Dr Weifei Lu, Department of Animal Biotechnology, College of Animal Science and Veterinary Medicine, Henan Agricultural University, 63 Nongye Road, Zhengzhou, Henan 450002, P.R. China
*Contributed equally
Tumor hypoxia contributes to the development of resistance to chemotherapeutic drugs in several human cancer cell lines. Atovaquone, an anti-malaria drug approved by the US Food and Drug Administration, has recently demonstrated anti-cancer effects
Colorectal carcinoma is the second most common type of cancer. Although conventional treatments such as surgical resection, chemotherapy and radiation therapy have decreased the mortality rate of colon cancer, it has been projected that there will be 148,950 estimated new cases and 53,200 estimated deaths in the US in 2020(
Reduced intratumoral oxygen tension (hypoxia) is a feature that is common in a majority of solid tumors and occurs as a result of the abnormal vasculature's limited capacity to deliver oxygen, which cannot meet the demands of the rapidly proliferating cancer cells (
Atovaquone (ATO) is an anti-parasitic drug approved by the US Food and Drug Administration in the treatment of malaria and pneumocystis pneumonia. ATO is structurally similar to coenzyme Q10 and competitively inhibits its binding to the cytochrome bc1 complex, resulting in mitochondrial membrane potential (MMP) collapse and parasite death (
The human HCT-116 colon cancer cell line was purchased from the Cell Bank of the Chinese Academy of Sciences and was cultured in high-glucose DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO2. EpCAM+CD44+ HCT-116 cells were cultured in serum-free DMEM/F12 (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 20 ng/ml epidermal growth factor (EGF), 20 ng/ml basic fibroblast growth factor (bFGF; both from PeproTech, Inc.) and 2% B27 (Gibco; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO2. For hypoxic incubation, cells were cultured in a hypoxic chamber at 37˚C in a humidified atmosphere of 5% CO2, 1% O2 and 94% N2.
EpCAM+CD44+ HCT-116 cells were obtained by magnetic-activated cell sorting as previously described (
In brief, a single-cell suspension of sorted EpCAM+CD44+ HCT-116 cells was cultured in serum-free DMEM/F12 supplemented with 20 ng/ml EGF, 20 ng/ml bFGF and 2% B27. The cells were then seeded on uncoated 6-well culture plates (Corning, Inc.) at a density of 1x104 cells/well. Tumorsphere formation was observed for 4 days and representative images of at least five random fields and were captured using an inverted light microscope (Olympus Corp.) at a magnification of x100.
To evaluate the effect of ATO on tumorsphere formation, a single-cell suspension of EpCAM+CD44+ HCT-116 cells was treated with 15 µM ATO for 3 days under hypoxic conditions, with 50 µM DDP and 0.05% DMSO as a positive and negative control, respectively. The number of tumorspheres was counted under an inverted light microscope (Olympus Corp.) at a magnification of x40.
EpCAM+CD44+ HCT-116 cells were resuspended and incubated in DMEM/F12 supplemented with 10% FBS at 37˚C with 5% CO2. Images of cells before and after 48 h of serum induction were acquired using an inverted light microscope (Olympus Corp.) at a magnification of x200.
To determine the expression of stemness-related genes [OCT-4, SOX-2, Nanog homeobox (NANOG) and C-MYC], total RNA of 1x106 HCT-116 and EpCAM+CD44+ HCT-116 cells was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Complementary DNA was synthesized by RT using a PrimeScript RT kit (Takara Bio, Inc.) according to the manufacturer's instructions and quantified by performing qPCR using the FastStart SYBR Green master mix (Roche Diagnostics, GmbH) on a PikoReal 96 Real-Time PCR system (Thermo Fisher Scientific, Inc.) with the following thermocycling conditions: Initial denaturation for 5 min at 95˚C; and 40 cycles of 95˚C for 5 sec and 60˚C for 30 sec. Likewise, in EpCAM+CD44+ HCT-116 cells treated with 15 µM ATO for 24 h under hypoxic conditions and in the respective controls, the expression levels of apoptosis-associated genes (Bcl-2 and Bax) and invasion-associated genes [MMP-2/-9 and tissue inhibitor of MMPs 1 (TIMP-1)] were evaluated. GAPDH was detected as an internal control. The average Cq values of the target genes were normalized to those of the control genes (∆∆Cq) (
EpCAM+CD44+ HCT-116 cells (5x103/well) were seeded in a 96-well plate and cultured under hypoxic conditions. Cells were incubated with ATO at different concentrations (0, 5, 10, 15 and 20 µM) for 24 h. Triplicate wells were set up for each concentration. Cell viability was measured using an MTS kit (Promega Corp.) according to the manufacturer's protocol. The absorbance was measured at 490 nm using a Multiskan GO microplate reader (Thermo Fisher Scientific, Inc.). All experiments were performed at least three times. The cell viability was determined, and the inhibition ratio was calculated using the following formula: Inhibition ratio (%) = (1-optical density of the treatment group/optical density of the solvent control) x100.
