National Institutes of Health). The American Joint Committee on Cancer (AJCC) Staging Manual system was used to assess tumor grades (17).

cDNA fragments encoding USP22 were inserted into pCMV-HA vector to construct an USP22-HA overexpression vector. Short hairpin (sh)RNA targeting sequences for human USP22 (shRNA1: 5′-AAGTCCTGTATCTGCCATGTC-3′, shRNA2: 5′-GTTTCACAAAGAAGCATATTC-3′) or scrambled shRNA (sequence: CCTAAGGTTAAGTCGCCCTCG) were inserted into a pLKO.1-GFP-shRNA construct. ACHN and TK-10 cells were transfected with USP22 shRNA and ACHN cells were transfected with USP22-HA vector using Turbofect (Thermo Fisher Scientific, Inc.). Cell Counting Kit-8 (CCK-8; Thermo Fisher Scientific, Inc.) was used to estimate cell numbers according to manufacturer's instructions, 48 h post-transfection. OD values (450 nm) were measured using a microplate reader (Thermo Fisher Scientific, Inc.). Cell counting assays were performed using ImageJ software version 1.49 [National Institutes of Health (NIH)] to establish growth curves. Each experiment was repeated 4 times in quintuplicate wells per sample by 2 independent experimenters.

ACHN cells were seeded in a six-well plate at 800 cells/well, USP22-specific shRNA and negative control shRNA were transfected into cells using Turbofect (Thermo Fisher Scientific, Inc.) the next day and the cells were cultured for another 7 days at 37°C in 5% CO₂. Cells were stained with crystal violet at room temperature for 10 min, the colonies (>1 mm) in diameter were counted using ImageJ software version 1.49 (NIH) (18).

Kidney tissues (about 100 mg) or ACHN cells (approximately 3×10⁵ cells) were incubated on ice with RIPA buffer (Beyotime Institute of Biotechnology) to extract the total proteins. The protein concentrations were determined with a bicinchoninic acid assay system (Thermo Fisher Scientific, Inc.). Protein samples (40 µg/lane) were separated via SDS-PAGE on a 10% gel (Beijing Solarbio Science & Technology Co., Ltd.), and then proteins were transferred onto nitrocellulose membranes. Membranes were then blocked with 5% BSA (Sigma-Aldrich; Merck KGaA) at room temperature for 1 h and incubated with primary antibodies overnight at 4°C, and then incubated with HRP-labeled goat anti-rabbit secondary antibody (cat. no. A0208; Beyotime Institute of Biotechnology; 1:3,000) or HRP-labeled goat anti-mouse secondary antibody (cat. no. A0216; Beyotime Institute of Biotechnology; 1:3,000) at room temperature for 1 h. Immunoreactive bands were visualized using ECL detection reagents (Thermo Fisher Scientific, Inc.), and protein levels were quantified using ImageJ software (version 1.49; National Institutes of Health). The antibodies were USP22 (cat. no. ab71732; Abcam; 1:2,000), SURVIVIN (cat. no. 2808; Cell Signaling Technology, Inc.; 1:2,000), cleaved-caspase-3 (cat. no. 9664; Cell Signaling Technology, Inc.; 1:2,000), caspase-3 (cat. no. ab197202, Abcam; 1:1,000), phosphorylated (p-)Akt (cat. no. ab38449, Abcam; 1:1,000), Akt (cat. no. ab8805, Abcam; 1:2,000), p-Erk (cat. no. ab131438, Abcam; 1:1,000), Erk (cat. no. ab32537, Abcam; 1:2,000), GAPDH (cat. no. bc002, xmbcss, www.bcssbio.com; 1:2,000), ubiquitin (cat. no. sc-8017, Santa Cruz Biotechnology, Inc.; 1:2,000), HA (cat. no. 51064-2-AP, ProteinTech Group, Inc.; HA sequences: YPYDVPDYA; 1:2,000) and β-actin (cat. no. 23660-1-AP; ProteinTech Group, Inc.; 1:2,000).

