Contributed equally
Osteoporosis is a disease characterized by the degeneration of bone structure and decreased bone mass. Induced pluripotent stem cell-derived mesenchymal stem cells (iPSC-MSCs) have multiple advantages that make them ideal seed cells for bone regeneration, including high-level proliferation, multi-differentiation potential and favorable immune compatibility. Distal-less homeobox (DLX)3, an important member of the DLX family, serves a crucial role in osteogenic differentiation and bone formation. The present study aimed to evaluate the effects of DLX3 on the proliferation and osteogenic differentiation of human iPSC-MSCs. iPSC-MSCs were induced from iPSCs, and identified via flow cytometry. Alkaline phosphatase (ALP), Von Kossa, Oil Red O and Alcian blue staining methods were used to evaluate the osteogenic, adipogenic and chondrogenic differentiation of iPSC-MSCs. DLX3 overexpression plasmids were constructed and transfected into iPSC-MSCs to generate iPSC-MSC-DLX3. iPSC-MSC-GFP was used as the control. Reverse transcription-quantitative PCR (RT-qPCR) and western blotting were performed to measure the expression of DLX3 2 days after transfection. Subsequently, cell proliferation was assessed using a Cell Counting Kit-8 assay on days 1, 3, 5 and 7. RT-qPCR and western blotting were used to analyze osteogenic-related gene and protein expression levels on day 7. ALP activity and mineralized nodules were assessed via ALP staining on day 14. Statistical analysis was performed using an unpaired Student's t-test. Flow cytometry results demonstrated that iPSC-MSCs were positive for CD73, CD90 and CD105, but negative for CD34 and CD45. iPSC-MSC-DLX3 had significantly lower proliferation compared with iPSC-MSC-GFP on days 5 and 7 (P<0.05). mRNA expression levels of osteogenic markers, such as ALP, osteopenia (OPN), osteocalcin (OCN) and Collagen Type I (COL-1), were significantly increased in iPSC-MSC-DLX3 compared with iPSC-MSC-GFP on day 7 (P<0.05). Similarly, the protein expression levels of ALP, OCN, OPN and COL-1 were significantly increased in iPSC-MSC-DLX3 compared with iPSC-MSC-GFP on day 7 (P<0.05). The number of mineralized nodules in iPSC-MSC-DLX3 was increased compared with that in iPSC-MSC-GFP on day 14 (P<0.05). Thus, the present study demonstrated that DLX3 serves a negative role in proliferation, but a positive role in the osteogenic differentiation of iPSC-MSCs. This may provide novel insight for treating osteoporosis.
Bone is in a dynamic balance between bone formation and bone resorption (
Skeletal development is regulated by numerous homeodomain proteins, including the distal-less (DLX) family, which play an important role in the development of bone tissue (
Bone marrow mesenchymal stem cells (BMSCs) are a type of post-natal stem cell with the potential to differentiate into different cells, such as osteoblasts, chondrocytes and adipocytes (
A previous study revealed that overexpression of DLX3 enhances the osteogenic differentiation of human BMSCs (
In the present study, DLX3-overexpression iPSC-MSCs (iPSC-MSC-DLX3) were constructed, the expression of DLX3 in iPSC-MSCs and iPSC-MSC-DLX3 was examined by reverse transcription-quantitative PCR (RT-qPCR) and western blotting, and then the effects of the DLX3 gene on osteogenic differentiation of these cells was evaluated.
The experiment protocol of the present study was approved by the Ethical Review Committee of Jinan University (approval no. 2015-045). Human iPSC line was obtained from the South China Institute for Stem Cell Biology and Regenerative Medicine Group of the Chinese Academy of Sciences. iPSCs were cultured in mTeSR1 medium (Stemcell Technologies, Inc.) on Geltrex™ LDEV-Free Reduced Growth Factor Basement Membrane Matrix (Gibco; Thermo Fisher Scientific, Inc.) coated dishes for 5 days. Then, the medium was replaced with DMEM (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), 2 mM L-glutamine, 1% penicillin/streptomycin and 0.1 mM non-essential amino acids (Gibco; Thermo Fisher Scientific, Inc.). When these cells reached 80% confluence, they were passaged. When most of the cells presented spindle-like morphology, they were collected and applied for subsequent experiments.
