Diffuse large B-cell lymphoma (DLBCL) is the most common and aggressive form of non-Hodgkin's lymphoma. Extracellular vesicles (EVs) derived from cancer cells are known to modify the tumor microenvironment. The aim of the present study was to investigate the role of miR-125b-3p carried by EVs in DLBCL
Diffuse large B-cell lymphoma (DLBCL) is the most common aggressive pediatric mature B-cell non-Hodgkin's lymphoma (NHL), with a high incidence of short- and long-term toxicity after chemotherapy regimens (
Tumor necrosis factor necrosis factor alpha-induced protein 3 (TNFAIP3), also known as A20, is a negative regulator of nuclear factor kappa B (NF-κB) that has been implicated as a tumor suppressor in multiple types of B-cell lymphoma (
Extracellular vesicles (EVs), nanometer-sized, cell-secreted membrane vesicles, are critical to intercellular communication between tumor cells and resident cells (
The study obtained approval from the Ethics Committee of The Affiliated Hospital of Southwest Medical University (China; no. 20180306006). The clinical registration number is KY2019091. Animal experiments were implemented on the guide for the care and use of laboratory animals, and approved by the Ethics Committee of The Affiliated Hospital of Southwest Medical University (animal ethics no. 20180306006; human ethics no. KY2019091).
A total of 34 patients with DLBCL, who underwent surgical resection at The Affiliated Hospital of Southwest Medical University from August 2017 to August 2019, were selected as the DLBCL group, including 20 males and 14 females, aged 38-64 years. The inclusion criteria were as follows: i) Patients diagnosed with DLBCL by pathology; ii) patients conforming to surgical indications; iii) patients who did not receive chemotherapy prior to surgery; iv) patients with complete clinical and pathological data and signed informed consent. Patients with other hematological or solid malignancies, liver and kidney dysfunction, autoimmune diseases, or infectious diseases were excluded. Furthermore, 30 patients with DLBCL without remission after 6 cycles of rituximab treatment were selected as the DLBCL-R group, including 18 males and 12 females, aged 32-64 years. At the same time, another 35 patients with reactive hyperplasia of lymph nodes, confirmed by pathology at The Affiliated Hospital of Southwest Medical University, were selected as the control group, including 23 males and 12 females, aged 34-68 years. There was no significant difference in the general data among the three groups (
DLBCL cell lines SUDHL-4 (SUD, GCB subtype), OCI-LY8 (LY8, GCB subtype), and NU-DUL-1 (DUL, ABC subtype) and 293T cells were purchased from the American Type Culture Collection (ATCC). LY8 cells were cultured in Iscove modified Dulbecco's medium (HyClone) containing 10% fetal bovine serum (FBS; Gibco) and 1% penicillin/streptomycin. SUD and DUL cells and 293T cells were cultured in RPMI-1640 medium, containing 10% FBS and 1% penicillin/streptomycin (HyClone), at 37°C under 5% CO2. When necessary, 1% antibiotics (penicillin, streptomycin, amphotericin) (Gibco) were added to the medium to maintain the culture. Cells were passaged every 2-3 days.
SUD cells were cultured in DMEM or RPMI-1640 medium with 10% EV-depleted FBS and 1% penicillin/streptomycin for 48 h. The supernatant was centrifuged at 100 × g for 5 min to remove cells and cellular debris, and then centrifuged at 3,600 × g and 4°C for 30 min to remove large vesicles. The supernatant was then filtered through a 0.2
EV particles were resuspended in 1 ml diluent C. PKH-26 (2
According to the manufacturer's instructions, miR-125b-5p inhibitor and its negative control (NC) (50 nM, GenePharma Co., Ltd.), pcDNA-TNFAIP3, and pcDNA-NC (40 nM, Sangon Biotech Co., Ltd.) vectors were transfected into LY8 or DUL cells using Lipofectamine™ 2000 (Thermo Fisher Scientific) according to the manufacturer's instructions. The DLBCL cells were then incubated with the conditioned medium from SUD cells treated with 30
miR-125b-5p inhibitor and its NC were transfected into SUD cells using Lipofectamine™ 2000, followed by incubation for 4 h at 37°C. The cells were cultured in complete medium for 48 h, and then EVs were isolated and incubated with LY8 and DUL cells.
