A number of microRNAs (miRs) have been revealed to be involved in the development of osteoporosis, including postmenopausal osteoporosis. The aim of the present study was to investigate miR-135a-5p expression and the cellular function of miR-135a-5p and its underlying mechanism in postmenopausal osteoporosis. miR-135a-5p expression levels in the femoral neck trabecular bone tissue fragments from postmenopausal women with or without osteoporosis were detected by reverse transcription-quantitative polymerase chain reaction and western blot analysis. The role of miR-135a-5p during osteogenic differentiation was examined by performing gain- and loss-of-function experiments using miR-135a-5p mimic or inhibitor. TargetScan bioinformatics analysis was sued to predict targets of miR-135a-5p, which were confirmed using luciferase reporter assays. miR-135a-5p expression was significantly upregulated in femoral neck trabecular bone tissue fragments from postmenopausal women with osteoporosis compared with postmenopausal women without osteoporosis. In addition, miR-135a-5p expression levels significantly decreased during osteogenic differentiation in the C2C12 cell model. miR-135a-5p overexpression decreased the osteogenic potential of C2C12 cells, as miR-135a-5p overexpression significantly reduced the expression levels of several key osteoblast markers, whilst miR-135a-5p knockdown had the opposite effect. Furthermore, the current study demonstrated that RUNX2 was a direct target of miR-135a-5p. Rescue experiments indicated that RUNX2 overexpression significantly reversed the effect of miR-135a-5p mimic on the osteogenic potential of C2C12 cells, indicating that miR-135a-5p mediates osteogenic differentiation via direct targeting of RUNX2. Taken together, these results suggest that miR-135a-5p may serve a role in osteoporosis progression by regulating osteogenic differentiation via RUNX2.
Osteoporosis is a common chronic metabolic bone disease characterized by low bone mineral density and low-traumata fractures (
Restoring and maintaining the balance between bone formation and bone resorption is an effective way to treat postmenopausal osteoporosis (
MicroRNAs (miRNAs or miRs) are a family of small non-coding single stranded RNAs, which can negatively regulate the expression of target genes during various cellular events, including proliferation, apoptosis and differentiation by binding to the 3′untranslated region (UTR) of target genes (
The aim of the present study was to investigate miR-135a-5p expression and the cellular function of miR-135a-5p and its underlying mechanism in postmenopausal osteoporosis.
Bone fragments were obtained from 20 postmenopausal female patients (54–71 years old) with osteoporosis who underwent hip replacement for osteoporotic fractures (OP) at Ningbo First Hospital between April 2015 and April 2017. The control group were recruited at the same time and consisted of 20 postmenopausal female patients (52–74 years old) with osteoarthritis only and not osteoporosis, according to BMD and T-score measurements (0.791±0.081 and −0.26±0.831, respectively). Bone fragments, which were extracted from the transcervical region of the femoral neck, were dissected into smaller fragments, washed three times in PBS and stored at −80°C until further use. The present study was approved by the Ethics Committee of Ningbo First Hospital (Ningbo, China) and written informed consent was obtained from each patient.
To extract total RNA, bone fragments in TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) were homogenized using a tissue homogenizer (Omni International, Kennesaw, GA, USA) and total RNA was extracted using the RNA RNeasy kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's protocol.
Mouse myoblast cell line C2C12 (ATCC® CRL-1772™) was purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in Dulbecco's modified Eagle medium (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% fetal bovine serum (Invitrogen; Thermo Fisher Scientific, Inc.) and 1% streptomycin and penicillin mix solution, and maintained at 37°C in a 5% CO2-humidified incubator.
The C2C12 cell line is a typical pluripotent mesenchymal precursor cell line that possesses the potential to differentiate into myoblasts, chondroblasts and osteoblasts (
C2C12 cells were seeded in 6-well plates at a density of 1×106 cells/well and cultured at 37°C for 24 h. miRNA mimic and inhibitor were obtained from Shanghai GenePharma Co., Ltd. (Shanghai, China). Cells were subsequently transfected with 100 nM miR-135a-5p mimic (5′-UAUGGCUUUUUAUUCCUAUGUGA-3′), 100 nM mimic control (5′-UCUCCAAACGUGUCACCUTT-3′), 100 nM miR-135a-5p inhibitor (5′-UCACAUAGGAAUAAAAAGCCAUA-3′), 100 nM inhibitor control (5′-CAGUACUUUUGUGUAGUACAA-3′), 2 µl control-plasmid (cat. no. sc-108083), 2 µl RUNX2-plasmid (cat. no. sc-400183-ACT; both Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), miR-135a-5p mimic+control-plasmid or miR-135a-5p mimic+RUNX2-plasmid using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Cells without any treatment were considered as the control group. Transfection efficiency was detected following 24-h transfection using RT-qPCR.