Flow cytometry was performed to analyze cell apoptosis in hypoxia using an Annexin V/PI-FITC kit (Nanjing KeyGen Biotech Co., Ltd.) according to the manufacturer's protocol. In brief, the cells were seeded in a 6-well plate (1x106 cells/well) and cultured under hypoxic conditions. The cells were then treated with ATO (5, 10 or 15 µM) for 24 h, with 50 µM DDP and DMSO used as a positive and negative control, respectively. After washing with PBS, the cells (5x105) were resuspended in binding buffer (500 µl) and stained with Annexin V-FITC (5 µl) and PI (5 µl) in the dark at room temperature for 5 min. The cells were washed with PBS and analyzed within 1 h using a Beckman Coulter FC500 Flow Cytometer with the CellQuest Pro software (version 6.0; BD Biosciences). The experiment was performed for a total of three times.
The MMP was detected by a JC-1 staining assay using the JC-1 Apoptosis Detection kit (Nanjing KeyGen Biotech Co., Ltd.). In brief, the EpCAM+CD44+ HCT-116 cells were dissociated into single cells using TrypLE reagent and then seeded in a 6-well plate (1x106/well). The cells were incubated under hypoxic conditions and treated with 5, 10 or 15 µM ATO for 24 h, with 50 µM DDP and DMSO as a positive and negative control, respectively. After washing with PBS, cells were resuspended in 500 µl binding buffer, and 5x105 cells were stained with JC-1 (5 µl) and incubated in the dark at room temperature for 15 min at 37˚C with 5% CO2 under hypoxic conditions. The cells were then resuspended in incubation buffer (500 µl), washed with PBS and analyzed using a Beckman Coulter FC500 Flow Cytometer with CellQuest Pro software (version 6.0; BD Biosciences). The experiment was performed three times.
In brief, 1x106 EpCAM+CD44+ HCT-116 cells treated with 15 µM ATO were incubated under hypoxic conditions for 24 h. The cells were dissociated into single cells using TrypLE reagent and fixed with ice-cold 70% ethanol for 12 h at 4˚C. The cells were pelleted at 500 x g for 5 min at 4˚C and washed by gently resuspending them in 1 ml PBS. After carefully removing the supernatant, the cells were treated with 50 µl RNaseA (100 µg/ml; Nanjing KeyGen Biotech Co., Ltd.) and stained with 200 µl PI (50 µg/ml) at 37˚C in the dark for 30 min. The stained cells were placed on ice in the dark, washed with PBS and analyzed for PI fluorescence using a Beckman Coulter FC500 flow cytometer with CellQuest Pro software (version 6.0; BD Biosciences). The experiment was performed three times.
An invasion assay was performed using 6.5-mm Transwell plates with sterile 8.0-µm pore polycarbonate membrane inserts (Corning, Inc.) and covered with a thin layer of BD Matrigel (BD Biosciences). In brief, the EpCAM+CD44+ HCT-116 cells (1x105 cells/well) were seeded in a Transwell plate and treated with 15 µM ATO. As positive and negative controls, 50 µM DDP and DMSO were respectively used. DMEM/F12 medium supplemented with 10% FBS was loaded into the bottom chamber through the insert as a chemostatic factor. After incubation for 24 h under hypoxic conditions, the media in the upper and lower chambers were removed and the cells that had invaded the membranes were fixed with 4% paraformaldehyde (500 µl) for 20 min and stained with 0.01% crystal violet for 20 min at room temperature. The cells were counted on an inverted light microscope (Olympus Corp.) and the mean value was determined from counts of five random fields.
Values are expressed as the mean ± standard deviation of data from triplicate experiments. GraphPad Prism (version 6.0; GraphPad Software Inc.) was employed for statistical analysis. Student's t-test or one-way ANOVA followed by Dunnett's test was used in the analysis when appropriate. P<0.05 was considered to indicate statistical significance.
