The vascular inflammatory response involves the coordinated action of a large network of molecular mediators and culminates in the transmigration of leukocytes into the site of inflammation. Inflammatory mediators include a variety of protein families, including adhesion molecules such as integrins and members of the immunoglobulin superfamily, as well as other cytokines and chemokines. In this study, a rat model of traumatic skeletal muscle injury was used to demonstrate endoplasmic reticulum resident protein 72 (ERp72) overexpression in the early phase of the inflammatory response that follows skeletal muscle injury. Reverse transcription-quantitative PCR, western blotting, dual-labeling immunohistochemistry and immunofluorescence experiments confirmed that ERp72 was expressed on the endothelial cells of blood vessels present at the injured area. In addition, a cell-based neutrophil adhesion assay indicated that a polyclonal antibody specific for ERp72 significantly reduced adhesion of neutrophils to activated human umbilical vein endothelial cells (35% reduction). These data suggested that ERp72 expression on vascular endothelial cells may play a role in skeletal muscle inflammation and could be considered as a target for the modulation of leukocyte-endothelial cell interactions in an inflammatory setting.
The inflammatory response that follows tissue injury mobilizes a large network of molecular mediators. The coordinated and finely tuned actions of these mediators culminate in the recruitment of leukocytes to the site of injury; a cascade of events regulates leukocyte recruitment and trafficking to the site of injury. Adhesion molecules, such as selectins and integrins, control the process of initial rolling, firm adhesion, crawling and transmigration (
PDI, also known as the β subunit of prolyl 4-hydroxylase, is a 55-kDa soluble protein that constitutes the archetype of the PDI family of proteins, which contains a thioredoxin-like βαβαβαββα fold motif and acts as a dithiol-disulfide oxidoreductase to catalyze the reduction, oxidization and isomerization of disulfide bonds (
Although the chaperone function of PDIs is generally mapped to the endoplasmic reticulum (ER) (
To the best of the authors' knowledge, the majority of studies are focused on PDIs in leukocytes and little to almost no information is available on the role played by endothelial PDIs during cellular activation and recruitment. The present study was initiated following a yeast two-hybrid screening of the binding partner of a biological compound (SI/0220) that is currently under development (Patent FR2909672A1, pending). SI/0220 is a bispecific integrin/selectin biological compound that was engineered to target ICAM1 and P-selectin glycoprotein ligand-1 (
Yeast two-hybrid screening was performed using the Hybrigenics Services technical platform (
A total of 30 female inbred Wistar rats weighing 200–220 g were used to develop the muscle injury model, following institutional guidelines and in conformity with the international standards recommended for animal experimentation. All animal experimental protocols were approved by the Research and Ethics Committee of Arabian Gulf University (Manama, Bahrain). All methods were carried out in accordance with the committee's relevant guidelines and regulations in March 2019. A total of 25 rats were used for the monitoring of gene expression and immunohistochemistry experiments post-injury. The remaining five rats did not undergo muscle injury and were used as an untreated control group.