Following a 24-h transfection with miR-135a-5p mimic, mimic control, miR-135a-5p inhibitor, inhibitor control, miR-135a-5p inhibitor+control-siRNA or miR-135a-5p inhibitor+RUNX2- siRNA, the ALP activity of C2C12 cells was detected. As previously described (
Total RNA was extracted from C2C12 cells using TRIzol reagent, according to the manufacturer's protocol. Total RNA was reverse transcribed into cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. qPCR was subsequently performed using the 2X SYBR Green PCR Master mix (Applied Biosystems; Thermo Fisher Scientific, Inc.). Primer sequences used for the qPCR were as follows: GAPDH forward, 5′CTTTGGTATCGTGGAAGGACTC3′ and reverse, 5′GTAGAGGCAGGGATGATGTTCT3′; U6 forward, 5′GCTTCGGCAGCACATATACTAAAAT3′ and reverse, 5′CGCTTCACGAATTTGCGTGTCAT3′; miR-135a-5p forward, 5′TTGGTCTTGTTTCCCGGTCC3′ and reverse, 5′TCACAGCTCCACAGGCTAAC3′; osteocalcin (OC) forward, 5′CTGACCTCACAGATCCCAAGC3′ and reverse, 5′TGGTCTGATAGCTCGTCACAAG3′; Osterix forward, 5′ACCAGGTCCAGGCAACAC3′ and reverse, 5′-GCAAAGTCAGATGGGTAAGTAG-3′; ALP forward, 5′CTTGACTGTGGTTACTGCTGATCA3′ and reverse, 5′GTATCCACCGAATGTGAAAACGT3′; and RUNX2 forward, 5′AGTCCCAACTTCCTGTGCTCC3′ and reverse, 5′CGGTAACCACAGTCCCATCTG3′. The thermocycling conditions were as follows: Initial denaturation at 95°C for 10 min; 35 cycles of 95°C for 15 sec and 55°C for 40 sec. Relative mRNA expression was quantified using the 2−ΔΔCq method and normalized to the internal reference gene U6 or GAPDH, respectively (
Following treatment with BMP2, total protein was extracted from C2C12 cells using RIPA buffer (cat. no. P0013E; Beyotime Institute of Biotechnology). Total protein was quantified using a bicinchoninic acid assay kit (cat. no. BCA1-1KT; Sigma-Aldrich; Merck KGaA) and 30 µg protein/lane was separated via SDS-PAGE on a 10% gel. The separated proteins were subsequently transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA) and blocked for 1.5 h at room temperature with 5% non-fat milk. The membranes were incubated with primary antibodies ALP (cat. no. sc-365765), Osterix (cat. no. sc-393060; both Santa Cruz Biotechnology, Inc.), OC (cat. no. Ab93876; Abcam), Runx2 (cat. no. 12556) and β-actin (cat. no. 4970; both Cell Signaling Technology, Inc., Danvers, MA, USA; all 1:1,000) overnight at 4°C. Subsequently, membranes were incubated with a horseradish peroxidase-conjugated anti-rabbit immunoglobulin G secondary antibodies (1:2,000; cat. no. 7074; Cell Signaling Technology, Inc.) for 3 h at room temperature. Protein bands were visualized using an enhanced chemiluminescence reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol.
TargetScan bioinformatics software (
Data are presented as the mean ± standard deviation. All statistical analyses were performed using SPSS statistical software (version 18.0; SPSS, Inc., Chicago, IL, USA). The statistical significance of differences between two groups was analyzed using Student's t-test. One-way analysis of variance followed by Tukey's post hoc test was used to analyze differences among multiple groups. All experiments were repeated three times. P<0.05 was considered to indicate a statistically significant difference.
