Contributed equally
Long non-coding RNAs (lncRNAs) have been discovered to serve important roles in a variety of types of cancer, including cervical cancer. The low expression of lncRNA long intergenic non-protein coding RNA 861 (LINC00861) is related to poor prognosis in ovarian cancer. However, the effects and underlying mechanisms of LINC00861 in cervical cancer remain largely unknown. The present study aimed to examine the role of LINC00861 in the development and progression of ovarian cancer and its underlying mechanisms. The expression levels of LINC00861 and microRNA (miR)-513b-5p were analyzed using reverse transcription-quantitative PCR analysis. Cell proliferation, migration and invasion were measured by using Cell Counting Kit-8, colony formation, wound healing and Transwell assays, respectively. A luciferase assay was used to determine whether miR-513b-5p targeted LINC00861 and PTEN. The expression of protein was measured by using western blot assay. The results of the present study discovered that LINC00861 expression levels were significantly downregulated in cervical cancer tissues and CaSki and ME-180 cell lines. Downregulated LINC00861 expression levels were identified to be associated with an advanced-stage, lymph node metastasis and the poor survival of patients with cervical cancer. Gene Set Enrichment Analysis revealed that the PI3K/AKT/mTOR signaling pathway was significantly enriched in cervical tumors expressing low expression levels of LINC00861 compared with tumors expressing high levels of LINC00861. The overexpression of LINC00861 reduced cervical cancer cell proliferation, migration, invasion and epithelial-mesenchymal transition (EMT) processes, upregulated PTEN protein expression levels and downregulated phosphorylated (p)-AKT and p-mTOR protein expression levels. The regulatory relationship between LINC00861, microRNA (miR)-513b-5p and PTEN was validated using a dual luciferase reporter gene assay. PTEN expression levels were significantly downregulated in the miR-513b-5p mimic group and significantly upregulated in the miR-513b-5p inhibitor group compared with the mimic NC and inhibitor NC in both cell lines. Furthermore, LINC00861 was suggested to serve as a competing endogenous RNA by sponging miR-513b-5p and consequently upregulating the expression levels of PTEN in cervical cancer cells. The expression of PTEN, the phosphorylation of Akt and mTOR and and the EMT phenotype were rescued following co-transfection with LINC00861 and miR-513b-5p mimics. In conclusion, the findings of the present study indicated that the LINC00861/miR-513b-5p axis may inhibit the progression of cervical cancer cells through the PTEN/AKT/mTOR signaling pathway to suppress the EMT process.
Cervical cancer is the fourth most common type of malignancy and a prominent cause of cancer-related deaths in women worldwide (
Long non-coding RNAs (lncRNAs) are transcripts of >200 nucleotides in length that do not encode proteins (
In the current study, the expression levels of LINC00861 were discovered to be significantly downregulated in cervical cancer tissues, as well as CaSki and ME-180 cell lines. The downregulated LINC00861 expression levels were associated with an advanced-stage, lymph node metastasis and the poor survival of patients with cervical cancer. LINC00861 overexpression was also demonstrated to inhibit cervical cancer cell proliferation, migration, invasion and EMT via functioning as a ceRNA for miR-513b-5p, which subsequently regulated the PTEN/AKT/mTOR signaling pathway.
A total of 56 cervical cancer tissues from patients (age, 35–59) with cervical cancer and their matched adjacent normal tissues were obtained from the Department of Gynecology at Yantai Hospital of Traditional Chinese Medicine from April 2017 to December 2018. All samples were collected, snap-frozen in liquid nitrogen and kept at −80°C until use. Patients were included if they were pathologically diagnosed with cervical cancer and had not received anticancer therapy prior to tumor excision. Patients were excluded if they had other malignant tumors. Written informed consent was obtained from each patient. The study protocol was approved by the Research Ethics Committee of Yantai Hospital of Traditional Chinese Medicine (approval no. YTSZYYY2017-112).