CSCs have a crucial role in tumor initiation, progression and metastasis (
To determine the effects of ATO on cell viability, the EpCAM+CD44+ HCT-116 cells were treated with different concentrations (0-20 µM) of ATO under hypoxic conditions for 24 h. The results indicated that ATO inhibited the proliferation of EpCAM+CD44+ HCT-116 cells in a concentration-dependent manner (
An annexin V-FITC/PI double staining assay and JC-1 assay were performed to determine whether ATO is able to induce apoptosis in EpCAM+CD44+ HCT-116 cells under hypoxic conditions. The results suggested that treatment with 15 µM ATO increased the percentage of Annexin V-positive cells to 38.22±5.18% compared with 8.48±2.75% in the DMSO group and 18.86±2.98% in the DDP group (
Flow cytometric analysis of the cell-cycle profile of EpCAM+CD44+ HCT-116 cells after treatment with 15 µM ATO revealed that the number of cells in S phase significantly increased compared with that of the untreated cells (P<0.01), while the number of cells in G1 and G2 phase decreased accordingly (P<0.01). These results suggested that ATO treatment of EpCAM+CD44+ HCT-116 cells under hypoxia induced cell-cycle arrest in S-phase (
A Transwell invasion assay was performed to investigate the invasiveness of EpCAM+CD44+ HCT-116 cells following treatment with ATO under hypoxic conditions for 24 h. The results indicated that treatment with ATO significantly inhibited the invasion of EpCAM+CD44+ HCT-116 cells as compared with that in the DMSO group (
Hypoxia is a major feature of the tumor microenvironment and results from an imbalance between oxygen supply and oxygen consumption of cancer cells (
EpCAM and CD44 were used as markers for the isolation of colon CSCs from the colon cancer cell line HCT-116 by magnetic-activated cell sorting; in the native cell population, EpCAM+CD44+ HCT-116 cells accounted for 2.38% of all HCT-116 cells, which is consistent with the result of previous studies (
ATO is a cytotoxic and apoptosis-inducing agent that is potent against various cancer cell lines (
In summary, the present
Not applicable.
The current study was supported by the Jilin Province Science and Technology Support Program (grant no. 20200204036YY), the Education Department of Jilin Province (grant no. JJKH20201122KJ) and the Jilin Province Health Technology Innovation Project (grant no. 2017J062).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
CF, WL and YW conceived and designed the experiments. CF and XX performed the experiments. CF drafted the manuscript and supervised the experiments. CF, XX and HX performed data analysis and interpretation. WL and YW verified the results of the experiments, helped with the statistical analysis and revised the manuscript critically for intellectual content. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Isolation and characterization of EpCAM+CD44+ HCT-116 cells. (A) Optical micrographs presenting the morphology of EpCAM+CD44+ HCT-116 cells obtained by magnetic-activated cell sorting cultured over 4 days (scale bar, 50 µm). (B) Serum-induced differentiation of EpCAM+CD44+ HCT-116 cells (left) into adherent cells (right). Scale bar, 25 µm. (C) EpCAM+CD44+ cell percentage among HCT-116 cells prior to and after magnetic-activated cell sorting evaluated by flow cytometry. (D) Reverse transcription-quantitative PCR analyses of NANOG, OCT-4, SOX-2 and C-MYC mRNA expression in EpCAM+CD44+ HCT-116 cells. Values are expressed as the mean ± standard deviation of three independent experiments. *P<0.05 and **P<0.01 vs. HCT-116, as determined by Student's t-test for each gene. NANOG, Nanog homeobox; EpCAM, epithelial cell adhesion molecule.
ATO reduces EpCAM+CD44+ HCT-116 cell viability in hypoxia. (A) EpCAM+CD44+ HCT-116 cells treated with ATO (0-20 µM) for 24 h under hypoxic conditions were assessed for cell viability using an MTS assay. (B and C) ATO (15 µM) inhibited the tumorsphere formation capacity of EpCAM+CD44+ HCT-116 cells under hypoxic conditions. Cells treated with 50 µM DDP used as a positive control. (B) Quantified results and (C) representative microscopy images of the tumorspheres (scale bar, 200 µm). Values are expressed as the mean ± standard deviation of three independent experiments. **P<0.01 and ****P<0.0001 vs. DMSO; #P<0.05 and ##P<0.01 vs. DDP as determined by one-way ANOVA followed by Dunnett's test. DDP, cisplatin; ATO, atovaquone; EpCAM, epithelial cell adhesion molecule.