Flow cytometry was used to evaluate surface markers of iPSC-MSCs. Briefly, the cells were harvested, and then 3% BSA (Gibco; Thermo Fisher Scientific, Inc.) was used to block non-specific antigens on the cell surface at 37°C for 30 min. Subsequently, the cells were incubated with monoclonal antibodies (all purchased from BioLegend, Inc.) against CD73 (cat. no. 344005), CD90 (cat. no. 328113), CD105 (cat. no. 323207), CD34 (cat. no. 343607) and CD45 (cat. no. 368511). Then, the cells were washed three times with BSA to remove non-specific antibodies. A Guava® easyCyte™ flow cytometer and Guava® Suite Software 3.4 (both EMD Millipore) were used to analyze surface antigens.
The osteogenic, adipogenic and chondrogenic differentiation capabilities of iPSC-MSCs were analyzed. To study osteogenic differentiation, iPSC-MSCs at 1×104/well density were seeded on 6-well plates (Corning, Inc.) and incubated with 2 ml StemPro™ Osteogenesis Differentiation medium (Gibco; Thermo Fisher Scientific, Inc.) at 37°C for 3 weeks. The Osteogenesis Differentiation medium was replaced every 3 days. The cells were fixed with 4% paraformaldehyde for 30 min at room temperature. The ALP activity of iPSC-MSCs was assayed using an ALP staining kit (Sigma-Aldrich; Merck KGaA) according to the manufacturer's instructions, and the calcified matrix deposition was detected using a Von Kossa staining kit (Nanjing Jiancheng Bioengineering Institute) according to the manufacturer's instructions and observed under a light microscope (Zeiss Axio Observer.Z1; Carl Zeiss AG).
In order to study adipogenic differentiation, iPSC-MSCs at 1×104/well density were seeded on 6-well plates and incubated with 2 ml StemPro™ Adipogenesis Differentiation medium (Gibco; Thermo Fisher Scientific, Inc.) at 37°C for 3 weeks. Adipogenesis Differentiation medium was replaced every 3 days, and subsequently the cells were assayed with an Oil Red O kit (Nanjing Jiancheng Bioengineering Institute) for 15 min at room temperature.
To study chondrogenic differentiation, iPSC-MSCs at 1×104/well density were seeded on 6-well plates and incubated with 2 ml StemPro™ Chondrogenesis Differentiation medium (Gibco; Thermo Fisher Scientific, Inc.) at 37°C for 3 weeks. The Chondrogenesis Differentiation medium was replaced every 3 days, and subsequently the cells were assayed with an Alcian blue kit (Nanjing Jiancheng Bioengineering Institute) for 30 min at room temperature.
Human DLX3 gene primers (PrimerBank ID:38327640c1,
Proliferation of iPSC-MSC-GFP and iPSC-MSC-DLX3 was assessed using Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.). On the first day, cells were seeded on 96-well plates at 2×103 cells/well, and then cultured with DMEM plus 10% FBS. Cell viability was evaluated on day 1, 3, 5 and 7 post-transfection. Optical density (OD) at 450 nm was recorded using an enzyme immunoassay reader (Bio-Rad Laboratories, Inc.).
Total RNA was isolated from iPSC-MSC-GFP and iPSC-MSC-DLX3 using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) on day 7. NanoDrop™ 2000 system (Thermo Fisher Scientific, Inc.) was used to test RNA concentrations. The extracted RNA was reverse-transcribed into cDNA using iScript™ gDNA Clear cDNA Synthesis kit (Invitrogen; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. qPCR analysis was operated using PowerUp SYBR-Green Master Mix (Invitrogen; Thermo Fisher Scientific, Inc.) and measured by spectrofluorimetric iQ5 Thermal iCycler (Bio-Rad Laboratories, Inc.) according to the manufacturer's instructions. The primer sequences of DLX3, ALP, osteopontin (OPN), osteocalcin (OCN), Collagen Type I (COL-1) and GAPDH are presented in
A total of 7 days after transfection, iPSC-MSC-GFP and iPSC-MSC-DLX3 were rinsed with PBS and lysed in 0.1 ml RIPA buffer containing 10 mg/ml proteinase inhibitor PMSF (Invitrogen; Thermo Fisher Scientific, Inc.) on ice for 30 min. The lysed cells were centrifuged at 10,000 × g for 10 min at 4°C, and the supernatant was collected. During electrophoresis, 20 µg target total protein/lane was separated via SDS-PAGE on a 10% gel (Beyotime Institute of Biotechnology), which were subsequently transferred to PVDF membranes (Thermo Fisher Scientific, Inc.) at 200 mA for 2 h. PVDF membranes were blocked using 5% non-fat milk with TBS with 0.1% Tween-20 at room temperature for 2 h, and then incubated with the primary antibodies at 4°C overnight. The primary antibodies used were as follows: DLX3 (1:500; cat. no. ab64953; Abcam), ALP (1:500; cat. no. ab83259; Abcam), OPN (1:500; cat. no. ab8448; Abcam), OCN (1:500; cat. no. ab93876; Abcam), COL-1 (1:500; cat. no. ab34710; Abcam) and GAPDH (1:2,500; cat. no. ab9485; Abcam). Then, PVDF membranes were incubated with a secondary antibody (1:2,500; cat. no. ab97051; Abcam) at 37°C for 2 h. GAPDH was used as the control. The blotting results were visualized with chemiluminescent western blotting detection reagents (Pierce; Thermo Fisher Scientific, Inc.) and measured by Image-Pro Plus version 6.0 (Media Cybernetics, Inc.).