All diagnoses were histologically confirmed independently by at least two experienced pathologists following the examination of the sections following hematoxylin and eosin (H&E) staining. Tissues were fixed in 4% paraformaldehyde for 24 h at 25°C, dehydrated, embedded in paraffin, and cut into 4-µm slices for histological staining. These sections were stained with hematoxylin (Beyotime Institute of Biotechnology) for 15 min and eosin (Beyotime Institute of Biotechnology) for 5 min at 25°C. Samples were examined under a light microscope (magnification, ×400; Nikon Corporation).
Human cervical cancer cell lines, CaSki and ME-180, and the human cervical epithelial cell line, Ect1/E6E7, were obtained from the American Type Culture Collection. All cells were maintained in RPMI-1640 medium (HyClone; Cytiva) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), and maintained at 37°C in a humidified atmosphere with 5% CO2.
CaSki and ME-180 cells (1.5×106 cells/ml) were seeded into 6-well plates and transfected with 50 nM pcDNA3.1-LINC00861 or empty vector pcDNA3.1 as a negative control (NC), (both Shanghai GenePharma Co., Ltd.) using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) 37°C for 6 h, according to the manufacturer's protocol. miR-513b-5p expression levels were overexpressed or knocked down by transfecting CaSki and ME-180 cells (1.5×106 cells/ml) with 50 nM miR-513b-5p mimic or miR-513b-5p inhibitor, respectively, or their respective NCs, mimic NC and inhibitor NC (all Shanghai GenePharma Co., Ltd.). The sequences are listed in
CaSki and ME-180 cells were seeded into 96-well plates at a density of 2×103 cells/100 µl and incubated at 37°C for 24, 48 and 72 h. Subsequently, 10 µl CCK-8 solution (Dojindo Molecular Technologies, Inc.) was added to each well and incubated for 2 h. The absorbance at a wavelength of 450 nm was measured in each well using a microplate reader (Bio-Rad Laboratories, Inc.).
CaSki and ME-180 cells were plated into six-well plates at a density of 1×103 cells/100 µl. Following incubation for 12 days at 37°C, the cells were fixed with 4% paraformaldehyde at 25°C for 15 min and stained with 0.1% crystal violet solution at 25°C for 20 min. Colonies were counted under a light microscope (magnification, ×100; Nikon Corporation), with >50 cells considered a colony.
CaSki and ME-180 cells were seeded in six-well plates at a density of 4×105 cells/well. The cell monolayers were scratched using a 200-µl pipette tip once the cultured cells reached 100% confluence and then cultured in serum-free RPMI-1640 medium. At 0 and 24 h, the width of the wound was visualized under a light microscope (magnification, ×100; Nikon Corporation). The wound healing rate was calculated by using the formula: The wound healing rate (%) = (width of the wound at 0 h-width of the wound at 24 h)/width of the wound at 0 h ×100%.
CaSki and ME-180 cells at a density of 4×103 cells/100 µl in serum-free RPMI-1640 medium were plated into the upper chambers of 24-well Transwell plates (Corning, Inc.) precoated with Matrigel (EMD Millipore) at 37°C for 60 min. The lower chambers were filled with 500 µl RPMI-1640 medium supplemented with 10% FBS. Following 24 h of incubation at 37°C, the invasive cells were fixed with 75% methanol at 25°C for 15 min and then stained with 0.1% crystal violet (Sigma-Aldrich; Merck KGaA) for at 25°C 15 min. The invasive cells were visualized under a light microscope (magnification, ×100; Nikon Corporation).