To determine whether miR-135a-5p was involved in the development of osteoporosis, the expression level of miR-135a-5p was detected using RT-qPCR in the bone tissue fragments from postmenopausal women with and without osteoporosis. The results revealed that the expression level of miR-135a-5p was significantly increased in postmenopausal women with osteoporosis compared with the postmenopausal women without osteoporosis (
To investigate the function of miR-135a-5p in osteoporosis, the expression level of miR-135a-5p was detected during osteogenic differentiation induced by BMP2 in C2C12 cells. To confirm the successful induction of osteogenic differentiation, the relative mRNA expression level of key osteoblast markers OC, osterix, and ALP were detected using RT-qPCR. The relative mRNA expression levels of OC, osterix and ALP were significantly increased following treatment with BMP compared with the control group (
To further investigate the function of miR-135a-5p in osteogenic differentiation, C2C12 cells were treated with 2 nM BMP2 following transfection with miR-135a-5p mimic, mimic control, miR-135a-5p inhibitor or inhibitor control. Transfection efficiency was detected using RT-qPCR following 24-h transfection. The expression level of miR-135a-5p was significantly increased in BMP-treated C2C12 cells following transfection with miR-135a-5p mimic compared with the control (
To determine the effect of miR-135a-5p in osteogenic differentiation, changes in mRNA and protein expression levels of specific osteoblast markers were examined. The mRNA and protein expression levels of OC, osterix and ALP were significantly decreased in BMP-treated C2C12 cells following transfection with miR-135a-5p mimic compared with the control, whilst the opposite effect was observed following transfection with miR-135a-5p (
To investigate the molecular mechanism of miR-135a-5p in osteogenic differentiation, TargetScan (
The mRNA expression level of RUNX2 was detected using RT-qPCR in the bone tissue fragments from postmenopausal women with and without osteoporosis. The current study demonstrated that the mRNA expression level of RUNX2 was significantly decreased in postmenopausal women with osteoporosis compared with the postmenopausal women without osteoporosis (
miR-135a-5p overexpression inhibits osteogenic differentiation in C2C12 cells by targeting RUNX2. To investigate whether miR-135a-5p serves a role in osteogenic differentiation by direct targeting of RUNX2, C2C12 cells were treated with 2 nM BMP2 following transfection with miR-135a-5p mimic, mimic control, control-plasmid, RUNX2-plasmid, miR-135a-5p mimic+control-plasmid or miR-135a-5p mimic+RUNX2-plasmid. Transfection efficiency was detected using RT-qPCR following 24-h transfection. The expression level of RUNX2 was significantly increased in BMP-treated C2C12 cells following transfection with RUNX2-plasmid compared with the control (
The mRNA and protein expression levels of OC, osterix and ALP were decreased in BMP-treated C2C12 cells following transfection with miR-135a-5p mimic compared with the control, however these effects were reversed following transfection with RUNX2-plasmid (
In the present study, the miR-135a-5p expression level was significantly increased in postmenopausal women with osteoporosis. However, during osteogenic differentiation
In China, osteoporosis is a common bone-related disease (
Several studies have indicated that miRNAs serve an important role in the regulation of osteoblastic differentiation or bone formation (
The relative miR-135a-5p expression level in the bone tissue fragments of postmenopausal women with and without osteoporosis was examined. The current study demonstrated that the expression level of miR-135a-5p was significantly upregulated in postmenopausal women with osteoporosis. Further analysis indicated that miR-135a-5p expression was downregulated during osteogenic differentiation. Overexpression of miR-135a-5p inhibited osteogenic differentiation, whilst miR-135a-5p knockdown enhanced osteogenic differentiation. To further investigate the underlying molecular mechanism of miR-135a-5p in osteogenic differentiation, the direct interaction between miR-135a-5p and RUNX2 was predicted using TargetScan and confirmed using dual-luciferase reporter assay. To investigate whether miR-135a-5p serves a role in osteogenic differentiation by direct targeting of RUNX2, rescue experiments were performed. The inhibitory effect of miR-135a-5p on osteogenic differentiation was reversed by RUNX2 overexpression, indicating that miR-135a-5p can inhibit osteogenic differentiation via RUNX2.
In conclusion, the current study demonstrated that miR-135a-5p expression was upregulated in postmenopausal women with osteoporosis, and miR-135a-5p inhibited osteogenic differentiation via direct targeting of RUNX2. Therefore, miR-135a-5p may be a promising therapeutic target for the treatment of postmenopausal osteoporosis.
Not applicable.
The present study was supported by the Ningbo Natural Science Foundation Project (grant no. 2017A610278).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XS contributed to study design, data collection, statistical analysis and data interpretation. ZZ contributed to data collection, manuscript preparation and the literature search.
The present study was approved by the Ethics Committee of Ningbo First Hospital (Ningbo, China) and written informed consent was obtained from each patient.
Not applicable.
The authors declare that they have no competing interests.
Relative miR-135a-5p expression in postmenopausal women with osteoporosis. The relative miR-135a-5p expression level was determined by, reverse transcription-quantitative polymerase chain reaction in bone tissue fragments from postmenopausal women with osteoporosis and without osteoporosis (Control). Data are presented as the mean ± standard deviation from three independent experiments. **P<0.01 vs. Control. miR, microRNA.
