Contributed equally
Numerous studies have suggested that non-coding RNAs mediate tumorigenesis via the epithelial-mesenchymal transition (EMT). However, whether the long non-coding RNA (lncRNA) HOXA transcript at the distal tip (HOTTIP) plays a role in the EMT of small cell lung cancer (SCLC) remains unclear. The results of the present study suggest that HOTTIP-knockdown may lead to a significant increase in E-cadherin expression and a decrease in vimentin (VIM) expression; these proteins are two key markers of EMT. Furthermore, a notable morphological change in SCLC cells with HOTTIP-knockdown was observed: After upregulation of microRNA (miR)-574-5p, the cells exhibited a long, fusiform morphology. Investigating these phenomena further revealed that HOTTIP may participate in EMT by binding to miR-574-5p. In addition, using bioinformatics technology and a dual luciferase reporter assay, it was found that miR-574-5p inhibited VIM expression via direct binding and interaction. In summary, the present results indicate that HOTTIP may be involved in the EMT of SCLC by binding to miR-574-5p, and that miR-574-5p may act through VIM, which is a key marker of EMT.
Lung cancer remains one of the most fatal diseases in the world, and small cell lung cancer (SCLC) accounts for >15% of lung cancer cases (
Non-coding RNAs have no protein-coding potential, and account for >90% of transcripts. Among them, microRNAs (miRNAs or miRs) with a length of 19–25 nucleotides (nt) have been extensively studied. Thousands of miRNAs regulate ~30% of protein-coding genes (
The lncRNA HOXA transcript at the distal tip (HOTTIP), which lies at the 5′ end of the HOXA cluster, has been confirmed to be a key regulator in several cancer types, such as gastric cancer, pancreatic ductal adenocarcinoma, colorectal and ovarian cancer (
The SCLC cell lines H146, H446, H69 and H69AR cells were obtained from the American Type Culture Collection (ATCC), and were cultured in Gibco RPMI-1640 medium (Thermo Fisher Scientific, Inc.) containing 10 or 20% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) at 37°C and 5% CO2. Different from the adherent H69AR cell line, the H146 cell line is a type of semi-suspended and semi-adherent cell line, which makes it more suitable for the observation of cell morphological changes during the EMT process. Since H69AR and H69 cells grow vigorously and exhibit fully adherent growth characteristics according to cell growth characteristics described in ATCC, they are suitable for cell collection, as well as for RNA and protein extraction. According to the needs of the present study, H69, H69AR and H146 SCLC cells were selected for further experiments. Furthermore, the 293T cell line (ATCC), which was were cultured in RPMI-1640 medium containing 10% fetal bovine serum at 37°C and 5% CO2, was used for the dual luciferase reporter assay.
HOTTIP small interfering (si)RNA and miR-574-5p inhibitors or mimics (
RT-qPCR was performed according to the manufacturer's instructions of the TB Green® Premix Ex Taq™ (Tli RNaseH Plus) (Takara Bio, Inc.), and was used to detect the mRNA expression levels of the related genes in SCLC cells. The extraction of total RNA from cells was performed using TRIzol® reagent (Thermo Fisher Scientific, Inc.). The primers are listed in
Western blotting was performed as previously described (
For IF staining, H146 and H146/miR-574-5p and the corresponding control cells were fixed with 4% paraformaldehyde at room temperature for 20 min and blocked with PBS containing 5% goat serum (cat. no. 16210-064; Gibco; Thermo Fisher Scientific, Inc.). The cells were then washed three times for 5 min with PBS and permeabilized with 0.3% Triton X-100 for 1 h at room temperature. An additional washing step with PBS was performed three times for 5 min, and the cells were incubated with 5% BSA for 1 h at room temperature. The samples were incubated overnight at 4°C with a primary antibody against VIM (cat. no. 5741S; 1:100; Cell Signaling Technology, Inc.). The samples were subsequently washed with PBS three times for 5 min and incubated with the secondary antibody (FITC-Labeled Anti-Rabbit IgG; cat. no. CST. 5151p; Cell Signaling Technology, Inc.), and the nuclei were stained with DAPI (Thermo Fisher Scientific, Inc.). An Olympus IX73 microscope was used to capture the fluorescence images. For the quantitative analysis of the intensity of fluorescence expression, the immunofluorescence images were quantitatively analyzed using ImageJ software.
According to a standard protocol, plate colony formation experiments were conducted. Single-cell suspension was prepared, and 500 cells were inoculated in a 3.5-cm dish with a diameter of 3.5 cm. The drug concentration was determined according to the IC50 in the treatment group on the next day. Following culture at 5% CO2, 37°C and saturated humidity for 14–21 days, when there were visible clones in the culture dish, the culture was terminated, the supernatant was discarded, and the cells were washed with PBS twice, fixed with pure methanol at room temperature for 10 min and dyed with 0.4% crystal violet at room temperature for 10 min. The number of colonies with >50 cells was counted under an inverted phase-contrast microscope (CX41, Olympus Corporation). The experiment was repeated three times to obtain mean values (
For the wound healing assay, H146 and H146/si-HOTTIP as well as H146/si-HOTTIP + miR-574-5p cells (5×105 per well) were incubated in 6-well plates for 24 h. When the cells were ~100% confluent, the monolayer was scratched with a 200-µl pipette tip. The cells were washed with PBS, and fresh serum-free medium was added. The cells were cultured at 37°C with 5% CO2 and the wound was allowed to heal. Images of the wound were captured at 0 and 24 h. ImageJ software was used to evaluate the wound area, and the wound closure rate was calculated using the following formula: Closure rate=(original wound area/final wound area)/original wound area ×20.
