Purified mouse IgG (cat. no. I8765) and mouse IgG_2a (cat. no. M7769) were purchased from Sigma-Aldrich; Merck KGaA. Anti-EpCAM mAbs were purified using Protein G-Sepharose (Cytiva).

All animal experiments were performed in accordance with institutional guidelines and regulations to minimize animal suffering and distress in the laboratory. The Institutional Committee for Experiments of the Institute of Microbial Chemistry (Numazu, Japan) approved the animal studies for ADCC and antitumor activity (approval no. 2019-066). Mice were monitored for health and weight every 1–5 days. Experiments on mice were conducted in ≤3 weeks. Weight loss >25% or tumor size >3,000 mm³ were identified as humane endpoints for euthanasia. At humane and experimental endpoints, mice were euthanized by cervical dislocation, and death was verified by validating respiratory and cardiac arrest.

P3X63Ag8U.1 (P3U1), CHO-K1 and Caco-2 cells were obtained from the American Type Culture Collection. The Genome Network Project clone IRAK021G03 (EpCAM) was provided by the RIKEN BioResource Research Center through the National BioResource Project of the MEXT and AMED agencies of Japan (18–21). EpCAM DNA plus a C-terminal PA tag recognized by the anti-PA tag mAb (NZ-1) was subcloned into a pCAG-Ble vector (FUJIFILM Wako Pure Chemical Corporation). CHO/EpCAM was established by transfecting pCAG/EpCAM-PA into CHO-K1 cells using the Neon Transfection System (Thermo Fisher Scientific, Inc.). CHO-K1 cells (1.5×10⁶) were transfected with 10 µg of plasmid DNA using 100 µl Neon tip, at room temperature. After 4 days, cells were incubated with 1 µg/ml anti-EpCAM mAb (clone 9C4; cat. no. 324202; BioLegend, Inc.) for 30 min on ice and subsequently with Alexa Fluor 488-conjugated anti-mouse IgG (1:1,000; cat. no. 4408; Cell Signaling Technology, Inc.) for 30 min on ice. Positive cells for anti-EpCAM mAb were sorted using an SH800 cell sorter (Sony Corporation), and stable transfectants were cultivated in RPMI-1640 medium (Nacalai Tesque, Inc.) containing 0.5 mg/ml zeocin (InvivoGen). Using TruGuide gRNA tool, gRNA of EpCAM (NM_002354) was selected from GeneArt predesigned gRNAs database (Thermo Fisher Scientific, Inc.). gRNA sequence used was GATCCTGACTGCGATGAGAG(cgg), which targeted exon 3 of EpCAM (Assay ID, CRISPR701274). Double strand gRNA sequence was subcloned into GeneArt CRISPR Nuclease Vector with OFP Reporter (Thermo Fisher Scientific, Inc.). Caco-2/EpCAM-knockout (BINDS-16) cells were generated by transfecting 10 μg of CRISPR/Cas9 plasmids for EpCAM (Thermo Fisher Scientific, Inc.) into Caco-2 cells (1.5×10⁶) for 7 days using a Neon transfection system with 100 µl Neon tip. Stable transfectants were established by cell sorting as aforementioned. P3U1, CHO-K1 and CHO/EpCAM cells were cultured in RPMI-1640 medium (Nacalai Tesque, Inc.). Caco-2 and BINDS-16 were cultured in Dulbecco's modified Eagle's medium (DMEM; Nacalai Tesque, Inc.). The medium was supplemented with 10% heat-inactivated fetal bovine serum (FBS; Thermo Fisher Scientific Inc.), 100 U/ml penicillin, 100 µg/ml streptomycin and 0.25 µg/ml amphotericin B (Nacalai Tesque, Inc.), and the cells were incubated at 37°C in a humidified atmosphere containing 5% CO₂.

