Induced pluripotent stem cells (iPSCs) reprogrammed by somatic cells may be used as a potentially novel treatment regimen in stem cell regenerative medicine, particularly in the central nervous system (CNS). In the present study, iPSCs were generated using mouse embryonic fibroblasts by ectopic overexpression of Sox-2, Oct-3/4, Klf-4 and c-Myc, and cultured under the same conditions as that used for embryonic stem cells. The neuronal differentiation capacity of mouse iPSCs was examined, and the involvement of the formation of embryoid bodies was assessed. The results suggested that after 15 days of neuronal inducement, Nestin, Vimentin and Glast protein expression levels were significantly increased in the mouse iPSC-derived cells. Additionally, Bmi1, which is selectively expressed in differentiated postnatal adult stem cells. such as hematopoietic stem cells and neural stem cells, was required for establishment of the neuronal differentiation of mouse iPSCs. In order to assess the effects of Bmi1 in neuronal differentiation, Bmi1 expression levels were inhibited with the small molecule PTC-209. The results showed that inhibition of Bmi1 expression reduced the expression of neuronal markers, such as Nestin, compared with the controls. These results suggested that mouse iPSCs can be induced to achieve neuronal differentiation. More interestingly, Bmi1 was required during the neuronal differentiation of mouse iPSCs.
Neuronal loss frequently results in neurological injury and underlies several neurological diseases (
To date, there are three major established regimens used for differentiation of PSCs into neural precursor cells: Promoting the direct neural differentiation of PSCs; co-culture of PSCs with stromal cells, such as MS5 and PA6; or use of a multistep procedure that includes the formation of embryoid bodies (EBs) (
Mouse embryonic fibroblasts (MEFs) were separated from the embryos of female mice after 14.5 days of pregnancy. The specific procedure of deriving MEFs was as follows: The ICR mouse was sacrificed by cervical spondylolisthesis, and the abdomen was saturated with 70% ethanol. Sterilized instruments were used to cut the peritoneal wall and expose the uterine horns, which were removed and placed in a clean disposable Petri dish in PBS. The embryos were obtained and minced. The minced tissue was trypsinized and incubated in DMEM (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% of FBS (Gibco; Thermo Fisher Scientific, Inc.), 1% nonessential amino acids (Invitrogen; Thermo Fisher Scientific, Inc.), 1% L-glutamine (Invitrogen; Thermo Fisher Scientific, Inc.) and penicillin/streptomycin (Beijing Solarbio Science & Technology Co., Ltd.) to grow the MEFs.
293T cells were kindly provided by the Stem Cell Bank, Chinese Academy of Sciences (Serial no. GNHu17) and cultured in DMEM high glucose (Invitrogen; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS and penicillin/streptomycin. All animal experiments were performed in accordance with the guidelines described in the Institutional Animal Care Committee of Zhejiang Chinese Medical University. The present study was approved by the Laboratory Animal Management and Welfare Ethical Review Committee (approval no. ZSLL-2017-181).
Moloney-based retroviral vectors (pMXs) containing the human genes encoding c-Myc, Klf4, Sox2 and Oct3/4 (all established cell-reprogramming factors) (
AP staining was performed using an Alkaline Phosphatase staining kit (EMD Millipore). For immunofluorescence staining, cells were cultured in plates, and fixed and immunostained using established standard protocols (
For formation of EBs, mouse iPSCs were suspended in the mouse ESC medium without LiF and cultured in 10 mm culture dishes at 37˚C for 40 min to remove the MEF layers. Then, 2x105 single mouse iPSCs were cultured in 60 mm petri dishes with mouse ESC medium and without LiF (termed EB medium). After the first and second day, petri dishes were gently shaken to prevent the adherence of the cells. After 8 days, EBs had formed and images were taken at x40 magnification using an inverted light microscope (Nikon Corporation).
First, mouse iPSCs were suspended for 3 days upon the formation of EBs (days 0-3). Then, EBs were treated with 1 µM all-trans RA (Sigma-Aldrich; Merck KGaA) for 4 days (days 3-7). EBs were plated onto 0.1% gelatin-coated dishes in N2B27 medium supplemented with 10 µg/ml basic fibroblast growth factor (bFGF) (PeproTech, Inc.),10 µg/ml epidermal growth factor (EGF) (PeproTech, Inc.) and 1 µM/ml PTC-209 (Selleck-chem) for 6-7 days (days 7-15). The media was replaced every other day. The N2B27 medium was a 1:1 mixture of DMEM/F12 supplemented with N2 (Invitrogen; Thermo Fisher Scientific, Inc.) and neurobasal media added, and supplemented with B27 (Invitrogen; Thermo Fisher Scientific, Inc.). Images were obtained at x100 magnification using an inverted light microscope (Nikon Corporation).