A Boyden chamber was used for an
The dual luciferase reporter assay was conducted by Suzhou GenePharma Co., Ltd. Detailed information regarding the methodology is provided on the supplier's website. The putative binding site for miR-574-5p and HOTTIP was predicted using the bioinformatics tool starBase (
All experiments were conducted in triplicate. The data are expressed as the mean ± SD. All statistical analyses were performed using GraphPad Prism 7 software (GraphPad Software, Inc.). Statistical significance was analyzed by unpaired Student's t-test, one-way ANOVA and two-way ANOVA. Bonferroni's correction was applied as a post hoc test after ANOVA. P<0.05 was considered to indicate a statistically significant difference.
The present study suggested that several EMT markers showed differential expression between the H69 and H69AR cell lines (
As described in a previous study (
Based on the aforementioned results, in order to determine whether HOTTIP induced EMT by binding to miR-574-5p, the expression of VIM and E-cadherin in H69AR and H69 cells was determined following transfection with miR-574-5p mimics. It was found that, compared with that of the corresponding H69AR group, VIM expression in the H69AR/miR-574-5p mimics group was significantly decreased, whereas it was significantly increased in the H69AR/miR-574-5p inhibitor group (
By bioinformatics prediction, two pairable base regions were found in the sequences of miR-574-5p and VIM (
To further investigate the effects of HOTTIP binding to miR-574-5p on cell proliferation and invasion, plate colony-forming experiments were carried out. It was found that the colony formation ability of cells was significantly reduced in the H146/si-HOTTIP group compared with that of the H146 group. However, after transfection of H146/si-HOTTIP cells with miR-574-5p mimics, the colony formation ability was restored (
In a Transwell migration assay, the migration ability of cells in the H146/si-HOTTIP group was significantly reduced compared with that of cells in the non-transfected group, but it was restored by subsequent transfection with miR-574-5p mimics in the H146/si-HOTTIP + miR-574-5p group (
Next, a wound healing experiment was conducted to verify the aforementioned results. At 48 h, the wound healing ability of the two treatment groups was poorer compared with that of the control group. However, at 72 h, the H146/si-HOTTIP + miR-574-5p group exhibited the highest wound closure rate (
Since the prognosis of SCLC is markedly poor, the study of the pathogenesis and development of SCLC may lead to the identification of new biomarkers and thus aid early detection and treatment. The ceRNA network is a key regulatory mechanism in the pathogenesis and development of numerous tumors, and is a regulatory network involving lncRNAs, miRNAs and their target genes. Our previous study indicated that HOTTIP participates in the pathogenesis, development and chemoresistance of SCLC by sponging miR-574-5p (
Multiple studies have suggested that HOTTIP acts as an oncogene in esophageal squamous cell carcinoma by inducing EMT via the HOTTIP-miR-30b-HOXA13 axis, in which HOXA13 is a downstream factor of HOTTIP that has been demonstrated to be directly regulated by HOTTIP (
Previous studies on human gastric carcinoma cells have shown that miR-574-3p regulates EMT, as well as cisplatin resistance, by targeting zinc finger E-box-binding homeobox 1 (
Our previous study evaluated HOTTIP, miR-574-5p and the prognosis of patients with SCLC (
There are certain limitations in the present study, including the absence of
In conclusion, the present study showed that HOTTIP may participate in EMT by sponging miR-574-5p. In addition, by using bioinformatics technology and a dual luciferase reporter assay, it was confirmed that miR-574-5p probably inhibits the expression of VIM, a key molecule of EMT, through direct target binding. Future studies may focus on the regulation of SCLC metastasis by HOTTIP.
The authors would like to thank Dr Linlang Guo (Department of Pathology, Zhujiang Hospital of Southern Medical University) for the designing guidance in the present study. The dual luciferase reporter assay was performed by Suzhou GenePharma Co., Ltd.
The present study was partly supported by the National Natural Science Foundation of China (grant no. 81702285), Funds for the Construction of Basic Medical Disciplines in Guangdong Medical University (grant no. 4SG19047G), Innovation experiment project of Guangdong Medical University in 2020 (grant no. ZZDS007) and Key projects of Guangdong Medical University (grant no. GDMUZ201808).
The datasets used and/or analyzed in the current study are available from the corresponding author upon reasonable request.
