Dr Jian Guo, BGI-Shenzhen, 11, Beishan Industrial Zone, Shenzhen, Guangdong 518083, P.R. China
*Contributed equally
The current study aimed to analyze the genotype-phenotype relationship in patients with variants of zinc finger E box-binding homeobox 2 (
Mowat-Wilson syndrome [MWS; Phenotype Mendelian Inheritance in Man (MIM) no. 235730] was first described in 1998 as a rare condition characterized by dysmorphic facial features, delayed motor development, intellectual disability and multisystem involvement (~1 among 50,000-70,000 live births) (
MWS has been demonstrated to be associated with
The ZEB2 protein contains a number of functional domains, including a nucleosome remodeling and deacetylase-interaction motif, one zinc-finger (ZF) cluster in the amino terminal region (N-ZF), a SMAD binding domain, a homeodomain, a C-terminal binding protein interacting domain, and one ZF cluster in the carboxyl terminal region (C-ZF) (
Up to date, >220 pathogenic variants of
The current study described the identification of two previously described and two novel
The current study assessed two cohorts of patients from the Shenzhen Children's Hospital (Shenzhen, China) between October 2016 and December 2017. The inclusion criteria were: i) Diagnosis of epilepsy based on International League Against Epilepsy criteria (ILAE2017) (
Genomic DNA was isolated from probands' peripheral leukocyte with the QIAamp DNA Blood Mini Kit (Qiagen GmbH), according to the manufacturer's protocol. Leukocyte DNA was also obtained from the parents of the four probands. Sample collection from the adult participants was performed in Shenzhen Children's Hospital (Shenzhen, China) at the same time with the probands between December 12th, 2016 and May 5th, 2017. Totally, eight parents (sex, four males and four females) participated in the study (age range, 30-40 years; median age, 34 years). Whole genome sequencing was conducted using the BGISEQ-500 platform (cat. no. 1000005478; BGI Group) performing paired-end, 100 bp (PE100) sequencing as described previously (
Primers for the amplification of the four
Multiple sequence alignments were generated for homologous ZEB2 sequences to evaluate conservation using T-Coffee (
WGS was performed in 530 patients with epilepsy, developmental delays and intellectual disabilities alone or in combination, as aforementioned. Among these, 4 (~0.75 %) unrelated patients, ranging in age from 2 years and 4 months to 6 years and 5 months, who harbored heterozygous
Each of the four distinct mutations introduced premature stop codons, either directly as a consequence of a codon change to a stop codon, or indirectly as a consequence of a frame shift. In patients 1, 2 and 3, the stop codons were located outside the known protein domains (NM_014795.3:c.290G>A/p.Trp97X; NM_014795.3: c.1067_1068insAGACG/p.Val357Aspfs*15; and NM_014795.3:c.2761C>T/p.Arg 921X, respectively) while in patient 4, the stop codon was located in the C-ZF domain (NM_014795.3:c.3214C>T/p.Gln1072X;
The four patients demonstrated a wide spectrum of phenotypic features (
At the time of diagnosis, all 4 patients exhibited some signs of distinctive facial features of MWS, including a broad nasal bridge, a prominent and pointed chin, a prominent nasal tip, and uplifted earlobes with a central depression. As an example, the characteristic facial appearance of patient 2 is presented in
The wide phenotypic spectrum and varying degrees of disease severity render a clinical diagnosis of MWS difficult, especially when the typical facial features are not clearly present at an early age. Therefore, none of the 4 patients in the current study were identified to carry truncating
The detailed clinical assessment showed considerable patient-to-patient differences in disease manifestations, which ranged from mild in patient 4 to severe in patient 1. While patient 4 presented with mild delayed motor development, intellectual disability and epilepsy, but no multisystem involvements, patient 1 exhibited severely delayed motor development, severe intellectual disability, epilepsy, hypotonia, microcephaly, frontal cortical atrophy, HSCR and hypospadias. The disease severity in patients 2 and 3 was milder compared with that in patient 1 but more severe compared with that in patient 4. The molecular genetic analysis revealed that patient 4 had a truncating mutation in the ultimate exon 10, which encodes a highly conserved cluster of zinc fingers. This mutation resembles one described by Ivanovski
As premature stop codons in the ultimate exon do not lead to nonsense-mediated decay of mRNA and may not alter mRNA stability or translatability (
In contrast to patient 4, patients 1, 2 and 3 all exhibited coding region truncations originating in internal exons (exons 3 and 8) where premature stop codons usually lead to nonsense-mediated decay of the corresponding mRNAs and hence a severe reduction or total absence of polypeptides that otherwise may be derived from them (
Alternatively, it is possible that the mutant mRNAs of patients 1, 2, and 3, as suggested for the mRNA of patient 4, are not subject to nonsense-mediated decay and are translated, leading to accumulation of the truncated proteins. If so, it would appear that the smaller the resulting polypeptide is, the more severe the phenotype. This may be consistent with the earlier notion that while
In conclusion, the current study described 4 patients with
Not applicable.