The transfected cells were seeded on 6-well plates at an initial density of 3×104 cells/well and cultured for 14 days to 80% confluence in DMEM containing 10% FBS. The cells were fixed with 4% paraformaldehyde for 30 min at room temperature. The ALP Staining kit (Nanjing Jiancheng Bioengineering Institute) was used to stain cells for 30 min at room temperature on day 14 after transfection. In total, three randomized observation views were selected, and the number of mineralized nodules was counted under a microscope (Zeiss Axio Observer.Z1; Carl Zeiss AG).
SPSS 20.0 software (IBM Corp.) was used to analyze the data, which are presented as the mean ± SD. Statistical significance was calculated using an unpaired Student's t-test. P<0.05 was considered to indicate a statistically significant difference.
As illustrated in
After osteogenic induction, iPSC-derived cells displayed positive ALP staining (
Both iPSC-MSC-GFP and iPSC-MSC-DLX3 groups had a GFP expression percentage of ~100% (
The OD values of iPSC-MSC-GFP on day 1, 3, 5 and 7 were 0.21±0.02, 0.25±0.03, 0.33±0.03 and 0.50±0.05, while the OD values of iPSC-MSC-DLX3 on day 1, 3, 5 and 7 were 0.19±0.01, 0.22±0.03, 0.26±0.02 and 0.37±0.03, respectively (
After 7 days of transfection of iPSC-MSC-GFP and iPSC-MSC-DLX3, the relative expression levels of ALP were 1.00±0.33 and 11.99±0.24, those of OPN were 1.00±0.49 and 5.80±0.07, those of OCN were 1.00±0.06 and 8.64±0.11, those of COL-1 were 1.00±0.53 and 5.98±0.02. The results indicated that the mRNA expression levels of osteogenic markers in iPSC-MSC-DLX3 were significantly higher compared with those in iPSC-MSC-GFP (P<0.05;
Similarly, the relative expression levels of ALP were 1.00±0.13 and 7.77±0.05, those of OPN were 1.00±0.04 and 2.05±0.04, those of OCN were 1.00±0.05 and 3.79±0.17, and those of COL-1 were 1.00±0.11 and 3.38±0.22. The expression levels of the osteogenic proteins in iPSC-MSC-DLX3 were significantly increased compared with those in iPSC-MSC-GFP (P<0.05;
As presented in
iPSC-MSCs have been considered as a novel cell resource for bone tissue engineering (
While iPSC-MSCs have similar surface markers as BMSCs, their gene expression profile differs (
At present, the role of DLX3 on cell proliferation has not been sufficiently investigated. A previous research group pointed out that stable overexpression of DLX3 gene inhibited the proliferation of human DPCs by inactivating the canonical Wnt pathway (
DLX3, expressed in osteo-/odontogenic lineages, is a crucial transcription factor for osteo-/odontogenic differentiation, mineralization and skeletal development (
Osteoporosis (OP) is a bone metabolic disease that is characterized by the degeneration of bone structure and decreased bone mass (
However, the present study has some limitations. It was assumed that multilineage induction experiments were enough to demonstrate the successful induction of human iPSCs into iPSC-MSCs, but the relative marker genes were not analyzed pre/post-osteogenic and chondrogenic induction. Therefore, it is hoped that these limitations can be improved in future studies.
In conclusion, the present study demonstrated that DLX3 exerted a positive role in regulating the osteogenesis of iPSC-MSCs. However, the specific underlying mechanism of DLX3 affecting osteogenic differentiation in iPSC-MSCs is yet to be fully elucidated. Further investigations, both
Not applicable.
