Cell lines SUP-B15 and 293T were purchased from The American Type Culture Collection (ATCC). The SUP-B15 cell line was authenticated by short tandem repeat DNA profiling analysis at Suzhou Genetic Testing Biotechnology Corporation, China. SUP-B15 cells were cultured in Iscove's modified Dulbecco's medium (IMDM) with 20% fetal bovine serum (FBS), and 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) with 10% FBS. All cells were maintained in a humidified incubator at 37°C in an atmosphere of 5% CO₂.

The transduction protocols were described in our previous paper (7). Briefly, 12 µg PHY-310 lentiviral vector (hU6-MCS-CMV-ZsGreen1-PGK-Puro; Shanghai Hanyin Biotechnology Co., Ltd.) containing an shRNA targeting CD9 [the target sequence for CD9 shRNA: 5′-AGGAAGTCCAGGAGTTTTA-3′ (synthesized by Shanghai Hanyin Biotechnology Co., Ltd.); primers used for targeting the interference sequence of the CD9 gene: F: GATCCAGGAAGTCCAGGAGTTTTATTCAAGAGATAAAACTCCTGGACTTCCTTTTTTTG and R: AATTCAAAAAAAGGAAGTCCAGGAGTTTTATCTCTTGAATAAAACTCCTGGACTTCCTG) and 9 µg lentiviral packaging vector LV-PV001 [a second-generation packaging vector; Han Yin Biotechnology (Shanghai) Co., Ltd.] were mixed with polyethylenimine (Sigma-Aldrich; Merck KGaA) and incubated for 20 min at 37°C. Then, the subconfluent 293T cells (1.5×10⁸/dish) in a 10-cm culture dish were transfected with the transfection mixture. The blank PHY-310 vector (in order to exclude the effect of the lentiviral vector on the experimental results) was used as a negative control. At 48 h after transfection, lentiviral particles produced from the transfected 293T cells were harvested and purified by ultra-centrifugation at 3,000 × g for 2.5 h at 4°C. SUP-B15 cells were transduced with the lentiviral particles [multiplicity of infection (MOI)=100)] by centrifugation in the presence of 8 µg/ml polybrene (Sigma-Aldrich; Merck KGaA) at 37°C for 4 h, and then stable cell lines were generated by selection with puromycin (1 µg/ml) for 48 h. The efficiency of CD9 knockdown was evaluated by reverse transcription-quantitative PCR (RT-qPCR). The method of RT-qPCR was carried out according to a previous study (7).

The levels of phosphorylated-PI3K (p-PI3K) in SUP-B15 cells were measured using the Human p-PI3K ELISA kit (cat. no. M1060625; Shanghai Enzyme-linked Biotechnology Co., Ltd.) according to the manufacturer's protocol. Briefly, cells were lysed by three consecutive freeze-thawing cycles (10 min each), and then centrifuged at 860 × g for 10 min at 4°C. The total protein concentration in the supernatant was determined using a BCA protein assay kit (Beyotime Institute of Biotechnology). Subsequently, 50 µl of total protein extraction (1:5 dilution with PBS) or standards along with 50 µl of biotin-labeled anti-p-PI3K antibody were incubated on an antibody-coated plate for 1 h at 37°C. Wells were then washed three times. The next step involved adding 80 µl of streptavidin-labeled horseradish peroxidase (HRP) to each well, followed by incubation at 37°C for 30 min. After washing for three times, 50 µl of substrate solution A along with 50 µl of substrate solution B was added to each well and the plate was incubated at 37°C for 10 min. The reaction was quenched by the addition of 50 µl of stop solution. The plate was analyzed by evaluating the absorbance at 450 nm using a Spectra MAX M5 microplate reader (Molecular Devices).