The CBIS method (17) was used in the present study to develop mAbs against EpCAM. Briefly, one BALB/c mouse was intraperitoneally (i.p.) immunized with CHO/EpCAM cells (1×10⁸ cells/500 µl) with Imject Alum adjuvant (Thermo Fisher Scientific Inc.). The procedure included three additional immunizations, followed by a final booster injection administered i.p. 2 days before spleen cell harvesting. Spleen cells (1×10⁸ cells) were then fused with mouse plasma cell myeloma P3U1 cells (1×10⁷ cells) using PEG1500 (Roche Diagnostics). The hybridomas were cultured in RPMI-1640 medium supplemented with hypoxanthine, aminopterin and thymidine for selection (50X solution; Thermo Fisher Scientific Inc.). Cell culture supernatants of hybridomas in each well of 96-well plates were mixed with 1×10⁵ CHO/EpCAM cells and were directly screened using flow cytometry.

Caco-2 cells (2.5×10⁵ cells/ml) were harvested after brief exposure to 0.25% trypsin in 1 mM ethylenediaminetetraacetic acid (EDTA; Nacalai Tesque, Inc.). Following washing with 0.1% bovine serum albumin (BSA; Nacalai Tesque, Inc.) in phosphate-buffered saline (PBS), Caco-2 cells were treated with 1 µg/ml of anti-EpCAM mAbs for 30 min at 4°C, followed by Alexa Fluor 488-conjugated anti-mouse IgG (1:1,000; cat. no. 4408; Cell Signaling Technology, Inc.). Fluorescence data were obtained using an EC800 Cell Analyzer (Sony Corporation), and analyzed using the originally installed EC800 software v1.3.6 (Sony Corporation).

Cell pellets were lysed in PBS with 1% Triton X-100 and 50 µg/ml aprotinin (cat. no. 03346-84; Nacalai Tesque, Inc.). Protein concentration was determined using the BCA assay. Cell lysates of CHO-K1, CHO/EpCAM, Caco-2 and BINDS-16 cells were boiled in sodium dodecyl sulfate sample buffer (Nacalai Tesque, Inc.). The samples (10 µg/lane) were then electrophoresed on 5–20% polyacrylamide gels (Nacalai Tesque, Inc.) and transferred to polyvinylidene difluoride membranes (Merck KGaA). Following blocking with 4% milk (Nacalai Tesque, Inc.) for 1 h, the membrane was incubated with anti-EpCAM (1 µg/ml) or anti-β-actin (1 µg/ml; clone AC-15; cat no. A5441; Sigma-Aldrich; Merck KGaA) antibodies for 1 h, followed by incubation with HRP-conjugated anti-mouse IgG (cat. no. P0260, Agilent Technologies, Inc.) or anti-rat IgG (cat. no. A9542; Sigma-Aldrich; Merck KGaA) at a 1:2,000 dilution for 1 h at room temperature. The membrane was developed using the ImmunoStar LD Chemiluminescence Reagent (FUJIFILM Wako Pure Chemical Corporation) and a Sayaca-Imager (DRC Co., Ltd.). All western blotting procedures were performed at room temperature.

Histological sections (4 µm) of a colorectal adenocarcinoma tissue array (cat. no. CO243b; US Biomax Inc.) were autoclaved directly in citrate buffer (pH 6.0; Nichirei Bioscience, Inc.) for 20 min. The sections were then incubated with 1 μg/ml anti-EpCAM mAb for 1 h at room temperature and treated using an Envision+ kit (Agilent Technologies, Inc.) for 30 min at room temperature. The color was developed using 3,3′-diaminobenzidine tetrahydrochloride (Agilent Technologies Inc.) for 2 min at room temperature, and sections were then counterstained with hematoxylin (FUJIFILM Wako Pure Chemical Corporation) for 2 min at room temperature. Hematoxylin and eosin (H&E) staining (FUJIFILM Wako Pure Chemical Corporation) was performed using consecutive colorectal adenocarcinoma tissue sections for 2 min at room temperature.

Caco-2 cells were suspended in 100 µl serially diluted anti-EpCAM mAb (0.006–100 µg/ml), followed by the addition of Alexa Fluor 488-conjugated anti-mouse IgG (1:200; cat. no. 4408; Cell Signaling Technology, Inc.). Fluorescence data were obtained using an EC800 Cell Analyzer, and analyzed using the originally installed EC800 v1.3.6 software (Sony Corporation). The dissociation constant (K_D) was calculated by fitting binding isotherms to built-in, one-site binding models in GraphPad Prism 6 (GraphPad Software, Inc.).