Cells in the logarithmic phase were collected and treated with rituximab (2.5, 5, 10, 20, and 40
Subsequently, 10
Cell apoptosis was detected using the PE Annexin V Apoptosis Detection Kit with 7-aminoactinomycin D, according to the manufacturer's instructions (BD Bioscience). The number of apoptotic cells was quantified using the BD FACSCalibur flow cytometer system (BD Bioscience) and CellQuest Pro software (BD Bioscience).
The TNFAIP3 3′UTR fragment containing the miR-125b-5p binding site (WT) and the fragment containing the site-directed mutagenesis modification site (MUT) were cloned into psiCHECK-2.0 vector (Promega). Then, the 293T cells (ATCC) treated with miR-125b-5p mimic or miR-125b-5p mimic NC (RiboBio) were co-transfected with WT or MUT plasmids, with phRL-tk transfection (
The RNAiso plus kit (Takara, Dalian, China) was used to extract total RNA from SUD, LY8, and DUL cells, EVs, and tissues. The total RNA was reverse transcribed into cDNA using PrimeScript RT reagent kit (Takara). RT-qPCR was performed on a 7500 Real-Time PCR system using the SYBR-Green PCR kit (Takara Bio). The reaction conditions were pre-denaturation at 95°C for 10 min, denaturation at 95°C for 10 sec, annealing at 60°C for 20 sec, and extension at 72°C for 34 sec, a total of 40 cycles.
Patient focus or mouse tumor tissue homogenate or cells were lysed in RIPA buffer containing 50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% sodium deoxycholate, 5 mM EDTA, 0.1 mM PMSF, and 2 mg/ml aprotinin. Protein concentration was measured using the BCA kit (Beijing Solarbio Science & Technology Co., Ltd.). Then, the proteins (50
Female nude mice (5-6 weeks old) were purchased from the Shanghai Experimental Animal Center and raised under aseptic laminar flow conditions. The mice were reared at 50-60% humidity and 25°C, and maintained in a 12 h light/dark cycle. Food and water were provided a Extracellular vesicles d libitum.
Each mouse was injected with 2×107 LY8 cells into the right abdomen. When a measurable tumor (approximately 100 mm3) was observed at the injection site after 3 weeks, the mice were subjected to drug treatment. Based on body weight, the mice were randomly allocated into 3 groups, with 10 mice in each group: The LY8 group (injected with LY8 cells + 10 mg/kg rituximab), GW group (injected with the same dose of GW4869 medium + 10 mg/kg rituximab), and EV group (injected with 30
All data were processed using the IBM SPSS Statistics version 21.0 software (IBM Corp.). Data were first verified to show normal distribution and homogeneity of variance. Data were expressed as means ± standard deviation or counts. An independent samples t-test or χ2 was used to compare two groups. One-way analysis of variance (ANOVA) was applied for comparison among multiple groups, followed by Tukey's multiple comparisons test. P<0.05 indicated a statistically significant difference.