YS, YY and SG conceived and designed the experiments. JH and YG conceived the study. RY and CH performed the
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Microarray assay suggests that several EMT markers may be involved in SCLC. (A) Relative expression of five EMT markers, as determined by microarray assay (×103). (B) The expression of VIM and E-cadherin in H69 and H69AR cell lines was examined by RT-qPCR (*P<0.05 vs. H69). (C) Transfection effect of HOTTIP RNAi sequences in SCLC cell lines (*P<0.05 vs. NC or Wild-type) (D) Western blot assay showed the effects of HOTTIP-knockdown on the expression of VIM and E-cadherin proteins. (E) Histogram of the western blot bands shown in
miR-574-5p may induce epithelial-mesenchymal transition via HOTTIP sponging. (A) Morphology of H146 cells (magnification, ×200). (B) Morphology of H146/si-HOTTIP cells (magnification, ×200). (C) Morphology of H146/si-HOTTIP cells after transfection with miR-574-5p mimics (magnification, ×200). (D) Transfection efficiency of miR-574-5p mimics and inhibitor in H146 and H69AR cells. (E) Expression of miR-574-5p in H146 cells transfected with miR-574-5p mimics (**P<0.01, *P<0.05 vs. H146). (F) Expression of HOTTIP in H146 cells transfected with miR-574-5p mimics (**P<0.01 vs. H146). (G) Regulatory effects of miR-574-5p on VIM and E-cadherin (*P<0.05). (H) The effects of HOTTIP silencing and miR-574-5p upregulation on VIM and E-cadherin expression were evaluated by western blotting. (I) Histogram of the western blotting results of
miR-574-5p may regulate the expression of VIM by direct binding. (A) miR-574-5p has two targeted binding areas with VIM according to bioinformatics prediction. (B) Immunofluorescence assay showed that miR-574-5p mimics and NC were successfully transfected into 293T cells (magnification, ×20); the transfected cells emitted green fluorescence. (B-a) 293T cell transfection with miR-574-5p NC for 48 h was observed under a light microscope. (B-b) 293T cells with miR-574-5p NC transfection for 48 h were observed under a fluorescence microscope. (B-c) 293T cells with miR-574-5p mimics transfection were observed under a light microscope at 48 h. (B-d) 293T cells with miR-574-5p mimics transfection were observed under a fluorescence microscope at 48 h. (C) Reverse transcription-quantitative PCR demonstrated that the miR-574-5p level was increased in 293T cells following transfection with miR-574-5p mimics (*P<0.05 vs. miRNA NC). (D) Dual luciferase reporter assay showed that miR-574-5p could regulate VIM expression by direct binding (**P<0.01 vs. miRNA NC). (E) miR-574-5p could reduce VIM expression at the protein level, according to the results of immunofluorescence analysis (magnification, ×200). VIM, vimentin; miR, microRNA; WT, wild-type; MUT, mutant; NC, negative control.
HOTTIP affects colony formation and cell migration abilities by regulating miR-574-5p. (A) Representative images of the colony formation assay (magnification, ×20). (B) Differences in colony formation ability between H146, H146/si-HOTTIP and H146/si-HOTTIP + miR-574-5p mimics cells after transfection with miR-574-5p mimics (*P<0.05 vs. H146). (C) Representative Transwell assay images (magnification, ×20). (D) Differences of cell migration ability between H146, H146/si-HOTTIP and H146/si-HOTTIP+miR-574-5p mimics cells, as determined by transwell assay (*P<0.05 vs. H146). (E) Representative wound healing assay images (magnification, ×20). (F) Differences in cell migration ability between H146, H146/si-HOTTIP and H146/si-HOTTIP+miR-574-5p mimics cells, as determined by wound healing assay (*P<0.05 vs. H146 at 48 or 72 h). miR, microRNA; HOTTIP, HOXA transcript at the distal tip; si, small interfering.
Primers used for reverse transcription-quantitative PCR analysis.
Gene | Primer sequence (5′-3′) |
---|---|
HOTTIP | Forward: CCTAAAGCCACGCTTCTTTG |
Reverse: TGCAGGCTGGAGATCCTACT | |
GAPDH | Forward: GGGCTGCTTTTAACTCTG |
Reverse: TGGCAGGTTTTTCTAGACGG | |
Vimentin | Forward: AGTCCACTGAGTACCGGAGAC |
Reverse: CATTTCACGCATCTGGCGTTC | |
E-cadherin | Forward: ATTTTTCCCTCGACACCCGAT |
Reverse: TCCCAGGCGTAGACCAAGA |
HOTTIP, HOXA transcript at the distal tip.
miR-574-5p mimic/inhibitor/antagomir and HOTTIP siRNA sequences.
Molecule | Sequences (5′-3′) |
---|---|
miR-574-5p mimic | UGAGUGUGUGUGUGUGAGUGUGUACACUCACACACACACACUCAUU |
miR-574-5p inhibitor | ACACACUCACACACACACACUCA |
Mimics NC | UCUACUCUUUCUAGGAGGUUGUGA |
Inhibitor NC | UCUACUCUUUCUAGGAGGUUGUGA |
HOTTIP siRNA | GCUGCUUUAGAGCCACAUAdTdT |
siRNA NC | UUCUCCGAACGUGUCACGUUU |
miR, microRNA; siRNA, small interfering RNA; HOTTIP, HOXA transcript at the distal tip; NC, negative control.