ADCC induction by EpCAM was assayed as follows: A total of 6 female 5-week-old BALB/c nude mice were purchased from Charles River Laboratories, Inc. Following euthanasia by cervical dislocation, the spleens were removed aseptically, and single-cell suspensions were obtained by forcing spleen tissues through a sterile cell strainer (cat. no. 352360; Corning, Inc.) with a syringe. Erythrocytes were lysed by 10-sec exposure to ice-cold distilled water. The splenocytes were washed with DMEM and resuspended in DMEM with 10% FBS; this yield was designated as effector cells. Caco-2 cells were labeled with 10 µg/ml Calcein-AM (Thermo Fisher Scientific, Inc.) and resuspended in DMEM with 10% FBS. Caco-2 cells were transferred to 96-well plates at 2×10⁴ cells/well and mixed with the effector cells at an effector-to-target ratio of 50:1, along with 100 µg/ml anti-EpCAM mAb or control mouse IgG_2a. Following a 4-h incubation, Calcein-AM release into the supernatant was measured in each well using a Power Scan HT microplate reader (BioTek Instruments, Inc.) with an excitation wavelength of 485 nm and an emission wavelength of 538 nm. Cytolytic activity was determined as a percentage of lysis and calculated using the following equation: Lysis (%) = (E - S) / (M - S) × 100, where E is the fluorescence measured in the co-cultures of target and effector cells, S is the spontaneous fluorescence of the target cells, and M is the maximum fluorescence measured after lysis of all cells with a buffer containing 0.5% Triton X-100, 10 mM Tris-HCl (pH 7.4) and 10 mM EDTA.

CDC by EpCAM was assayed as follows: Caco-2 cells were labeled with 10 µg/ml Calcein-AM and resuspended in DMEM with 10% FBS. Caco-2 cells were plated in 96-well plates at 2×10⁴ cells/well, and 10% Low-Tox-M rabbit complement (Cedarlane Laboratories) with 100 µg/ml anti-EpCAM mAb or control mouse IgG_2a was added to each well. Following a 4-h incubation at 37°C, Calcein-AM release into the supernatant was determined in each well. Fluorescence intensity was calculated as described in the ADCC section.

A total of 32 5-week-old female BALB/c nude mice were purchased from Charles River Laboratories, Inc. After a 2-week acclimation period, the mice were used in experiments at 7 weeks of age. Caco-2 cells (0.3 ml; 1.33×10⁸ cells/ml in DMEM) were mixed with 0.5 ml BD Matrigel Matrix Growth Factor Reduced (BD Biosciences), and 100 µl of this suspension (5×10⁶ cells) was injected subcutaneously into the left flank of each animal. On day 1 post-inoculation, 100 µg anti-EpCAM mAb or control mouse IgG in 100 µl PBS was injected i.p. Additional antibody inoculations were performed on days 7 and 12. Tumor formation was measured in mice in the treatment and control groups on days 7, 8, 12, 15 and 17 after Caco-2 cell injection. On day 17 after cell implantation, all mice were euthanized by cervical dislocation, and tumor diameters and volumes were measured and recorded.

Data are presented as the mean ± SEM. Statistical analysis was conducted with one-way ANOVA and Tukey's multiple comparisons tests for ADCC and CDC; one-way ANOVA and Sidak's multiple comparisons tests for tumor volume and mouse weight; and Welch's t-test for tumor weight. All calculations were performed with GraphPad Prism 7 (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

The anti-EpCAM mAb was established by immunizing one mouse with CHO/EpCAM cells and fusing its spleen cells with P3U1 cells. Supernatants from hybridomas, which were positive for CHO/EpCAM and negative for CHO-K1, were selected by flow cytometry. Further screening by immunohistochemistry and western blotting was performed for validation, resulting in the establishment of EpMab-16 (IgG_2a, κ).

