*Contributed equally
Obesity is currently an important health problem and is associated with an increased likelihood of various diseases. The efficacies of various natural treatments have been assessed for their utility in treating obesity. Alliin (S-allyl-L-cysteine sulfoxides) is considered the major component of garlic and has a wide range of natural antioxidant properties. However, the direct effects of alliin on obesity have not been well clarified. The present study investigated the effects and possible mechanisms of alliin on adipocyte differentiation. The 3T3-L1 cells were treated with alliin (0-40 µg/ml) during adipogenic differentiation. The effect of alliin on lipid accumulation was evaluated by Oil red O staining. Reverse transcription-quantitative PCR was performed to investigate the expression levels of adipogenic differentiation-related genes. The accumulation of lipid droplets was markedly inhibited following alliin treatment. The expression levels of multiple adipogenic transcription markers, such as CCAAT/enhancer-binding protein (C/EBP) β, C/EBP α and peroxisome proliferation-activity receptor γ, were markedly decreased following treatment with alliin during adipogenic differentiation. Expression levels of several adipocyte-related genes were subsequently suppressed. Additionally, alliin suppressed PKB/Akt and PI3K expression. These results suggested that alliin exhibits anti-adipogenic activity by downregulating major adipogenic differentiation-related genes and Akt/PI3K expression. Alliin may have a potential therapeutic effect on metabolic disease.
Obesity is a significant risk factor for many metabolic diseases such as obstructive sleep apnea, cardiovascular diseases, diabetes, cancers, and osteoarthritis (
Many studies have focused on developing anti-obesity drugs (
Alliin, obtained from Abcam (ab141896), was dissolved in dimethylsulfoxide (DMSO), and stored at -20˚C.
3T3-L1 fibroblasts were obtained from Japanese Collection of Research Bioresources Cell Bank (Osaka, Japan). Cells were cultured in DMEM (Sigma-Aldrich; Merck KGaA) supplemented with 10% fetal bovine serum (FBS; Gibco Life Technologies), 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin B (Biological Industries) in a CO2 ncubator. The cells were then trypsinized after reaching 80-90% confluence. Cells at passages 2-15 were used in this study.
The cells were differentiated following previously reported method with some modifications (
To confirm the lipid accumulation in cultured cells, Oil red O staining (Sigma-Aldrich; Merck KGaA) was performed. Eight days after induction, mature adipocytes were fixed with 4% paraformaldehyde phosphate buffer solution for 30 min at room temperature and then stained with Oil red O working solution (6:4 of oil red stock solution: Distilled water) for 15 min. PBS was washed three times to remove the excess Oil red O dye. The images were observed under a parallel phase contrast microscope (Olympus IX70 inverted microscope, Olympus Optical CO, Ltd.). For quantitative analysis, the percentage of positively stained areas were calculated using imageJ. Results are expressed as percentage of Oil red O-stained area compared to control. For each sample, the experiments were performed in triplicates.
Cell viability was determined using a Cell Counting Kit-8 assay (CCK-8; DOJINDO Lab, Osaka, Japan). 3T3-L1 cells were seeded in 96-well plates (5x103 cells/well) for 2 days. Cells were then cultured with various concentrations of alliin (0-40 µg/ml) for 7 days. Cell Counting Kit-8 (CCK-8; Dojindo Laboratories) was used according the manufacturer's instruction. Cells were incubated with 10 µl of CCK-8 reagent for 2 h at 37˚C. The result was determined using a Synergy™ HTX Multi-Mode Microplate Reader (BioTek Instruments) at 450 nm.