The present study was supported by the Guangdong Basic and Applied Basic Research Foundation (grant no. 2020A1515010239), National Natural Science Foundation of China (grant no. 81500825), Medical Scientific Research Foundation of Guangdong Province (grant no. A2015423), Special Fund for Public Welfare Research and Capacity Building of Guangdong Province (grant no. 2014A020212211), and Science and Technology Program of Guangzhou (grant no. 201607010205).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
WZ and RL designed the study, prepared the figures and drafted the manuscript. JL and QL performed the experiments. YL conceptualized the study and drafted and revised the manuscript. All authors read and approved the final manuscript.
The present study was approved by the Ethical Review Committee of Jinan University (approval no. 2015-045).
Not applicable.
The authors declare that they have no competing interests.
Generation and identification of iPSC-MSCs. (A-C) Generation of iPSC-MSCs. (A) Scale bar, 200 µm; (B and C) scale bar, 100 µm. (D) Flow cytometric analysis of iPSC-MSCs. (E) Alkaline phosphatase staining. (F) Osteogenesis was detected using Von Kossa staining. (G) Adipogenesis was detected using Oil Red O staining. (H) Chondrogenesis was detected using Alcian blue staining (scale bar, 100 µm). iPSC-MSC, induced pluripotent stem cell-derived mesenchymal stem cell.
Lentiviral transfection efficiency. (A) GFP expression percentage in the iPSC-MSC-GFP and iPSC-MSC-DLX3 groups (scale bar, 50 µm). (B) Reverse transcription-quantitative PCR analysis of DLX3 gene expression. (C and D) Western blot analysis of DLX3 protein expression. *P<0.05 vs. iPSC-MSC-GFP. iPSC-MSC, induced pluripotent stem cell-derived mesenchymal stem cell; DLX3, distal-less homeobox 3.
Cell proliferation. Cell proliferation rate was significantly reduced in the iPSC-MSC-DLX3 group compared with the rate observed intheiPSC-MSC-GFP group on days 5 and 7. *P<0.05 vs. iPSC-MSC-DLX3. iPSC-MSC, induced pluripotent stem cell-derived mesenchymal stem cell; DLX3, distal-less homeobox 3.
mRNA and protein expression of osteogenic differentiation-related genes on day 7. (A) Reverse transcription-quantitative PCR analysis of osteogenic-related gene expression. (B and C) Western blot analysis of osteogenic-related protein expression. *P<0.05 vs. iPSC-MSC-GFP. iPSC-MSC, induced pluripotent stem cell-derived mesenchymal stem cell; DLX3, distal-less homeobox 3; ALP, alkaline phosphatase; OPN, osteopenia; OCN, osteocalcin; COL-1, Collagen Type I.
ALP activity and mineralized nodules. (A) ALP was stained as golden, and mineralized nodules were stained as black/brown (marked with arrow). Scale bar, 50 µm. (B) The number of mineralized nodules in the iPSC-MSC-DLX3 group was higher than that in the iPSC-MSC-GFP group. *P<0.05 vs. iPSC-MSC-GFP. iPSC-MSC, induced pluripotent stem cell-derived mesenchymal stem cell; DLX3, distal-less homeobox 3; ALP, alkaline phosphatase.
Primers used for reverse transcription-quantitative PCR.
Gene | Primer sequences (5→3) | Size (bp) |
---|---|---|
DLX3 | F: TACCCTGCCCGAGTCTTCTG | 111 |
R: TGGTGGTAGGTGTAGGGGTTC | ||
ALP | F: ACCACCACGAGAGTGAACCA | 79 |
R: CGTTGTCTGAGTACCAGTCCC | ||
OPN | F: CTCCATTGACTCGAACGACTC | 230 |
R: CAGGTCTGCGAAACTTCTTAGAT | ||
OCN | F: CACTCCTCGCCCTATTGGC | 112 |
R: CCCTCCTGCTTGGACACAAAG | ||
COL-1 | F: GAGGGCCAAGACGAAGACATC | 140 |
R: CAGATCACGTCATCGCACAAC | ||
GAPDH | F: GGAGCGAGATCCCTCCAAAAT | 197 |
R: GGCTGTTGTCATACTTCTCATGG |
DLX3, distal-less homeobox 3; ALP, alkaline phosphatase; OPN, osteopontin; OCN, osteocalcin; COL-1, Collagen Type I; F, forward; R, reverse.