Contributed equally
Ovarian cancer (OC) is a common malignant tumor of the female reproductive system. Long non-coding RNAs (lncRNAs) play an important role in OC occurrence and development. Thus, the function and potential mechanism of lncRNA small nucleolar RNA host gene 3 (SNHG3) was explored in the development of OC. The expression of SNHG3, microRNA (miR)-139-5p and Notch homolog 1, translocation-associated (
Ovarian cancer (OC) is one of the most lethal gynecological malignancies in the world (
lncRNAs are non-coding RNA molecules, that do not have protein-coding functions, and participate in biological processes in the form of RNAs (
SNHG3 which is located on 1q36.1 and is also named host gene of U17 (U17HG), is a member of SNHG family (
In the present study, 40 patients with OC and 19 patients with benign OC admitted to Jinan Maternal and Child Health Care Hospital (Jinan, China) from July, 2018 to September, 2019. OC patients were between the ages of 45 and 65 years, with an average age of 51.8±7.6 years. The age of benign OC patients were ranged from 40 to 55 years, with an average age of 48.8±8.6 years. Inclusion criteria included: i) Not receiving any treatment before surgery. ii) Confirmed by pathological examination. iii) The patient underwent follow-up observations. Exclusion criteria included: i) Patients with other malignant tumors. ii) Severe abnormal liver function. iii) Serious lung diseases. iv) Cannot cooperate with the treatment. v) Patients with mental illness or immune disease. This study was approved by the Medical Ethics Committee of Jinan Maternal and Child Health Care Hospital and all subjects signed written informed consent.
Human OC cell lines A2780, SKOV3, OVCAR3 and OV90, and human ovarian epithelial cell line HOSE which were purchased from the American Type Culture Collection (ATCC) were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS), 1% penicillin, and 1% streptomycin in a cell incubator at 37°C and 5% CO2. Cell passage was performed when the degree of cell fusion reached 80%.
Small interfering RNA targeting SNHG3 (si-SNHG3) and control [si-negative contol (NC)], Notch1 overexpression vector (pc-Notch1), miR-139-5p mimic (mimic) and control (miR-NC), miR-139-5p inhibitor (inhibitor) and control (anti-miR-NC) were synthesized by Shanghai GenePharma Co., Ltd. Transfections of siRNA, miRNA mimic/inhibitor as well as their negative controls (50 nM) were performed by Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. After 24 h of incubation at 37°C, the cells were harvested for further analysis. The siRNA, miRNA mimic and inhibitor as well as their negative control sequences were as follows: si-SNHG3, 5′-CCAGAATTGCTTGCCTCAT-3′; si-NC, 5′-CCAGACTGCAGGTTTGAC-3′; mimic, 5′-UCUACAGUGCACGUGUCUCCAG-3′; miR-NC, 5′-UCUCCGAACGUGUCACGU-3′; inhibitor, 5′-ACUGGAGACACGUGCACUGUAGA-3′; anti-miR-NC, 5′-CAGUACUUUUGUGUAGUACAA-3′.
The binding sites between SNHG3 and miR-139-5p, and the target genes of miR-139-5p were predicted using starBase 3.0 (
A CCK-8 assay (Dojindo Molecular Technologies, Inc.) was used to detect cell proliferation according to the manufacturer's instructions. The transfected cells were inoculated into 96 wells with 2×104 cells/well. After cell attachment, they were cultured for 1, 2, 3 and 4 days, and 10 µl of CCK-8 solution was added. Finally, the absorbance of each well at 450 nm was measured using a microplate reader (Bio-Rad Laboratories, Inc.). The experiment was conducted independently in triplicate.
The transfected OC cells were placed into a 6-well plate in a CO2 incubator for 24 h. After the cells were completely attached to the wall, a straight line perpendicular to the cell surface was gently drawn in the petri dish with the tip of a 10-µl pipette. The non-adherent cells were washed off. Image-Pro Plus software (Media Cybernetics, Inc.) was used to measure the scratch width. Cell scratch width was analyzed and the scratch healing rate was calculated. Scratch healing rate = (scratch width at 0 h - scratch width at 24 h)/scratch width at 0 h × 100%. The experiment was repeated three times.