Total RNA was extracted from cells using TRIzol® reagent (Ambion®; Gibco Life Technologies) according to manufacturer's instructions. The quantity and quality of isolated RNA were detected using a Nano Drop spectrophotometer (Nano Drop® ND-1000, Thermo Fisher Scientific, Inc.). Complementary DNA (cDNA) was synthesized in a 20-µl reaction using 2 µg RNA, 20 pmol Oligo dT12-18 (Invitrogen; Thermo Fisher Scientific, Inc., 18418-012), 0.5 µl RNase inhibitor (Promega Corporation, N211A), 0.2 µl ReverTra Ace (Toyobo, TRT-101), 2 µl dNTP Mixture (Takara, 4030), 4 µl 5X RT buffer (Toyobo, TRT-101), and 10 mM DEPC water. RT-qPCR was performed in a 25-µl reaction, containing 1 µl cDNA, 10 pmol forward and reverse primers, and 12.5 µl SYBR Premix Ex Taq II (Takara, RR820A). PCR amplification was set as follows: 95˚C for 30 sec, 40 cycles of 95˚C for 5 sec, and 60˚C for 30 sec; then the final dissociation was set at 95˚C for 15 sec, 60˚C for 30 sec, and 95˚C for 15 sec. The data were quantified using the 2-∆∆Cq method and were normalized against the levels of β-actin (
The results are presented as the mean ± standard error of the mean (SEM) of three experiments. SPSS 13.0 and GraphPad Prism 6 software were used for statistical analysis. The statistical significance between each group was computed using one-way analysis of variance followed by Dunnett's test. P<0.05 was considered statistically significant.
3T3-L1 cells showed fibroblastic-like morphology before adipogenic induction (
To examine the effect of alliin on adipogenic transcription markers during induction, cells were analyzed by RT-qPCR. The expression levels of C/EBP β, C/EBP α and PPAR γ were assessed on dayz 1, 3 and 7 of induction, respectively. The mRNA level of C/EBP β, induced by the differentiation medium, reached its peak on day 1, and then decreased gradually over time. Cells treated with 40 µg/ml alliin on day 3 showed a significant decrease in lipid accumulation compared to cells in the control group, but there was no significant difference on day 7 (
Expression of adipocyte-related genes was also analyzed using RT-qPCR. During adipogenic differentiation, expression of adiponectin mRNA increased over time. The level of adiponectin mRNA was significantly lower with treatment of 40 µg/ml alliin than without treatment at all time points examined (
Akt and ERK 1/2 are upstream regulators in the adipocyte differentiation pathway, including C/EBP α and PPAR γ pathways. To investigate the possible mechanism of alliin on adipogenic differentiation, the Akt and ERK 1/2 pathways related genes were examined. The 3T3-L1 cells were cultured with various concentrations of alliin during the differentiation of adipocyte. Results showed that expression of PI3K and Akt was significantly increased at the early stage of differentiation. Expression of PI3K was significantly inhibited in the 20 or 40 µg/ml alliin treatment group compared to that in the control group at all time points examined (
In the current study, we indicated that alliin treatment may contribute to decreased adipogenesis of 3T3-L1 adipocyte. This study revealed, for the first time, the direct effect of alliin on adipogenesis. Moreover, we found an effect of alliin on adipogenesis may be achieved by downregulating the Akt and PI3K expression. Several recent reports indicate the benefit of plant extracts as drugs (
Obesity is commonly caused by an excessive increase of adipocytes. Adipogenesis is a complex regulated cellular differentiation process involving many signaling pathways and related molecules (
In addition, PPAR γ and C/EBP α can be part of a feedback loop and promote adipogenesis by leading the expression of downstream genes, such as adiponectin, Fabp4, and leptin. These downstream genes play major roles in inducing and maintaining mature adipocytes (
Insulin signaling pathway plays a critical role in modulating adipogenesis. In the presence of insulin, the insulin receptor is autophosphorylated, and subsequently proteins in the insulin receptor substrate family are also phosphorylated, thereby activating the two main signaling pathways, PI3K/Akt and MAPK/ERK pathways (
In conclusion, the results demonstrated that alliin in garlic can inhibit adipogenesis by reducing expression of major transcriptional activators and their downstream genes, which may be mediated by regulation of Akt signaling pathway. Alliin may provide a possible naturally occurring therapeutic method for the prevention and treatment of metabolic disease.
Not applicable.
All data generated or analyzed during this study are included in this published article.
NL and KC performed all experiments, acquired data, analyzed the data and drafted the manuscript. . KC and HD contributed to the acquisition of data. JY, MY, HK and XL designed the experiment. XL revised the manuscript. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Effect of alliin on lipid droplet accumulation in 3T3-L1 cells. (A) Phase-contrast images of 3T3-L1 cells. (A-a and -b) 3T3-L1 cells exhibited fibroblastic morphology before adipogenic induction, (c-f) and then the cells changed to a round-shape after 7 days of induction. (A-g-j) Oil-red O staining revealed that the intracellular lipids were decreased in alliin-treated groups compared with the control. (B) Quantitative analysis demonstrated that the positively stained areas were decreased in the alliin treatment group. (C) Cell viability was tested on day 7. Alliin (10-40 µg/ml) exhibited no effect on cell viability. Scale bar, 100 µm. Data are presented as the mean ± SEM. *P<0.05, **P<0.01, ***P<0.001.