The Diana Tools (
Total RNA was extracted from frozen tissues and cultured cells (CaSki, ME-180, and Ect1/E6E7) using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). 1 µg RNA was reverse transcribed into cDNA using PrimeScript™ RT reagent kit with gDNA Eraser (cat. no. RR047A; Takara Bio, Inc.). qPCR was subsequently performed on an Applied Biosystems 7500 Real-Time PCR system (Thermo Fisher Scientific, Inc.) using the Power SYBR™ Green PCR Master mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was amplified using the following thermocycling conditions: i) Initial denaturation at 95°C for 30 sec; followed by 35 cycles of denaturation at 95°C for 5 sec, annealing at 55°C for 20 sec and extension at 72°C for 20 sec. The primer sequences used for qPCR are listed in
Total protein was extracted from the CaSki and ME-180 cell lines using RIPA lysis buffer (Thermo Fisher Scientific, Inc.). Total protein was quantified by using an Enhanced BCA Protein Assay kit (Beyotime Institute of Biotechnology) and 50 µg protein/lane was separated via 10% SDS-PAGE. The separated proteins were subsequently transferred onto PVDF membranes (EMD Millipore) and blocked by using 5% non-fat milk for 1 h at room temperature. The membranes were then incubated overnight at 4°C with the following primary antibodies (all Cell Signaling Technology, Inc.): Anti-PTEN (1:2,000; cat. no. 9188), anti-phosphorylated (p)-AKT (1:2,000; cat. no. 4060), anti-AKT (1:2,000; cat. no. 9272), anti-p-mTOR (1:2,000; cat. no. 5536), anti-mTOR (1:2,000; cat. no. 2972), anti-E-cadherin (1:2,000; cat. no. 3195), anti-Snail (1:2,000; cat. no. 3879), anti-vimentin (1:2,000; cat. no. 5741) and anti-GAPDH (1:2,000; cat. no. 5174). Following washing with TBST, the membranes were incubated with the HRP-conjugated anti-rabbit secondary antibodies (1:3,000, A0208; Beyotime Institute of Biotechnology). Protein bands were visualized using enhanced chemiluminescence kit (Sigma-Aldrich; Merck KGaA) and imaged using a gel imaging system. The optical densities of the protein bands were measured using Image-Pro Plus software (version 6.0; Media Cybernetics, Inc.).
Overall survival of cervical cancer patients for LINC00861 was done using gene expression profiling interactive analysis (
All experiments were performed ≥3 times. Statistical data are presented as the mean ± SD and statistical analysis was performed using GraphPad Prism 7 software (GraphPad Software, Inc.). A two-tailed paired Student's t-test was used to determine the statistical differences in the LINC00861 expression levels between cervical cancer and matched adjacent normal tissues. The survival analysis was performed using a Kaplan-Meier test and a log-rank test was used to determine the statistical significance between the two groups. A χ2 test was performed to analyze the association between LINC00861 expression levels and the clinicopathological features of the patients with cervical cancer. The remaining two group comparisons were performed using an unpaired Student's t-test. The comparisons among ≥3 groups were conducted using a one-way ANOVA followed by a Tukey's multiple comparisons test. P<0.05 was considered to indicate a statistically significant difference.
To investigate the role of LINC00861 in cervical cancer progression, RT-qPCR analysis was performed to analyze LINC00861 expression levels in 56 cervical cancer and adjacent normal tissues. LINC00861 expression levels were significantly downregulated in the cervical cancer tissues compared with the adjacent normal tissues (
The expression levels of LINC00861 were significantly downregulated in cervical cancer cells (CaSki and ME-180) compared with the human cervical epithelial cell line, Ect1/E6E7 (
In addition to proliferation, the effects of LINC00861 on migration and invasion were also investigated. Wound healing and Transwell invasion assays revealed that the transfection with pcDNA3.1-LINC00861 resulted in significantly reduced cell migratory and invasive abilities compared with cells transfected with pcDNA3.1-NC (
The online bioinformatics software, Diana Tools and TargetScan, predicted that miR-513b-5p contained putative binding sites within the 3′-untranslated region (UTR) of LINC00861 and PTEN (
To understand the underlying mechanism of LINC00861 in cervical cancer progression, GSEA was performed on TCGA cervical cancer datasets. The results revealed that downregulation of LINC00861 was associated with the PI3K/AKT/mTOR signaling (
Western blotting revealed that the overexpression of LINC00861 significantly upregulated E-cadherin expression levels and downregulated Snail and vimentin expression levels compared with the pcDNA3.1-NC + mimic NC group in both cell lines (
The abnormal expression of lncRNAs has been strongly implicated in a wide range of cancer types, such as prostate (
PTEN, an important tumor suppressor gene, is one of the most commonly deleted or mutated tumor suppressors in a variety of types of human cancer, including breast (
Tumor metastasis is the cause of cancer mortality in >90% of cases (
In conclusion, the results of the present study indicated that LINC00861 overexpression may inhibit the proliferation, migration and invasion of cervical cancer cells by sponging miR-513b-5p, which subsequently regulated the PTEN/AKT/mTOR signaling pathway. Therefore, the results suggested that LINC00861 may serve as a tumor suppressor in the development and progression of cervical cancer.