The current study was supported by the Science and Technology Innovation Commission of Shenzhen (grant no. KJYY20151116165726645) and Sanming Project of Medicine in Shenzhen (grant no. SZSM201812005).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
JL and JG designed the study. FW designed the study and administered the project. DZ completed the recruitment of the patients, collection of the clinical data, analysis of the data, and draft of the manuscript. LW, JD and HX performed data analysis and interpretation. TZ, ZY and QD performed data analysis and provided technical assistance. All authors read and approved the final manuscript.
The current study was approved by the Ethics Committee of the Shenzhen Children's Hospital (Shenzhen, China; reference no. 2017014). All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Declaration of Helsinki and its later amendments. Written informed consent was obtained from all parents or legal guardians of the patients.
Written patient consent for publication was obtained from patients' legal guardians.
The authors declare that they have no competing interests.
Schematic representation of the
Electropherograms of patients with Mowat-Wilson syndrome with
Primers for the amplification of four
Patient | Variant | Primer (5'-3') |
---|---|---|
P1 | c.290G>A (p.Trp97X) | Forward: GATGTAACTGCCGCAATGTGA |
Reverse: GGGGTGGCTGATGTTTCTCA | ||
P2 | c.1067_1068insAGACG (p.Val357Aspfs*15) | Forward: AGTGCCACTAAACCCGTGTG |
Reverse: TGTCCTCCCAGGGCAGATAA | ||
P3 | c.2761C>T(p.Arg921X) | Forward: AGCCCACTGATGGTTTTA |
Reverse: GAGCCTCTGAACTTGACTTT | ||
P4 | c.3214C>T(p.Gln1072X) | Forward: GCCTTCTTTCTCGTGCTCCT |
Reverse: CCATCGATTAGACCGGGGTG |
Clinical features and
Patient characteristic | P1 | P2 | P3 | P4 |
---|---|---|---|---|
Age | 3 y | 2 y 4 m | 3 y 2 m | 6 y 5 m |
Sex | M | F | M | M |
Exon affected by the mutation | 3 | 8 | 8 | 10 |
Mutation | c.290G>A | c.1067_1068insAGACG | c.2761C>T | c.3214C>T |
Novel | No | Yes | No | Yes |
AA | p. Trp97X | p. Val357Aspfs*15 | p. Arg921X | p. Gln1072X |
Inheritance | ||||
CFA | HT, BNB, PNT, UECD, PC | HT, BNB, PNT, UECD, PC | HT, DSE, BNB, PNT, PC | HT, BNB, PNT, UECD, PC |
WA | - |
- |
3 y | 2 y |
ID | ++ | ++ | ++ | + |
Speech | - | - | - | FW |
Epilepsy (medication received) | + | - | + (VPA) | + (VPA, LEV) |
Disposition | Happy | Happy | Happy | Happy |
Hypotonia | + | + | + | - |
MC | + | + | + | - |
BA | FCA | ETV | MD | - |
HSCR | + | - | - | - |
CO | - | + | + | - |
Other organ malformations | Hypospadias | - | - | - |
aNot able to walk at the time of assessment. y, year; m, month; M, male; F, female; AA, amino acid; CFA, characteristic facial appearance; HT, Hypertelorism; BNB, broad nasal bridge; PNT, prominent nasal tip; UECD, uplifted earlobes with a central depression; PC, pointed chin; DSE, deep-set eyes; WA, walking at age; ID, intellectual disability (++ severe, + moderate); FW, few words; VPA, valproate; LEV, levetiracetam; MC, microcephaly; BA, brain anomaly; FCA, frontal cortical atrophy; ETV, enlargement of the third ventricle; MD, myelin dysplasia; HSCR, Hirschsprung disease; CO, constipation;