Rat skeletal muscle injury was performed as described previously (
Total mRNA was extracted from homogenized tissues using the TRIzol® extraction protocol (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed using the ProtoScript® First Strand cDNA Synthesis kit (New England BioLabs, Inc.) according to the manufacturer's instructions. Primer sets for RT-qPCR (
Total proteins were extracted from homogenized vessels using TRIzol as recommended by the manufacturer (Invitrogen; Thermo Fisher Scientific, Inc.). Protein extracts from two rats of each group were resuspended in 1% SDS supplemented with phosphatase and a protease inhibitor cocktail (New England Biolabs, Inc.). The soluble protein concentration was determined using a BCA Protein Assay kit (Thermo Fisher Scientific, Inc.). For western blotting analysis, 20 µg of total protein extract were resolved by SDS-PAGE on 12% gels (
Immunohistochemistry staining was performed on the Ventana Discovery Ultra Chromogenic AmpHQ automated immunostainer (Ventana Medical Systems, Inc.) to determine ERp72 protein expression 2 h post-injury in the aforementioned sections. The multiplex technology uses the sequential application of unmodified primary antibodies with specific heat deactivation steps in between that does not affect the epitope in the tissue (
The pre-diluted anti-ERp72 primary antibody (1:10,000; Abcam; cat. no. ab109869), was applied first at 37°C for 60 min, followed by 16 min incubation at 37°C with ready-to-use OmniMap anti-Rabbit HRP solution (Ventana Medical Systems, Inc.; cat. no. 760-4311) followed by 8 min with ready-to-use ChromoMap DAB kit (Ventana Medical Systems, Inc.; cat. no. 760-159) for single IHC or DISCOVERY Teal HRP Kit (RUO; Ventana Medical Systems, Inc.; cat. no. 760-247) for duplex IHC (
For immunofluorescence, deparaffinization and on-board antigen retrieval were carried out for 64 min at 95°C using the CC1 reagent (Ventana Medical Systems, Inc.; cat. no. 950-500). Blocking buffer (Invitrogen; Thermo Fisher Scientific, Inc.; cat. no. 00-4952-54) was used for section blocking at 37°C for 20 min. Slides were processed using Ventana Medical Systems reagents according to the manufacturer's instructions. A duplex protocol was used; two pre-diluted primary antibodies were sequentially applied for 40 min at 37°C each, in the following order: Rabbit anti-ERp72 (1:10,000, Abcam; cat. no. ab109869) followed by mouse anti-CD34 (1:400; Abcam; cat. no. ab8536) for 40 min at 37°C. Secondary antibodies were then added in the following order using the indicated chromogenic detection: OmniMap anti-Rb HRP (Ventana Discovery; cat. no. 760-4310) and Discovery Rhodamine kit (Ventana Medical Systems, Inc.; cat. no. 760-233), then ready-to-use OmniMap anti-Ms HRP (Ventana Medical Systems, Inc.; cat. no. 760-4310) and Discovery Cy5 kit (Ventana Medical Systems, Inc.; cat. no. 60-238). Sections were then counterstained with DAPI and mounted using Vectashield mounting medium (Vector Laboratories, Inc.). Images were acquired on a Zeiss Axio Observer Z1 Inverted Fluorescence Microscope (Carl Zeiss AG). Image acquisition was performed using HALO™ Image Analysis software v. 2.1 (PerkinElmer, Inc.).
HUVECs were grown in EGM-2 medium (Lonza Group Ltd.). When cells reached 80–90% confluence, they were trypsinized and resuspended at 120,000 cells/ml. Then, 36,000 cells/well (0.3 ml) were plated into a 48-well polystyrene tissue culture plate. For the treatment, HUVEC monolayers were washed once with Hank's balanced salt solution (HBSS) and supplemented with 0.3 ml DMEM media containing 100 ng/ml TNFα (R&D Systems, Inc.; cat. no. 210-TA-100) for 3 h before neutrophils addition. Negative controls were supplemented with DMEM alone.
Experimental protocols were approved by the Research and Ethics committee at Arabian Gulf University. All methods were carried out in accordance with the committee's relevant guidelines and regulations. Participants provided written informed consent prior to enrolment in the study and for the publication of the data. Isolation of neutrophils was performed using Polymorphprep™ density gradient solution (Progen Biotechnik GmbH) to isolate polymorphonuclear granulocytes from whole blood (
2′,7′-Bis-(2-carboxyethyl)-5(and-6)-carboxyfluorescein, acetoxymethyl (BCECF-AM; Invitrogen; Thermo Fisher Scientific, Inc.) was used for neutrophil labeling. Briefly, BCECF-AM was added to the cells at a final concentration of 1 µM and incubated for 30 min at 37°C. Cells were washed twice in HBSS/BSA and resuspended in serum-free RPMI-1640 medium (Sigma-Aldrich; Merck KGaA) to achieve a final concentration of 1×106 cells/ml.