Not applicable.
No funding was received.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XS conceived and designed the study; HL, LZ and XD performed the experiments, analyzed the data and wrote the manuscript. All authors read and approved the final manuscript.
The experimental protocol involving patients was approved by the Research Ethics Committee of Yantai Hospital of Traditional Chinese Medicine (approval no. YTSZYYY2017-112). All patients provided written informed consent for participation.
Not applicable.
The authors declare that they have no competing interests.
Expression levels of LINC00861 in cervical cancer tissues. (A) Reverse transcription-quantitative PCR was used to determine that LINC00861 expression levels were downregulated in cervical cancer tissues compared with normal adjacent tissues. ***P<0.001. (B) Representative hematoxylin and eosin staining images of cervical cancer tissues and their matched adjacent normal tissues. Scale bar, 25-µm. (C) The cervical cancer patients were divided into high LINC00861 expression group (LINC00861 expression > median; n=145) and low LINC00861 expression group (LINC00861 expression ≤ median; n=146). Patients with cervical cancer with low LINC00861 expression had a poorer overall survival compared with patients with higher expression. LINC00861, long intergenic non-protein coding RNA 861.
Overexpression of LINC00861 attenuates cervical cancer cell proliferation. (A) RT-qPCR analysis of LINC00861 expression levels in cervical cancer cells (CaSki and ME-180) and the human cervical epithelial cell line Ect1/E6E7. (B) Transfection efficiency of pcDNA3.1-LINC00861 in CaSki and ME-180 cell lines was confirmed using RT-qPCR. (C) Cell proliferative rate of cervical cancer cells transfected with pcDNA3.1-LINC00861 or pcDNA3.1-NC was analyzed using a Cell Counting Kit-8 assay. (D) Proliferative ability of cervical cancer cells following LINC00861 overexpression was analyzed using a colony formation assay in CaSki and ME-180 cells. *P<0.05, **P<0.01. LINC00861, long intergenic non-protein coding RNA 861; NC, negative control; OD, optical density; RT-qPCR, reverse transcription-quantitative PCR.
Overexpression of LINC00861 attenuates cervical cancer cell migration and invasion. (A) Wound healing assay was used to determine the migratory ability of cervical cancer cells transfected with pcDNA3.1-NC or pcDNA3.1-LINC00861. Scale bar, 100-µm. (B) Invasive ability of cervical cancer cells following LINC00861 overexpression was analyzed using a Transwell assay. Scale bar, 100-µm. (C) LINC00861 overexpression regulated the expression levels of epithelial-mesenchymal transition-related proteins, E-cadherin, N-cadherin and Snail, in cervical cancer cells. *P<0.05, **P<0.01. LINC00861, long intergenic non-protein coding RNA 861; NC, negative control.
LINC00861 competitively binds to miR-513b-5p and regulates PTEN expression levels. (A) LINC00861 3′-UTR sequence containing the putative miR-513b-5p binding sites. (B) Relative luciferase activity of cervical cancer cells was analyzed following the co-transfection with LINC00861-WT or LINC00861-MUT 3′-UTR and the miR-513b-5p mimic or mimic NC. (C) Putative miR-513b-5p binding site in the 3′-UTR sequence of PTEN. (D) Relative luciferase activity was analyzed following the co-transfection with PTEN-WT or PTEN-MUT 3′-UTR and the miR-513-5p mimic or mimic NC into cervical cancer cells. (E) Expression levels of miR-513b-5p were analyzed using reverse transcription-quantitative PCR in cervical cancer cells transfected with the miR-513b-5p mimic, inhibitor or the respective NCs. (F) Expression levels of PTEN were analyzed using western blotting in cervical cancer cells transfected with the miR-513b-5p mimic, inhibitor or respective NCs. **P<0.01. LINC00861, long intergenic non-protein coding RNA 861; NC, negative control; UTR, untranslated region; miR, microRNA; WT, wild-type; MUT, mutant.