The USP22-HA and control plasmid was transfected into 293T cells and 48 h later, the cells were collected and dissolved in cold nucleolysis buffer (50 mmol/l Tris-HCl pH 8.0, 150 mmol/l NaCl, 1% NP-40 (Solarbio), 2% v/v complete protease inhibitor, and NaVO₃). Cells were disrupted with a homogenizer, and the supernatants were collected after 14,000 × g centrifugation for 15 min at 4°C. The supernatants were incubated with anti-USP22 antibody (cat. no. ab71732; Abcam; 1:500) or anti-IgG antibody (cat. no. ab109489; Abcam; 1:500) at 4°C and, 6 h later, protein A + G agarose beads (Santa Cruz Biotechnology, Inc; 1:200) were added to each sample and the samples were incubated overnight at 4°C. The beads were then centrifuged at 8,000 × g for 30 sec at 4°C and washed four times with 1 ml cold lysis buffer, as aforementioned. Then the beads were boiled in 30 µl sample buffer for 5 min, to release the protein from the beads. Proteins were detected via western blotting as mentioned above with USP22 (cat. no. ab71732; Abcam), SURVIVIN (cat. no. 2808; Cell Signaling Technology, Inc.).

Total RNA was isolated from 3×10⁵ cells using the RNAiso™ Plus kit (Tehermo Fisher Scientific, Inc.). Reverse transcriptions were conducted using a cDNA synthesis kit (Toyobo Life Science) in 20 µl reaction system. qPCR was performed using FastStart Universal SYBR Green Master (Roche, Inc.) in 25 µl reaction system with thermocycling conditions: Initial denaturation at 98°C for 30 sec; 35 cycles at 98°C for 10 sec, 60°C for 30 sec, and 72°C for 30 sec; final extension at 72°C for 2 min. The primer sequences were as follows: β-actin forward, 5′-AAGGAAGGCTGGAAGAGGTGC-3′ and reverse, 5′-CTGGAGAGAGAGAGAGAAA-3′; USP22 forward, 5′-GGCGGAGATCACCAGGTAT-3 and reverse, 5′-TTGTGTAGAGACTGTCCGTGGG-3′; and SURVIVIN forward, 5′-TGGCCTTTCAGAGCAGAGTG-3′ and reverse 5′-AAGCCACAGTTAGGGGAACG-3′. RNA extraction, cDNA synthesis, and qPCR performed according to the manufacturer's protocols. Normalized relative expression levels were calculated using the 2^−∆∆Cq (cycle threshold) method (19).

ACHN cells (approximately 3×10⁵ cells) were transfected with control or USP22-HA vector. After 48 h, CHX (500 µM) was added at different time points as indicated, and then cells were harvested. The expression of Survivin was detected via western blot analysis and quantification analysis was performed using ImageJ software (version 1.49; National Institutes of Health).

Statistical analysis was performed using GraphPad Prism 7 software (GraphPad Software, Inc.). All experiments were conducted in triplicate and repeated at ≥3 times unless otherwise specified. The data are presented as mean ± standard error of mean. The statistically significant differences between two groups were calculated with unpaired Student's t-test using GraphPad Prism 7 software (GraphPad Software, Inc.). One-way analysis of variance followed by Tukey's post hoc test were used to compare differences between multiple groups. P<0.05 was considered to indicate a statistically significant difference.

To determine whether the levels of USP22 and survivin are clinically correlated with RCC, 10 pairs of tissues were collected, each consisting of a patient's RCC tissue and an adjacent normal tissue as the control (Table I). The protein levels of USP22 and survivin in RCC were quantified with western blotting. Results indicated that the protein levels of USP22 and survivin in RCC tissues were significantly higher compared with those in control tissues (Fig. 1A and B). USP22 and survivin were also detected in RCC tissues and controls using immunohistochemistry. Analogous to western blotting, immunohistochemistry results also suggested upregulation of both USP22 and survivin in RCC tissues (Fig. 1C). Therefore, it was concluded that USP22 and survivin are co-expressed in RCC cells and their protein levels are upregulated in RCC.