Adherence of BCECF-AM-labeled neutrophils to HUVEC monolayers was evaluated as described previously (
Gene expression analyses were set up in triplicates for each rat. Cell adhesion assay were run in three independent experiments. One-way ANOVA followed by Tukey's post hoc test was used to compare experimental groups to the control for all experiments. All analyses were performed using SPSS statistics software version 27 (IBM Corp.). P<0.05 was considered to indicate a statistically significant difference.
Yeast two-hybrid screening was performed using the coding sequence of SI/0220 as a bait to screen a randomly primed HUVEC cDNA library. The screen identified ERp72 (GenBank ID 157427676) as a prey with a Predicted Biological Score (PBS) of B (high confidence in the interaction). The interacting domain mapping identified the ERp72 domain ranging from amino acids (aa) 172 to 352 as the selected interacting domain (SID) shared by all fragments matching the same reference protein (
RT-qPCR was performed to determine the gene expression levels of
For
To measure differential expression of these target proteins, quantification of their cellular expression in vessels at the site of injury was performed (
Adhesion of human neutrophils to TNFα-activated HUVECs was used to examine the role of ERp72 in cellular adhesion (
The development and progression of leukocyte-mediated tissue injury in inflammatory diseases is a multi-step processes that involves several adhesion molecules and neutrophil extravasation through the endothelial lining (
To investigate the potential role of vascular ERp72 in neutrophil recruitment, ERp72 gene expression was examined in a previously developed rat model of skeletal muscle injury (
The role of PDIs in inflammation and cellular adhesion has been investigated in several previous studies. Passam
Gene expression profiling demonstrated that the majority of upregulated genes in activated human coronary artery endothelial cells exposed to proinflammatory stimuli encode surface, adhesion, and receptor proteins (
It has been reported that thiol exchange on integrins regulates their adhesive function (
The authors thank Mr. Ammar Marweni from Arabian Gulf University (Manama, Bahrain) for his support in the work involving animals and Mrs. Luma Fayez Al Salah from Arabian Gulf University (Manama, Bahrain) for language editing.
This work was funded by an internal research grant from Arabian Gulf University (grant no. LS_NB_18).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
NBK conceived the study and designed the experimental work and data analysis. DAM carried out experimental work and data analysis. DMF conceived the study and analyzed the data. All authors read and approved the final manuscript.
Experimental protocols were approved by the Research and Ethics committee at Arabian Gulf University (Manama, Bahrain). All methods were carried out in accordance with the committee's relevant guidelines and regulations. Participants provided written informed consent prior to enrolment in the study and for the publication of the data.
Participants provided written informed consent for the publication of the data.
The current work used information related to a biological compound cited in patent FR2909672A1 submitted by Professor Dahmani Fathallah (Department of Life Sciences, Arabian Gulf University, Bahrain), Dr M. Ali Jarboui (Institut Pasteur, Tunis, Tunisia) and Professor Koussay Dellagi (Institut Pasteur, Tunis, Tunisia) on 11/12/2006 and filed by Institut Pasteur of Tunis, which is currently undergoing renewal.
2′,7′-bis-(2-carboxyethyl)-5(and-6)-carboxyfluorescein acetoxymethyl
endoplasmic reticulum
Hank's balanced salt solution
human umbilical vein endothelial cell
neutrophil
protein disulfide isomerase
polymorphonuclear neutrophil
Yeast two-hybrid screening results. ERp72 (PDIA4) was identified as a binding partner of SI/0202. Interacting domain mapping identified the ERp72 domain ranging from aa172 to aa 352 as the SID (orange). Conserved domains are indicated in green. The transmembrane domain is indicated in red. The signal peptide is indicated in yellow. The coiled coil domain is indicated in purple. Aa, amino acid; ERp72, endoplasmic reticulum resident protein 72; PDIA4, protein disulfide isomerase family A member 4; SID, selected interacting domain.