The general flow cytometry analysis protocols were performed as follows: The cells were centrifuged for 5 min at 400 x g and 10˚C. Single cell suspensions were obtained in a solution consisting of PBS supplemented with 2% FBS, and then re-suspended in 200 µl 4% paraformaldehyde and fixed at room temperature for 10 min. The cells were permeabilized using 100 µl PBS with 0.1% Triton X-100 (cat. no. ST797; Beyotime Institute of Biotechnology) for 20 min at 4˚C. The primary antibodies were added and cells were incubated at 4˚C for 30 min, and then subsequently, cells were treated with the corresponding secondary antibody at 4˚C for 30 min. Next, flow cytometry was performed using a BD Fortessa (Becton-Dickinson and Company). Analysis of the flow data was performed using FlowJo version 10 (FlowJo, LLC). The primary antibodies used were mouse anti-Nestin polyclonal antibody (1:200; Abcam; cat. no. ab1642) and mouse anti-GFAP polyclonal antibody (1:200; Abcam; cat. no. ab10062). The secondary antibody used was an anti-mouse IgG H&L-AlexaFluor 488 (1:1,000; Abcam; cat. no. ab150105).
Total RNA was extracted from untransfected MEFs, as well as MEFs transfected with retroviral particles expressing Oct3/4, SOX-2, c-Myc and Klf4 using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. cDNA was synthesized from the RNA using the PrimeScript™ RT reagent kit (Takara Bio, Inc.) according to the manufacturer's protocol. PCR was performed using 2X TSINGKE® MasterMix (Bejing TsingKe Biotech Co., Ltd.) in a 20 µl reaction mixture containing specific primers. PCR amplification reaction was conducted as follows: 5 min at 94˚C, followed by 40 cycles of 30 sec at 94˚C, 30 sec at 55˚C, and 1 min at 72˚C, Then 8 min at 72˚C. Nat1 was used as a loading control between the control MEFs and the MEFs 48-72 h after the transduction with the four retroviruses. The sequences of the primers used for PCR are listed in
For qPCR, total RNA was extracted from iPSCs and MEF and cDNA was synthesized from the RNA as described above. qPCR was performed using SYBR Premix Ex Taq™ (Takara Bio, Inc.) in a 10 µl reaction mixture containing 0.4 µl specific primers. Each sample was run in triplicate, and expression was normalized to the endogenous reference (GAPDH). All the amplifications were performed on a LightCycler 480 system (Roche Diagnostics), PCR amplification reaction was conducted as follows: 10 min at 95˚C, followed by 40 cycles of 15 sec at 95˚C and 1 min at 60˚C. and fold expression relative to the reference gene was calculated using the comparative method 2-ΔΔCq method (
Following induction of neural differentiation by a range of cytokines and RA, iPSC-derived cells were washed with cold PBS and lysed with RIPA lysis buffer (Boster Biological Technology) supplemented with a protease inhibitor cocktail (Thermo Fisher Scientific, Inc.) and phosphatase inhibitor tablets (Roche Diagnostics). The protein concentration of the supernatant was measured using BCA reagents. Equivalent amounts of protein lysates (~25 µg/lane) were loaded on a 10% SDS-gel, resolved using SDS-PAGE and transferred to a nitrocellulose membrane (Pall Life Sciences), which was then blocked using 5% skimmed milk in TBST (150 mM NaCl, 0.1% Tween-20, 25 mM Tris-HCl, pH 7.6) at room temperature for 2 h. The membranes were subsequently incubated with primary antibodies overnight at 4˚C and washed with TBST the following day. After incubating with the secondary IRDye 680 goat anti-mouse antibody (1:5,000; Abcam; cat. no. ab216776) for 2 h at room temperature, signals were visualized using an Odyssey Infrared Imaging system (LI-COR Biosciences). The primary antibodies used were rabbit anti-Bmi1 (1:5,000; Abcam; cat. no. ab38295) and mouse anti-β-actin (1:5,000; Sigma-Aldrich; Merck KGaA; cat. no. A5441).
Data are presented as the mean ± the standard error of the mean of three independent repeats. Comparisons between two groups were performed using a Student's t-test (for two groups) or a one-way ANOVA followed by a Student-Newman-Keuls post-hoc test for multiple groups. P<0.05 was considered to indicate a statistically significant difference. The data were analyzed using GraphPad Prism version 5 (GraphPad Software, Inc.).
Before reprogramming, the transfection efficiency of retroviruses was evaluated. Retroviruses were generated by transfection of 80% confluent 293T cells with the control plasmid pMXs-GFP (
After confirming the pluripotency of mouse iPSCs, they were differentiated into neuronal cells, with the aim of establishing neural stem cells (NSCs). iPSCs were first induced to form EBs, and then EBs were induced after 7 days to further form neural cells in N2B27 medium containing EGF (10 µg/ml) and bFGF (10 µg/ml). After another 7 days of adherent inducement, rosette-like structures were observed (
During the neural differentiation of mouse iPSCs, it was found that Bmi1 gene expression was increased, suggesting that it may participate in the regulation of neuronal cells (
iPSC technology allows for differentiation of pluripotent cells into almost any type of neuronal cell type, including, but not limited to, NSCs, neurons, astrocytes, microglia and oligodendrocytes. This prevents the need for the use of ESCs, with which there are additional ethical concerns and the potential for immunological rejection (
In the present study, the procedure used to differentiate mouse iPSCs into neural cell lineages was dependent on the sequential induction at the right time intervals through the use of growth factors and small molecular compounds that serve a role in embryonic neural development
Bmi1 is required to maintain the pool of adult stem cells, such as NSCs and HSCs (
In conclusion, the present study is the first to show that Bmi1 positively regulates neural differentiation of mouse iPSCs. The neural differentiation of iPSCs may provide a novel platform for studying neuronal development, tissue repair, regenerative medicine and disease modeling, and may also be used as a useful tool for individualized assessment of novel therapeutic compounds.