DLBCL is the most common histological subtype of NHL (
Next, in order to test our hypothesis, the TNFAIP3-expressing pcDNA vector was transfected into LY8 and DUL cells, which were then treated with different concentrations of rituximab. We confirmed the overexpression of TNFAIP3 with RT-qPCR and western blotting (P<0.001) (
Previous findings have shown that miRs can inhibit the expression of tumor-specific genes in cancer (
To identify the role of miR-125b-5p in anti-DLBCL treatment, we used the miR-125b-5p inhibitor to intervene with miR-125b-5p expression in LY8 and DUL cells, and then treated the cells with different concentrations of rituximab. The results of the MTT assay revealed that the IC50 value for cells with low miR-125b-5p expression was notably reduced compared with that for NC cells (LY8: 11.89±1.21 vs. 6.01±0.89
Tumor EVs are important mediators for intercellular communication between tumor cells and other cells located, not only in the microenvironment, but also at further distances (
Next, EV-treated LY8 and DUL cells were incubated with different concentrations of rituximab. Results of the MTT assay demonstrated that the IC50 value for EV-treated LY8 and DUL cells was significantly enhanced (LY8: 11.32±1.32 vs. 25.21±1.23
Next, a combined experiment was performed to verify that the EV-carried miR-125b-5p increased DLBCL resistance to rituximab by affecting TNFAIP3. The EVs isolated from LY8 cells were incubated with LY8 and DUL cells transfected with pcDNA-TNFAIP3 or pcDNA-NC, followed by treatment with 5
Based on the evidence that EVs can increase the resistance of DLBCL cells to rituximab, we further verified this effect in a mouse model. Subcutaneous injection of LY8 cells into mice resulted in the localized formation of tumor tissue masses. Mice were treated with EVs, GW4869 medium, and rituximab, and their tumors were monitored and finally extracted for measurement (
TNFAIP3 is frequently inactivated in B-cell lymphomas (
Previous findings have emphasized that TNFAIP3 alterations are involved in DLBCL pathogenesis (
The risk of drug resistance is reportedly 2.14-fold higher in DLBCL patients with abnormal miR expression (
Tumor-derived exosomal miRs play key roles in tumor chemoresistance (
Next, a combined experiment was performed to verify that the miR-125b-5p carried by EVs increased DLBCL resistance to rituximab by affecting TNFAIP3. pcDNA-transfected DLBCL cells were treated with LY8-EVs and rituximab, resulting in decreased activity and enhanced apoptosis rate and CD20 expression. B-cell lymphoma-derived EVs carry the CD20 target antigen and act as bait, enabling lymphoma cells to evade immunotherapy (
Results of the present study demonstrated that the EVs carrying miR-125b-5p can reduce DLBCL sensitivity to rituximab by inhibiting TNFAIP3 expression. However, the regulatory mechanism of the miR-125b-5p/TNFAIP3 axis in the sensitivity of DLBCL to rituximab requires further investigation. Whether the miR-125b-5p/TNFAIP3 axis can be used as a therapeutic approach for DLBCL also requires further study. Future studies aim to focus on the pathways downstream of the miR-125b-5p/TNFAIP3 axis that influence the sensitivity of DLBCL to rituximab.
The analyzed data sets generated during the study are available from the corresponding author on reasonable request.
LZ conceived and designed the study. SXZ, TJZ, XML and JLT contributed to research, conducting of experiments, analysis and review of data, as well as the writing and editing of the manuscript. All authors read and approved the final manuscript.
Study approval was obtained from the Ethics Committee of The Affiliated Hospital of Southwest Medical University (no. 20180306006). The clinical registration number is KY2019091. Patient consent was obtained from the patients. Animal experiments were implemented on the guide for the care and use of laboratory animals.
Not applicable.
The authors declare that they have no competing interests.
Not applicable.
TNFAIP3 is poorly expressed in DLBCL. (A and B) TNFAIP3 mRNA and protein levels in tissues analyzed with RT-qPCR and western blotting (n=35 Controls, 34 DLBCL, 30 DLBCL-R). One-way ANOVA was used for comparisons among multiple groups, followed by Tukey's multiple comparisons test. ***P<0.001. DLBCL, patients with diffuse large B-cell lymphoma; DLBCL-R; patients with DLBCL without remission after six cycles of rituximab treatment; Control, patients with reactive hyperplasia of lymph nodes.