Gene expression profiling.
Multiplex immunohistochemistry and immunofluorescence. (A) Multiplex immunohistochemistry showing co-localization of ERp72 (teal) and CD34 (brown) in the endothelial cells of the blood vessels in the control tissue sample (red arrow). (B and C) Multiplex immunofluorescence using anti-ERp72 (red) and anti-CD34 (cyan) with DAPI counterstaining (blue) showing the co-localization of the two markers in the endothelial cells of the blood vessels (white arrows) (B) in control tissue before injury and (C) in tissue 2 h post-injury. ERp72, endoplasmic reticulum resident protein 72.
ERp72 expression in blood vessels. (A) Immunohistochemical quantification of ERp72 (teal) expression in endothelial cells of vessel-containing zones (red arrows) in control samples and 2 h post-injury. For image analysis, the levels of expression of target proteins on endothelial cells are classified as low (blue), medium (yellow) and high (red). (B) Percentage distribution of cells with high, medium and low expression of ERp72 in control, or 2 and 4 h post-injury. A single rat was used for the analysis from each group. (C) Western blot detection of ERp72 (right panel) and β-actin (left panel) expression in total vessels extracts 2 h post-injury. Lane 1, molecular weight marker; lane 2, control rat; lane 3, treated rat 2 h post-injury. ERp72, endoplasmic reticulum resident protein 72.
Anti-ERp72 blocks neutrophil adhesion. (A) Neutrophil adhesion to TNFα-activated HUVECs was quantified in the presence of different concentrations of anti-ERp72 antibody. Data are presented as a percentage of neutrophil adhesion to TNFα-activated control cells without antibody treatment (anti-ERp72 0 µg/TNFα +). Negative controls (anti-ERp72 0 µg/ml/TNF α+, anti-ERp72 25 µg/ml/TNFα+ and Neutrophil (NPH)-/TNFα-) and anti-ERp5 isotype control (anti-ERp5 100 µg/ml/TNFα +) are shown. ***P<0.001). (B) Representative light microscopy image of neutrophils following treatment with 100 ng/ml TNFα. HUVECs are the elongated cells observed in the background. Representative fluorescence microscopy images of (C) neutrophils stained with BCECF-AM-labeled dye following treatment with 100 ng/ml TNFα, (D) 100 ng/ml TNFα and 25 µg/ml anti-ERp72 antibody, or (E) without any treatment as a control. BCECF-AM, 2′,7′-bis-(2-carboxyethyl)-5(and-6)-carboxyfluorescein acetoxymethyl; ERp72, endoplasmic reticulum resident protein 72; HUVEC, human umbilical vein endothelial cell.
List of primers used for reverse transcription-quantitative PCR.
Primer name | Target gene | Primer sequence (5′→3′) | Melting temperature, °C | Product size, bp |
---|---|---|---|---|
PDI4F1 | TGCAGCCTGAGAAGTTCCAG | 59.96 | 200 | |
PDI4R1 | GCTGAAGTCCACGCTGTAGT | 60.04 | 200 | |
ICAMF | GGTATCCATCCATCCCACAG | 60.01 | 208 | |
ICAMR | GCCACAGTTCTCAAAGCACA | 60.03 | 208 | |
VCAMF | ACAAAACGCTCGCTCAGATT | 60.02 | 152 | |
VCAMR | GTCCATGGTCAGAACGGACT | 59.97 | 152 | |
E-seleF | TTTTTGGCACGGTATGTGAA | 59.97 | 168 | |
E-seleR | AGGTTGCTGCCACAGAGAGT | 60.06 | 168 | |
GAPDHF | CTCATGACCACAGTCCATGC | 59.80 | 155 | |
GAPDHR | TTCAGCTCTGGGATGACCTT | 59.90 | 155 |