Effect of alliin on adipogenic transcriptional markers during induction. The 3T3-L1 cells were treated with or without alliin during adipogenic induction. Reverse transcription-quantitative PCR revealed the expression levels of (A) C/EBP β, (B) C/EBP α and (C) PPAR γ in 3T3-L1 cells during induction. Data are presented as the mean ± SEM. *P<0.05, **P<0.01. C/EBP, CCAAT/enhancer-binding protein; PPAR γ, peroxisome proliferation-activity receptor γ.
Effect of alliin on adipocyte-related genes during induction. Alliin was administered at various concentrations during adipogenic differentiation. Reverse transcription-quantitative PCR analysis was used to evaluate the gene expression levels of (A) adiponectin, (B) Fabp4 and (C) leptin. Data are presented as the mean ± SEM. *P<0.05, **P<0.01. Fabp4, fatty acid binding protein 4.
Effect of alliin on the Akt and ERK 1/2 pathway-related genes during induction. The 3T3-L1 cells were treated with different concentration of alliin during adipogenesis. The expression levels of (A) PI3K, (B) Akt, (C) MAPK and (D) ERK were analyzed by reverse transcription-quantitative PCR. Data are presented as the mean ± SEM. *P<0.05, **P<0.01.
Schematic representation of the possible mechanism of the anti-adipogenic effect of alliin. Alliin (C6H11NO3S) inhibits adipogenesis by downregulating PI3K and Akt activity, thereby attenuating the expression levels of C/EBP β, C/EBP α, PPAR γ and lipid metabolizing enzymes. C/EBP, CCAAT/enhancer-binding protein; PPAR γ, peroxisome proliferation-activity receptor γ.
Primer sequences for reverse transcription-quantitative PCR.
Name of gene | Primers (5'-3') | Melting temperature (˚C) | Product length (bp) | Genbank code |
---|---|---|---|---|
β-actin | F: CATCCGTAAAGACCTCTATGCCAAC ATGGAGCCACCGATCCACA | 64.1 | 193 | NM_007393.5 |
R: ATGGAGCCACCGATCCACA | 64.9 | |||
PPAR γ | F: GTGCCAGTTTCGATCCGTAGA | 66.2 | 167 | NM_001113418.1 |
R: GGCCAGCATCGTGTAGATGA | 66.2 | |||
C/EBP α | F: GGACAAGAACAGCAACGAGTA | 61.8 | 237 | NM_001287514.1 |
R: GCAGTTGCCATGGCCTTGA | 69.7 | |||
C/EBP β | F: TGGACAAGCTGAGCGACGAG | 69.1 | 192 | NM_001287738.1 |
R: TGTGCTGCGTCTCCAGGTTG | 70.0 | |||
Adiponectin | F: GCACTGGCAAGTTCTACTGCAA | 66.4 | 156 | NM_009605.5 |
R: GTAGGTGAAGAGAACGGCCTTGT | 66.4 | |||
Leptin | F: CCACACACAGCTGGAAACTC | 63.4 | 216 | NM_008493.3 |
R: GCCTTGCTTCAGATCCATCC | 65.9 | |||
Fabp4 | F: CCAATGAGCAAGTGGCAAGA | 66.2 | 179 | NM_024406.3 |
R: GATGCCAGGCTCCAGGATAG | 65.9 | |||
PI3K | F: TCCTGCTTCATACCGAGCTT | 63.8 | 212 | NM_001024955.2 |
R: CATGACATCCTCCCTCTCGT | 64.2 | |||
AKT | F: CCCTTCTACAACCAGGACCA | 63.9 | 210 | NM_009652.3 |
R: ATACACATCCTGCCACACGA | 64.1 | |||
MAPK | F: TGCCAGGCTGAACTACAGTG | 64.1 | 169 | NM_008927.4 |
R: CACAAGGCTCCCTCTCAGAC | 64.1 | |||
ERK | F: TCAGAGGCAGGTGGATCTCT | 64.0 | 188 | NM_011949.3 |
R: GGTGCCATCATCAACATCTG | 64.1 |
F, forward; R, reverse.