To knockdown USP22 in RCC cells, two pairs of USP22-targeting shRNA were constructed and their knockdown efficiency was validated via western blotting (Fig. 2A). Next, the role of USP22 in the proliferation of human renal carcinoma cell line ACHN and TK-10 cells was evaluated with CCK8 assays. The results indicated that USP22 knockdown significantly inhibited the proliferation of ACHN and TK-10 cells (Fig. 2B-C). Although USP22 silencing demonstrated similar inhibitory effects on both ACHN and TK-1 human RCC cells, only ACHN cells were subjected to the subsequent experiments as the most commonly utilized cell line in RCC research.

It was also determined that the cell number and cloning rate of ACHN cells transfected with USP22 shRNA was significantly lower compared with the cells transfected with control shRNA (Fig. 2D-E, P<0.01 in cell number and P<0.05 in cloning rate), indicating that USP22 may contribute to the proliferation of RCC.

To confirm the aforementioned findings described, a USP22-HA vector was constructed to test whether the overexpression of USP22 promotes the proliferation of ACHN cells. First, the expression of the USP22-HA vector was validated via western blotting. The results indicated that USP22-HA plasmids significantly increased the protein level of USP22 in ACHN cells (Fig. 3A). CCK8, cell number counting and monoclonal colony formation assays were performed to determine the proliferation rate of the cells. The results demonstrated that the overexpression of USP22 significantly increased the proliferation rate and the cell cloning rate of ACHN cells (Fig. 3B-D). These data further confirmed that USP22 may promote the proliferation of RCC.

A previous report has revealed that USP22 regulates the proliferation of hepatocellular carcinoma via the survivin signal pathway (20). In order to study the mechanism of USP22 in regulating the proliferation of RCC, the protein level of survivin was detected in ACHN cells following USP22 knockdown or overexpression. It was revealed that USP22 knockdown significantly decreased the protein level of survivin, and that the overexpression of USP22 had a reverse effect (Fig. 4A). Furthermore, it was found that cleaved caspase-3, a downstream protein of survivin, was decreased following USP22 knockdown and increased by USP22 overexpression (Fig. 4A-D); however, no significant changes were observed in the signal pathway of cell proliferation, including p-AKT, AKT, p-Erk, Erk and ratio of p-AKT/AKT and p-Erk/Erk (Fig. 4A). Notably, it was demonstrated that the mRNA level of SURVIVIN in ACHN cells was not changed by either knockdown or overexpression of USP22 (Fig. 4E). Furthermore, SURVIVIN overexpression rescued the effect of USP22 shRNA on cell proliferation and monoclonal colony formation of ACHN cells (Fig. 4F and G). These results indicate that USP22 regulates ACHN cell expansion via modulating survivin at the post-transcriptional level.

To further investigate the association between USP22 and survivin, the interaction between USP22 and survivin was evaluated via co-immunoprecipitation. It was revealed that the USP22 antibody, but not control IgG, could co-IP with survivin, suggesting that USP22 interacts with survivin (Fig. 5A). Next, the effect of USP22 on the ubiquitination of surviving was examined. ACHN cells were transfected with either USP22-HA or control plasmid. After 48 h of expression, the two groups were immunoprecipitated with anti-survivin antibodies and immunoblotted with an anti-ubiquitin antibody. The results indicated that the ubiquitination level of survivin was decreased after the overexpression of USP22 (Fig. 5B). Cycloheximide chase assays were performed in 293T cells and it was revealed that the degradation of survivin was markedly decreased following overexpression of USP22 (Fig. 5C). Together, these results indicated that USP22 was associated with survivin and regulated the stability of survivin via modulating its ubiquitination level (Fig. 6).