Both LINC00861 and miR-513b-5p overexpression modulates the PTEN/AKT/mTOR signaling pathway. (A) Gene Set Enrichment Analysis revealed that the PI3K/AKT/mTOR signaling pathway was enriched in patients from The Cancer Genome Atlas dataset with high LINC00861 expression vs. low LINC00861 expression. (B) Expression levels of PTEN, p-AKT/total AKT, p-mTOR/total mTOR in cervical cancer cell lines transfected with pcDNA3.1-LINC00861 or pcDNA3.1-NC cells were analyzed using western blotting. (C) Western blotting analysis of the relative protein expression levels of PTEN, p-AKT, AKT, p-mTOR and mTOR in cervical cancer cells following the co-transfection with pcDNA3.1-LINC00861 and the miR-513b-5p mimic. **P<0.01. LINC00861, long intergenic non-protein coding RNA 861; NC, negative control; miR, microRNA; p-, phosphorylated.
Both LINC00861 and miR-513b-5p overexpression modulates the epithelial-mesenchymal transition phenotype. Western blotting analysis of the relative protein expression levels of E-cadherin, Snail and vimentin in cervical cancer cells following the co-transfection with pcDNA3.1-LINC00861 and the miR-513b-5p mimic. **P<0.01. LINC00861, long intergenic non-protein coding RNA 861; NC, negative control; miR, microRNA.
Oligonucleotide sequences.
Nucleic acids name | Sequence (5′→3′) |
---|---|
MicroRNA-513b-5p | UUCACAAGGAGGUGUCAUUUAU |
mimic | AAAUGACACCUCCUUGUGAAUU |
Mimic NC | UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT |
MicroRNA-513b-5p inhibitor | AUAAAUGACACCUCCUUGUGAA |
Inhibitor NC | CAGUACUUUUGUGUAGUACAA |
NC, negative control.
Primers used for reverse transcription-quantitative PCR.
Gene | Primer sequence (5′→3′) |
---|---|
Long intergenic non- | F: ATGGTTAGGCACATGGGGTG |
protein coding RNA 861 | R: CCAGGCTCTGGGCAACATTA |
MicroRNA-513b-5p | F: TGGTACTGATGTGATGGACT |
R: TCATATCACACAGCACCGAT | |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT | |
GAPDH | F: ATGGGGAAGGTGAAGGT |
R: AAGCTTCCCGTTCTCAG |
F, forward; R, reverse.
Association between LINC00861 expression levels and the clinicopathological features of patients with cervical cancer.
LINC00861 expression | ||||
---|---|---|---|---|
Variable | n | High (n=28) | Low (n=28) | P-value |
Age, years | 0.179 | |||
<45 | 25 | 15 | 10 | |
≥45 | 31 | 13 | 18 | |
Tumor size, cm | 0.284 | |||
<4 | 26 | 11 | 15 | |
≥4 | 30 | 17 | 13 | |
Histology | 0.313 | |||
Squamous cell carcinoma | 45 | 24 | 21 | |
Adenocarcinoma | 11 | 4 | 7 | |
Differentiation | 0.237 | |||
Well + moderate | 40 | 22 | 18 | |
Poor | 16 | 6 | 10 | |
Lymph node metastasis | 0.035 |
|||
No | 41 | 24 | 17 | |
Yes | 15 | 4 | 11 | |
Tumor stage | 0.016 |
|||
Ib-IIa | 29 | 19 | 10 | |
IIb-IIIa | 27 | 9 | 18 |
P<0.05. LINC00861, long intergenic non-protein coding RNA 861.