Overexpression of TNFAIP3 increases the sensitivity of DLBCL to rituximab. (A and B) Overexpression efficiency of pcDNA-TNFAIP3 transfection verified with RT-qPCR and western blotting. (C) Growth inhibition rate and IC50 value for DLBCL cells in each group, calculated using the MTT assay. (D) The apoptosis rate of DLBCL cells in each group determined with flow cytometry. (E and F) CD20 expression in DLBCL cells measured with RT-qPCR and western blotting. Experiments were performed three times. Data are expressed as means ± standard deviations. Independent samples t-test was used to compare two groups in panels C/D/E/F. One-way ANOVA was used for comparisons among multiple groups in panels A/B, followed by Tukey's multiple comparisons test. *P<0.05, **P<0.01, ***P<0.001.
miR-125b-5p targets TNFAIP3 in DLBCL. (A) miR-125b-5p expression in tumor tissues, analyzed with RT-qPCR. (B) The binding site of miR-125b-5p with TNFAIP3 predicted using the starBase database. (C) The targeting relationship between miR-125b-5p and TNFAIP3 verified via dual-luciferase assay. (D) The effect of miR-125b-5p inhibition on miR-125b-5p expression analyzed with RT-qPCR. (E and F) TNFAIP3 expression in DLBCL cells with miR-125b-5p knockdown, analyzed with RT-qPCR and western blotting. The experiments were performed three times. Data are expressed as means ± standard deviations. Data in panels A/D/E/F were analyzed using one-way ANOVA, followed by Tukey's multiple comparisons test; data in panel C were analyzed using the t-test. **P<0.01, ***P<0.001.
miR-125b-5p downregulation increases the sensitivity of DLBCL to rituximab. DLBCL cells were treated with an mir-125b-5p inhibitor or inhibitor NC and then with rituximab. (A) Growth inhibition rate and IC50 value of DLBCL cells in each group, calculated using the MTT assay. (B) The apoptosis rate of DLBCL cells determined with flow cytometry. (C and D) CD20 expression in DLBCL cells analyzed with RT-qPCR and western blotting. The experiments were performed three times. Data are expressed as means ± standard deviations. Independent samples t-test was used to compare two groups. *P<0.05, **P<0.01, ***P<0.001.
Extracellular vesicles (EVs) carry miR-125b-5p into DLBCL cells. (A) The morphology of EVs secreted by DLBCL cells observed under transmission electron microscope. (B) The expression of CD9, TSG101, and calnexin on the surface of SUD-EVs analyzed with western blotting. (C) The concentration and particle size of EVs measured with a nanoparticle tracking analyzer. (D) miR-125b-5p expression in EVs, analyzed with RT-qPCR. (E) DLBCL cells incubated with PKH-26-labeled SUD-EVs, observed under confocal microscope. (F) miR-125b-5p expression measured with RT-qPCR. (G and H) TNFAIP3 levels in DLBCL cells, analyzed with RT-qPCR and western blotting. The experiments were performed three times. Data are expressed as means ± standard deviations. One-way ANOVA was used for comparisons among multiple groups in panel D, followed by Tukey's multiple comparisons test; t-test was used for comparisons between two groups in panels F/G/H. **P<0.01, ***P<0.001.
Extracellular vesicles (EVs) carrying miR-125b-5p reduce the sensitivity of DLBCL to rituximab. miR-125b-5p inhibitor was transfected into SUD cells, EVs were extracted, and then used with rituximab to treat LY8 and DUL cells. (A) Growth inhibition rate and IC50 value of DLBCL cells in each group, calculated using the MTT assay. (B) DLBCL cell viability determined using the MTT assay. (C) The apoptosis rate of DLBCL cells determined with flow cytometry. (D and E) CD20 expression in DLBCL, analyzed with RT-qPCR and western blotting. (F and G) miR-125b-5p expression in SUD, EVs, and DLBCL, analyzed with RT-qPCR. (H and I) TNFAIP3 levels in DLBCL cells, analyzed with RT-qPCR and western blotting. The experiments were performed three times. Data are expressed as means ± standard deviations. One-way ANOVA was used for comparisons among multiple groups, followed by Tukey's multiple comparisons test; t-test was used for comparisons between two groups in panels A/B/G/H/I. *P<0.05, **P<0.01, ***P<0.001.