ATO induces apoptosis of EpCAM+CD44+ HCT-116 cells in hypoxia. (A and B) Flow cytometric analysis of Annexin V/PI staining of EpCAM+CD44+ HCT-116 cells treated with ATO (5, 10 and 15 µM) under hypoxic conditions. (A) Flow cytometry dot plots of cells with Annexin V/FITC and PI fluorescence staining. Apoptotic cells are contained in the lower-right and upper-right quadrants. (B) Quantification of apoptotic cells. (C) Flow cytometric analysis of JC-1 staining assay of EpCAM+CD44+ HCT-116 cells treated with ATO (5, 10 and 15 µM) under hypoxic conditions. (D) Percentage of MMP depolarization. (E) Reverse transcription-quantitative PCR analysis of Bcl-2 and Bax mRNA expression in EpCAM+CD44+ HCT-116 cells treated with ATO (15 µM) under hypoxia. Cells treated with 50 µM DDP were used as the positive control. The relative mRNA expression is presented relative to the DMSO control. Values are expressed as the mean ± standard deviation of three independent experiments. *P<0.05, and ****P<0.0001 vs. DMSO as determined by one-way ANOVA by following Dunnett's test. ATO, atovaquone; DDP, cisplatin; ns, no significance; EpCAM, epithelial cell adhesion molecule; MMP, mitochondrial membrane potential.
ATO inhibits cell proliferation by causing cell-cycle arrest in S-phase. (A) Flow cytometric analysis of cell-cycle progression in EpCAM+CD44+ HCT-116 cells following treatment with 15 µM ATO for 24 h under hypoxic conditions. (B) Number of EpCAM+CD44+ HCT-116 cells in each cell-cycle phase. Cells treated with 50 µM DDP served as the positive control and DMSO was used as a negative control. Values are expressed as the mean ± standard deviation of three independent experiments. *P<0.05, **P<0.01 and ***P<0.001 and ****P<0.0001 as determined by one-way ANOVA followed by Dunnett's test. ATO, atovaquone; DDP, cisplatin; EpCAM, epithelial cell adhesion molecule.
ATO inhibits invasion of EpCAM+CD44+ HCT-116 cells in hypoxia. (A) Optical micrographs presenting the inhibition of EpCAM+CD44+ HCT-116 cell invasiveness after treatment with 15 µM ATO for 24 h under hypoxic conditions according to Transwell invasion assays. Cells treated with 50 µM DDP were used as a positive control. Scale bar, 100 µm. (B) Number of invaded EpCAM+CD44+ HCT-116 cells. (C) Reverse transcription-quantitative PCR analysis of MMP-2, MMP-9 and TIMP-1 mRNA expression in EpCAM+CD44+ HCT-116 cells treated with 15 µM ATO for 24 h under hypoxia. Cells treated with 50 µM DDP served as the positive control. The mRNA expression is presented relative to the DMSO control. Values are expressed as the mean ± standard deviation of three independent experiments. *P<0.05, ***P<0.001 and ****P<0.0001 vs. DMSO as determined by one-way ANOVA followed by Dunnett's test. ATO, atovaquone; DDP, cisplatin, TIMP, tissue inhibitor of MMPs; EpCAM, epithelial cell adhesion molecule.
Primer sequences.
Target gene | Sequence (5'-3') | Product size (bp) |
---|---|---|
GAPDH | F: CAGGAGGCATTGCTGATGAT | 138 |
R: GAAGGCTGGGGCTCATTT | ||
OCT4 | F: GATGTGGTCCGAGTGTGGTTCTG | 195 |
R: CGAGGAGTACAGTGCAGTGAAGTG | ||
NANOG | F: ATGCCTGTGATTTGTGGGCC | 403 |
R: GCCAGTTGTTTTTCTGCCAC | ||
c-MYC | F: CACCAGCAGCGACTCTGAGGAG | 239 |
R: ACTTGACCCTCTTGGCAGCAGG | ||
SOX2 | F: TCCATGACCAGCTCGCAGA | 152 |
R: GAGGAAGAGGTAACCACGGG | ||
MMP-2 | F: GCCTCTCCTGACATTGACCTTGG | 112 |
R: CACCACGGATCTGAGCGATGC | ||
MMP-9 | F: GCACCACCACAACATCACCT | 284 |
R: ACCACAACTCGTCATCGTCG | ||
TIMP-1 | F: CCTGGCTTCTGGCATCCTGTTG | 162 |
R: CGCTGGTATAAGGTGGTCTGGTTG | ||
BCL-2 | F: GGGGAGGATTGTGGCCTTCTTT | 107 |
R: TAATGTGCAGGTGCCGGTTCAG | ||
BAX | F: TAACCAAGGTGCCGGAACTGA | 126 |
R: GGGAGGAGTCTCACCCAACCA |
F, forward; R, reverse; NANOG, Nanog homeobox; TIMP-1, tissue inhibitor of MMPs 1.