Total RNA was extracted from cells and tissues using TRIzol Reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The Nano-Drop ND1000 spectrophotometer (NanoDrop; Thermo Fisher Scientific, Inc.) was used to detect the ratio of D260/D280 of RNA solution, and calculate the concentration and purity of RNA. The ratio of D260/D280 between 1.8 and 2.1 was used for the next experiment. Total RNA (1 µg) was reverse transcribed into cDNA using the MMLV reverse transcription kit (C&M Biolabs). Using this cDNA as a template, the expression of RNAs in the aforementioned samples was detected using SYBR Green Master Mix (Takara Bio, Inc.) on a BioRad CFX96™ system (Bio-Rad Laboratories, Inc.). The thermocycling conditions were as follows: initiation at 94°C for 30 sec, amplification for 32 cycles at 95°C for 5 sec, 60°C for 30 sec, and 72°C for 30 sec. The relative expression levels of RNAs were represented by a 2−∆∆Cq value (
Cells were lysed in ice-cold RIPA buffer (Beyotime Institute of Biotechnology) containing protease and phosphatase inhibitors after transfection. The lysed proteins were quantified with BCA. After equal amounts of proteins (50 µg) were separated by 10% SDS-PAGE, they were transferred to PVDF membranes. Primary antibodies [Notch1 (dilution, 1:1,000; cat. no. sc-6014; Santa Cruz Biotechnology Inc.) and GAPDH (dilution, 1:1,000; cat. no. 5174; Cell Siganling Technology, Inc.)] were incubated overnight at 4°C after being blocked with 5% skimmed milk for 1 h at room temperature. Then membranes were incubated with a secondary antibody conjugated to HRP (dilution, 1:5,000; cat. no. sc-2004; Santa Cruz Biotechnology Inc.). Finally, an enhanced chemiluminescence (ECL) kit (EMD Millipore) was used to detect protein expression. Densitometric analysis was performed by Image Lab software (version 5.2.1; Bio-Rad, Laboratories, Inc.). The analysis was performed independently in triplicate.
All values were presented as the mean ± SD. GraphPad Prism 5.0 (GraphPad Software, Inc.) statistical software was used to analyze the data with unpaired Student's t-test or ANOVA (parametric) with Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.
The expression level of SNHG3 in OC tissues was significantly higher than normal tissues (
OC cells were collected after 48-h transfection. Compared with the si-NC group, si-SNHG3 could effectively decrease the expression of SNHG3 in OVCAR3 cells (
We carried out bioinformatics analysis through the starBase platform to predict miRNAs that could target SNHG3. The software predicted that miR-139-5p binds to SNHG3 (
In order to understand whether SNHG3 interacts with miR-139-5p, we overexpressed or knocked down SNHG3 or miR-139-5p, and then examined their expression. The downregulation of SNHG3 expression increased the expression of miR-139-5p, indicating that SNHG3 inhibition increased endogenous miR-139-5p expression (
Considering the relationship of SNHG3 and miR-139-5p, SNHG3 and miR-139-5p expression were inhibited to detect OVCAR3 cell proliferation and invasion capabilities (
Then, bioinformatic online analysis (TargetScanHuman 7.2) predicted targets of miR-139-5p. The results revealed that binding sites exist between Notch1 and miR-139-5p (
In order to further verify the regulatory relationship between SNHG3 and miR-139-5p on Notch1, SNHG3 and miR-139-5p expression were interfered in OVCAR3 cells to analyze their effects on Notch1. Notch1 mRNA and protein levels of the si-SNHG3 group were significantly reduced vs. the si-NC group, and miR-139-5p inhibitor reversed this effect (
To explore whether SNHG3/miR-139-5p regulates OVCAR3 cell proliferation and migration via Notch1, Notch1 was overexpressed in OVCAR3 cells. The results revealed that Notch1 expression was increased by pc-Notch1 but decreased by si-SNHG3 or miR-139-5p mimic co-transfection (
OC is a malignant tumor of the reproductive system that affects the health and life of women (
The progression of OC is a complex process, which is regulated by various cytokines and signaling pathways (
As a promising cancer biomarker, miR-139-5p has various roles in different types of tumors (
Studies have revealed that lncRNAs, as carcinogenic or tumor suppressor genes, mainly regulate the expression of miRNA target genes by competitively binding miRNAs, and participate in the occurrence and development of malignant tumors (
There are some shortcomings in our research. For example, additional OC tissue samples should be collected to further explore the correlation between SNHG3 and clinicopathological features in OC. Moreover, two or more OC cell lines, other experiments (such as cell cloning, Transwell assay and RNA immunoprecipitation) and animal experiments should be introduced to investigate the function of SNHG3 in OC. Furthermore, it is possible there are other miRNAs or target genes/signaling pathways that are regulated by SNHG3. Hence, more research is warranted to fully understand the potential molecular mechanism of SNHG3 in OC.
In summary, SNHG3 expression significantly increased and its knockdown reduced cell proliferation and migration abilities in OC. Concurrently, the mechanism of SNHG3 was explored and preliminarily researched. The results demonstrated that SNHG3 can regulate the expression of Notch1 and miR-139-5p, and thus play a role in the development of OC. This provides a scientific basis for further exploration of the mechanism of OC progression and finding new targets for OC treatment.
Not applicable.
No funding was received.
The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.
LZ, GL and HW conceived and designed the study. LZ, XW, YZ and XH were responsible for the collection and analysis of the experimental data. GL and XW interpreted the data and drafted the manuscript. LZ and HW revised the manuscript critically for important intellectual content. All authors read and approved the final manuscript.
The study was approved by the Ethics Committee of Jinan Maternal and Child Health Care Hospital. Signed written informed consents were obtained from the patients and/or guardians.
Not applicable.
The authors declare that they have no competing interests.