Flow cytometry was performed to assess the sensitivity of EpMab-16 in CHO/EpCAM cells and the Caco-2 colorectal adenocarcinoma cell line. As presented in Fig. 1A, EpMab-16 bound to CHO/EpCAM cells, but not CHO-K1 cells. EpMab-16 also bound to Caco-2 but not BINDS-16 cells, indicating that EpMab-16 was specific for EpCAM in the colorectal adenocarcinoma cell line.

Western blotting was performed to further assess the sensitivity of EpMab-16. Lysates of CHO-K1, CHO/EpCAM, Caco-2 and BINDS-16 cells were probed. As demonstrated in Fig. 1B, EpMab-16 detected the 35-kDa band of EpCAM in lysates from CHO/EpCAM and Caco-2 cells, whereas this band was not present in lysates from CHO-K1 and BINDS-16 cells, indicating that EpMab-16 specifically detected both exogenous and endogenous EpCAM. The molecular weight of EpCAM between CHO/EpCAM and Caco-2 was different as a PA tag (12 amino acids) was added to C-terminus of EpCAM in CHO/EpCAM cells.

EpMab-16 detected membrane antigens in colorectal adenocarcinoma tissues in the immunohistochemical analysis (Fig. 2A and B). Among six cases of colorectal adenocarcinoma, five (83%) were positively stained by EpMab-16. No staining was observed without the primary mAb (data not shown). H&E staining was performed to stain nucleus as blue and cytosol as pink, using consecutive colorectal adenocarcinoma tissue sections (Fig. 2C and D). Furthermore, EpMab-16 weakly detected membrane antigens in normal colon tissues (Fig. 2E and F). Among six samples of normal colon tissues, three tissues (50%) were stained by EpMab-16. No staining was observed without the primary mAb (data not shown). H&E staining was performed to stain nucleus as blue and cytosol as pink, using consecutive normal colon tissue sections (Fig. 2G and H).

Kinetic analysis of the interactions of EpMab-16 with Caco-2 cells was subsequently analyzed using flow cytometry. The K_D for EpMab-16 in Caco-2 cells was calculated to be 1.8×10⁻⁸ M (Fig. 3A), indicating a moderate binding affinity of EpMab-16 to colorectal adenocarcinoma cells.

The present study further investigated whether EpMab-16 induced ADCC and CDC antitumor activity in an EpCAM-expressing Caco-2 colorectal adenocarcinoma cell line. As presented in Fig. 3B, EpMab-16 exhibited higher ADCC (44% cytotoxicity) in Caco-2 cells compared with that of control mouse IgG_2a (8.7% cytotoxicity; P<0.01) or control PBS (9.0% cytotoxicity; P<0.01) treatment. EpMab-16 was also associated with more robust CDC activity (49% cytotoxicity) in Caco-2 cells compared with that of control mouse IgG_2a (23% cytotoxicity; P<0.01) or control PBS (21% cytotoxicity; P<0.01) treatment (Fig. 3C). These results suggested that EpMab-16 induced strong ADCC and CDC antitumor activity in vitro.

We further examined whether EMab-16 exerts antitumor activity in vivo. On days 1, 7 and 12 after Caco-2 cell injections into the mice, the Caco-2 ×enograft mouse models were injected with EpMab-16 or control mouse IgG. During the animal experiment, no apparent weight loss due to tumor burden or organ failure was observed among the mice. EpMab-16-treated mice exhibited significantly lower tumor growth on days 7, 8, 12, 15 and 17 (all P<0.01) compared with that in IgG-treated control mice (Fig. 4A). Tumor volume reduction by EpMab-16 treatment reached 66% relative to the control group on day 17. Tumors from EpMab-16-treated mice weighed significantly less compared with those from IgG-treated control mice (60% reduction; P<0.01; Fig. 4B). Resected tumors on day 17 are depicted in Fig. 4C. Total body weights did not significantly differ between the treatment and control groups (Fig. S1). These results indicated that EpMab-16 reduced the growth of Caco-2 ×enografts, but did not altogether eliminate it.