The authors would like to thank Ms. Yanwei Li (Department of Core Facilities, Zhejiang University School of Medicine) for providing technical support concerning the present study.
The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.
QY and WS conceived and designed the experiments. WS and DL performed the experiments. WS, LZ, LL and DL were responsible for data analysis and interpretation. WS wrote the manuscript. LL and QY confirm the authenticity of all the raw data. All authors reviewed and approved the final manuscript.
All animal experiments were performed in accordance with the guidelines described in the Institutional Animal Care Committee of Zhejiang Chinese Medical University. The present study was approved by the Laboratory Animal Management and Welfare Ethical Review Committee (approval no. ZSLL-2017-181).
Not applicable.
The authors declare that they have no competing interests.
Evaluation of transfection efficiency of retrovirus for reprogramming MEFs. (A) GFP was observed 48 and 72 h after transfection of 293T cells. (B) GFP expression 72 h after infection of MEFs using the control pMXs-GFP plasmid. (C) Morphological changes observed during the process of reprogramming of MEFs into iPSCs. Scale bars, 100 µm. (D) PCR identifying expression of the transgenes Oct3/4, Sox2, c-Myc and Klf4 in control and transfected MEFs 48-72 h after transduction with the Oct3/4, Sox2, c-Myc and Klf4 retrovirus genes. MEF, mouse embryonic fibroblast.
Characteristics of the reprogrammed mouse iPSCs derived from MEFs. (A) Representative bright-field microscopy showing the morphology of the mouse iPSCs after 2 and 12 passages. (B) Characterization of mouse iPSCs was performed by AP staining. Reprogrammed iPSCs were immunostained for detection of (C) SSEA-1 or (D) Oct3/4 expression. Scale bars, 100 µm. (E)
Bmi1 regulates neural differentiation of iPSCs. (A) Gene expression levels of Bmi1 during the neural differentiation process. (B) Protein expression levels of Bmi1 in the different groups. β-actin was used as the internal control. (C) Densitometry analysis of Bmi1 protein expression. (D) Schematic representation of the neural differentiation strategy. (E) Nestin protein expression on day 14 was measured using flow cytometry. Data are representative of three independent experiments. (F) Statistical analysis of the percentage of Nestin+ cells in the presence of PTC-209 or DMSO. Data are presented as the mean ± standard deviation. *P<0.05, **P<0.01. iPSC, induced pluripotent stem cell; EB, embryoid body; EGF, epidermal growth factor; bFGF, basic fibroblast growth factor; RA, retinoic acid.
Sequences of the primers used for PCR.
Gene | Sequence, 5'-3' |
---|---|
Oct3/4 | |
Forward | CCCCAGGGCCCCATTTTGGTACC |
Reverse | CCCTTTTTCTGGAGACTAAATAAA |
SOX2 | |
Forward | GGCACCCCTGGCATGGCTCTTGGCTC |
Reverse | CCCTTTTTCTGGAGACTAAATAAA |
c-Myc | |
Forward | CAACAACCGAAAATGCACCAGCCCCAG |
Reverse | CCCTTTTTCTGGAGACTAAATAAA |
Klf4 | |
Forward | ACGATCGTGGCCCCGGAAAAGGACC |
Reverse | CCCTTTTTCTGGAGACTAAATAAA |
Nat1 | |
Forward | ATTCTTCGTTGTCAAGCCGCCAAAGTGGAG |
Reverse | AGTTGTTTGCTGCGGAGTTGTCATCTCGTC |
Sequences of the primers used for quantitative PCR.
Gene | Sequence, 5'-3' |
---|---|
Oct3/4 | |
Forward | AGAGGATCACCTTGGGGTACA |
Reverse | CGAAGCGACAGATGGTGGTC |
SOX2 | |
Forward | GCGGAGTGGAAACTTTTGTCC |
Reverse | CGGGAAGCGTGTACTTATCCTT |
c-Myc | |
Forward | CCGCTCAAGTTGCTCGAAAAG |
Reverse | TCTCCTTGTAAGACATTGCTGAC |
Nanog | |
Forward | TCTTCCTGGTCCCCACAGTTT |
Reverse | GCAAGAATAGTTCTCGGGATGAA |
Klf4 | |
Forward | CCAGACCAGATGCAGTCACA |
Reverse | GCAGGTGTGCCTTGAGATGA |
GAPDH | |
Forward | AGGTCGGTGTGAACGGATTTG |
Reverse | TGTAGACCATGTAGTTGAGGTCA |