Expression of SNHG3 is examined in OC tissues and cells by RT-qPCR. (A) Expression of SNHG3 was increased in OC tissues as revealed by RT-qPCR analysis. (B) RT-qPCR analysis indicated that SNHG3 was upregulated in OC cell lines. **P<0.01, ***P<0.001, ****P<0.0001, compared with normal tissues or HOSE cells. SNHG3, small nucleolar RNA host gene 3; OC, ovarian cancer; RT-qPCR, reverse transciption-quantitative PCR.
SNHG3 regulates cell proliferation and migration in OVCAR3 cells. (A) SNHG3 expression in cells after si-SNHG3 transfection. (B) A CCK-8 assay revealed that cell proliferation of OVCAR3 cells was inhibited after SNHG3 knockdown. (C) A wound healing assay revealed that cell migration of OVCAR3 cells was suppressed by SNHG3 inhibition. *P<0.05 and **P<0.01, compared with the si-NC group. SNHG3, small nucleolar RNA host gene 3; si-SNHG3, small interfering RNA targeting SNHG3; CCK-8, Cell Counting Kit-8; NC, negative control.
SNHG3 directly binds to miR-139-5p. (A) Predicted binding sites between miR-139-5p and SNHG3 were predicted using starBase website. (B) OVCAR3 cells were transfected with miR-139-5p mimic and miR-139-5p inhibitor, respectively. RT-qPCR was performed to assess miR-139-5p expression. (C) A luciferase reporter assay demonstrated that SNHG3 targeted miR-139-5p. (D) RT-qPCR analysis of miR-139-5p expression in OVCAR3 cells after si-SNHG3 transfection. (E) SNHG3 expression was quantified by RT-qPCR, in OVCAR3 cells after miR-139-5p inhibition or overexpression. (F) Expression of miR-139-5p was determined by RT-qPCR in tissue samples. (G) Correlation between SNHG3 and miR-139-5p in OC tissues was evaluated by Spearman correlation analysis. *P<0.05, **P<0.01 and ***P<0.001, compared with miR-NC, anti-miR-NC, normal or the si-NC group. SNHG3, small nucleolar RNA host gene 3; miR, microRNA; si-SNHG3, small interfering RNA targeting SNHG3; OC, ovarian cancer; RT-qPCR, reverse transciption-quantitative PCR; NC, negative control.
Inhibition of miR-139-5p reverses the suppressive effect of SNHG3 silencing on proliferation and migration. (A) miR-139-5p expression was detected by RT-qPCR in OVCAR3 cells after SNHG3 and miR-139-5p inhibition. (B and C) CCK-8 and wound-healing assays were conducted to detect cell proliferation and migration in OVCAR3 cells with SNHG3 and miR-139-5p inhibition. **P<0.01 and ***P<0.001 compared with si-NC; #P<0.05 and ##P<0.001 compared with the si-SNHG3 group. miR, microRNA; SNHG3, small nucleolar RNA host gene 3; si-SNHG3, small interfering RNA targeting SNHG3; CCK-8, Cell Counting Kit-8; NC, negative control.
miR-139-5p directly targets Notch1 in OVCAR3 cells. (A) Putative target sites between miR-139-5p and Notch1 were obtained by bioinformatics analysis. (B) A luciferase reporter assay was used to confirm the binding sites of SNHG3 and miR-139-5p. (C) RT-qPCR and western blot assays were conducted to detect Notch1 expression in OVCAR3 cells after SNHG3 and miR-139-5p inhibition. (D) RT-qPCR was applied to analyze Notch1 mRNA expression in OC tissues. (E) Spearman's correlation analysis revealed the correlation between SNHG3 and Notch1 in OC tissues. **P<0.01 and ***P<0.001, compared with miR-NC, si-NC, or the normal group; #P<0.05. compared with si-SNHG3. miR, microRNA; Notch 1, Notch homolog 1, translocation-associated (
Notch1 overexpression overturns the suppressive effect of SNHG3 knockdown or miR-139-5p overexpression on cell proliferation and migration in OVCAR3 cells. (A) Notch1 expression in OVCAR3 cells. (B and C) Cell proliferation and migration were detected by CCK-8 and wound healing assays. **P<0.01, ***P<0.001 and ****P<0.0001 compared with pc-NC; #P<0.05, ##P<0.01compared with pc-Notch1; $P<0.05, $$P<0.001 compared with the pc-Notch1 +si-SNHG3 group. Notch 1, Notch homolog 1, translocation-associated (
Primer sequences for real-time fluorescence quantification PCR.
Gene name | Primer sequences (5′-3′) |
---|---|
SNHG3 | F TTCAAGCGATTCTCGTGCC |
R AAGATTGTCAAACCCTCCCTGT | |
miR-139-5p | F TCTACAGTGCACGTGTC |
R GAATACCTCGGACCCTGC | |
Notch1 | F TGTTAATGAGTGCATCTCCAA |
R CATTCGTAGCCATCAATCTTGTCC | |
GAPDH | F GCACCGTCAAGGCTGAGAAC |
R TGGTGAAGACGCCAGTGGA | |
U6 | F TCCGATCGTGAAGCGTTC |
R GTGCAGGGTCCGAGGT |
SNHG3, small nucleolar RNA host gene 3; miR, microRNA; Notch1 Notch homolog 1, translocation-associated (