Overexpression of TNFAIP3 enhances the sensitivity of extracellular vesicle (EV)-treated DLBCL to rituximab. DLBCL cells were treated with pcDNA-TNFAIP3 or pcDNA-NC, incubated with EVs, and then treated with rituximab. (A) Cell viability determined by MTT assay. (B) The apoptosis rate of DLBCL cells determined with flow cytometry. (C and D) CD20 expression in DLBCL cells analyzed with RT-qPCR and western blotting. The experiments were performed three times. Data are expressed as means ± standard deviations. One-way ANOVA was used for comparisons among multiple groups, followed by Tukey's multiple comparisons test. **P<0.01, ***P<0.001.
Extracellular vesicles (EVs) reduce the sensitivity of DLBCL model mice to rituximab through the miR-125b-5p/TNFAIP3 axis. Subcutaneous injection with LY8 cells was used to establish the DLBCL mouse model. Mice were treated with the conditioned medium from SUV cells treated with GW4869, and EVs. Mice in both groups were treated with rituximab. (A) Mice were examined regularly. (B) Tumor volume on different days. (C) Tumor weight in each group. (D) TNFAIP3 and CD20 levels in mouse tumors analyzed by western blotting (N=5). Data are expressed as means ± standard deviations. One-way ANOVA was used for comparisons among multiple groups, followed by Tukey's multiple comparisons test. **P<0.01, ***P<0.001.
Clinical characteristic of DLBCL patients.
Characteristics | Control (N=35) | DLBCL (N=34) | DLBCL+R (N=30) | χ2/F | P-value |
---|---|---|---|---|---|
Age |
34-68 (mean=49.74) | 38-64 (mean=49.03) | 32-64 (mean=45.30) | 2.622 | 0.078 |
Male | 23/35 | 20/34 | 18/30 | 0.394 | 0.821 |
Pathology type | |||||
GCB | \ | 15/34 | 13/30 | 0.345 | 0.842 |
ABC | \ | 14/34 | 11/30 | ||
Unknown | \ | 5/34 | 6/30 | ||
Performance status (ECOG) | |||||
0-1 | 28/35 | 29/34 | 26/30 | 0.611 | 0.737 |
2 | 7/35 | 5/34 | 4/30 | ||
Lactic dehydrogenase | |||||
Normal | 23/35 | 20/34 | 19/30 | 0.359 | 0.836 |
Elevated | 12/35 | 14/34 | 11/30 | ||
Ann Arbor stage | 0.779 | 0.446 | |||
I-II | \ | 19/34 | 20/30 | ||
III-IV | \ | 15/34 | 10/30 |
DLBCL, diffuse large B-cell lymphomas; DLBCL+R, diffuse large B-cell lymphomas + resistance (resistance to rituximab); GCB, germinal center B cell-like; ABC, activated B cell-like; ECOG, Eastern cooperative oncology group.
One-way analysis of variance (ANOVA) used for comparison among multiple groups followed by Tukey's multiple comparisons test, or Chi square test used to compare the data.
Primer sequences for RT-qPCR.
Primer | Sequences (5′-3′) | Accession |
---|---|---|
F: ATGGCTGAACAAGTCCTTCCTCAG | NM_001270507 | |
R: TTAGCCATACATCTGCTTGAACTGA | ||
F: ATGACAACACCCAGAAATTCAGTA | NM_021950 | |
R: TTAAGGAGAGCTGTCATTTTCTAT | ||
F: TCCCTGAGACCCTAACTTGTGA | MIMAT0000423 | |
R: TCACAAGTTAGGGTCTCAGGGA | ||
F: CGCTTCGGCAGCACATATAC | NR_004394 | |
R: AATATGGAACGCTTCACGA | ||
F: ATGGTTTACATGTTCCAATATGA | NM_001256799 | |
R: TTACTCCTTGGAGGCCATGTGG |