Relative miR-135a-5p expression during osteogenic differentiation. C2C12 cells were treated with 2 nM BMP2 for 24 h to induce osteogenic differentiation. (A) The relative mRNA expression level of OC, osterix and ALP were determined by RT-qPCR. **P<0.01 vs. Control. (B) The relative miR-135a-5p expression level was determined by RT-qPCR in C2C12 cells following treatment with BMP2 for 0, 6, 12 and 24 h. Data are presented as the mean ± standard deviation from three independent experiments. *P<0.05 and **P<0.01 vs. 0 h. miR, microRNA; BMP2, bone morphogenetic protein 2; OC, osteocalcin; ALP, alkaline phosphatase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
Effect of miR-135a-5p in osteogenic differentiation. To explore the function of miR-135a-5p in osteoblast differentiation, C2C12 cells were treated with 2 nM BMP2 for 24 h following transfection with miR-135a-5p mimic, mimic control, miR-135a-5p inhibitor or inhibitor control, respectively, for 2 h. (A) The relative miR-135a-5p expression level was determined by RT-qPCR in C2C12 cells following transfection with and treatment with BMP2. (B) The relative protein expression level of OC, Osterix and ALP were determined by western blot analysis in C2C12 cells following transfection and treatment with BMP2. The relative mRNA expression level of (C) OC, (D) Osterix and (E) ALP were determined by RT-qPCR in C2C12 cells following transfection and treatment with BMP2. (F) ALP activity was examined in C2C12 cells following transfection and treatment with BMP2. Data are presented as the mean ± standard deviation from three independent experiments. **P<0.01 vs. Control. miR, microRNA; BMP2, bone morphogenetic protein 2; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; OC, osteocalcin; ALP, alkaline phosphatase.
RUNX2 is a direct target of miR-135a-5p. (A) TargetScan bioinformatics analysis was used to predict the miR-135a-5p binding site in the 3′UTR of RUNX2. (B) Luciferase reporter assays were performed in C2C12 cells following co-transfection with luciferase reporter plasmids containing wild-type RUNX2 3′UTR or mutant RUNX2 3′UTR and miR-135a-5 mimic or mimic control. Data are presented as the mean ± standard deviation from three independent experiments. **P<0.01 vs. Mimic control. (C) The relative RUNX2 mRNA expression level was determined by RT-qPCR in bone tissue fragments from postmenopausal women with osteoporosis and without osteoporosis (Control). The relative RUNX2 (D) mRNA and (E) protein expression levels were detected by RT-qPCR and western blot analysis, respectively, in C2C12 cells following treatment with BMP2 for 0, 6, 12 and 24 h. Data are presented as the mean ± standard deviation from three independent experiments. *P<0.05 and **P<0.01 vs. Control. RUNX2, runt related transcription factor 2; miR, microRNA; UTR, untranslated region; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; BMP2, bone morphogenetic protein 2.
miR-135a-5p regulates RUNX2 expression in BMP2 treated C2C12 cells. C2C12 cells were treated with 2 nM BMP2 for 24 h following transfection with miR-135a-5p mimic, mimic control, control-plasmid, RUNX2-plasmid, miR-135a-5p mimic+control-plasmid or miR-135a-5p mimic+RUNX2-plasmid, respectively, for 2 h. The relative RUNX2 (A) protein and (B) mRNA expression levels were detected by western blot and RT-qPCR analysis, respectively, in C2C12 cells following transfection with control-plasmid and RUNX2-plasmid. The relative RUNX2 (C) protein and (D) mRNA expression level was detected by western blot and RT-qPCR analysis, respectively, in C2C12 cells following transfection with mimic control, miR-135a-5p mimic, miR-135a-5p mimic+control-plasmid or miR-135a-5p mimic+RUNX2-plasmid. Data are presented as the mean ± standard deviation from three independent experiments. **P<0.01 vs. Control; ##P<0.01 vs. Mimic group. miR, microRNA; RUNX2, runt related transcription factor 2; BMP2, bone morphogenetic protein 2; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
miR-135a-5p inhibits osteogenic differentiation by targeting RUNX2. C2C12 cells were treated with 2 nM BMP2 for 24 h following transfection with miR-135a-5p mimic, mimic control, control-plasmid, RUNX2-plasmid, miR-135a-5p mimic+control-plasmid or miR-135a-5p mimic+RUNX2-plasmid, respectively, for 2 h. (A) The relative protein expression level of OC, Osterix and ALP were determined by western blot analysis in C2C12 cells following transfection and treatment with BMP2. The relative mRNA expression level of (B) OC, (C) Osterix and (D) ALP were determined by reverse transcription-quantitative polymerase chain reaction in C2C12 cells following transfection and treatment with BMP2. (E) ALP activity was examined in C2C12 cells following transfection and treatment with BMP2. Data are presented as the mean ± standard deviation from three independent experiments. **P<0.01 vs. Control; #P<0.05 vs. Mimic; ##P<0.01 vs. Mimic; miR, microRNA; RUNX2, runt related transcription factor 2; BMP2, bone morphogenetic protein 2; OC, osteoclacin; ALP, alkaline phosphatase.