The methods of protein extraction and western blotting were carried out as previously described (7). Briefly, cells were lysed using RIPA lysis buffer (Beyotime Institute of Biotechnology) and the total protein concentration was measured by the BCA protein assay kit (Beyotime Institute of Biotechnology). Total protein was then separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to a PVDF membrane. The membranes were blocked with 5% skim milk for 1 h at room temperature, and sequentially incubated overnight with primary antibodies at 4°C. The primary antibodies used were anti-phosphorylated-AKT (anti-p-AKT; 1:1,000 dilution, cat. no. 9018; Cell Signaling Technology, Inc.), anti-AKT (1:1,000 dilution, cat. no. 2938; Cell Signaling Technology, Inc.), anti-p53 (1:1,000 dilution, cat. no. CY5131; Abways, Inc.), anti-p21 (1:1,000 dilution, cat. no. CY5088; Abways, Inc.), anti-cleaved caspase 3 (1:1,000 dilution, cat. no. CY5051; Abways, Inc.), anti-P-glycoprotein (anti-P-gp; 1:1,000 dilution, cat. no. 13978; Cell Signaling Technology, Inc.), anti-multidrug-resistance associated protein 1 (anti-MRP1; 1:1,000 dilution, cat. no. CY6878; Abways, Inc.), anti-breast cancer resistance protein (anti-BCRP; 1:1,000 dilution, cat. no. 10051-1-AP, ProteinTech Group, Inc.), anti-matrix metalloproteinase 2 (anti-MMP2; 1:1,000 dilution, cat. no. BS1236; Bioworld Technology, Inc.), anti-phosphorylated-focal adhesion kinase (anti-p-FAK; 1:1,000 dilution, cat. no. CY6207; Abways, Inc.), anti-FAK (1:1,000 dilution, cat. no. CY5464; Abways, Inc.) and anti-β-actin (1:5,000 dilution, cat. no. ab2001; Abways, Inc.). Following incubation using HRP-conjugated anti-rabbit antibody (1:10,000 dilution, cat. no. 7074P2; Cell Signaling Technology, Inc.) or HRP-conjugated anti-mouse antibody (1:10,000 dilution, cat. no. 7076; Cell Signaling Technology, Inc.) at room temperature for 2 h, the protein bands were analyzed with chemiluminescent solution (ECL Western Blotting Detection Reagents; GE Healthcare Life Sciences). The relative level of protein expression was quantified by ImageJ software (version 1.49p; National Institutes of Health) and standardized to β-actin levels.

The cell proliferation was determined by use of a Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc.). Cells were cultured in 96-well microplates at a density of 3×10³ cells/well. After incubation at 37°C for 24, 48, 72, 96 and 120 h, 10 µl of CCK-8 solution was added to each well and the cells were incubated at 37°C for 2 h. The absorbance was measured at 450 nm using a Spectra MAX M5 microplate reader (Molecular Devices).

The measurement of in vitro drug sensitivity to chemotherapeutic agents were carried out according to our previous study (7). Cells were exposed to various concentrations of chemotherapeutic agents, including vincristine (VCR; Selleck Chemicals), daunorubicin (DNR; MedChemExpress), cyclophosphamide (CPM; MedChemExpress) and dexamethasone (DXM; Selleck Chemicals), at 37°C for 48 h, and then CCK-8 assay was used to detect the cell viability. The optical density (OD) was measured at 450 nm using a Spectra MAX M5 microplate reader (Molecular Devices). The percentage of cytotoxicity was calculated by the following formula: Cytotoxicity (%)=(1-mean OD of treated/mean OD of control) ×100.

An artificial basement membrane was prepared by adding 0.5 µg Superfibronectin (Sigma-Aldrich; Merck KGaA) into each well of a 96-well plate and incubating at 4°C overnight. Subsequently, a total of 1×10⁵ cells resuspended in 200 µl IMDM medium was seeded into each well of a 96-well plate and allowed to adhere to the Superfibronectin at 37°C for 90 min in a humidified 5% CO₂ atmosphere. Non-adherent cells were removed by rinsing with PBS and adherent cells were then quantified by CCK-8 assay.

For the cell migration assay, a total of 1×10⁴ cells in serum-free IMDM medium (100 µl) was placed in the upper chamber of an 8-µm pore size Transwell plate (Corning, Inc.) and 800 µl of IMDM medium containing 10% FBS was added to the lower chamber as a chemoattractant. After incubation for 72 h at 37°C in a 5% CO₂ atmosphere, cells that migrated to the lower chamber were harvested and stained with 1% crystal violet at room temperature for 30 min after fixation with 4% paraformaldehyde at room temperature for 20 min. Finally, a hemocytometer was used to count the cells under a light microscope (magnification, ×100). The invasion assay was performed using the same method as the migration assay, except for the precoating of the upper chamber with 50 µl Matrigel (1 mg/ml; BD Biosciences) at 37°C for 5 h.

The full-length cDNA of CD9 was cloned into the mammalian expression plasmid pcDNA3.1-Flag-MYC (Gene Universal), forming a MYC tagged CD9 expression vector pcDNA3.1-MYC-CD9, while full-length cDNA of PI3K-p85α or PI3K-p85β was inserted into pcDNA3.1-Flag-HA (Gene Universal), forming a HA tagged PI3K-p85α expression vector pcDNA3.1-HA-p85α or PI3K-p85β expression vector pcDNA3.1-HA-p85β. The empty plasmids, pcDNA3.1-Flag-MYC and pcDNA3.1-Flag-HA, were used as negative control groups. Vector pET28 (Gene Universal) was used to construct vectors expressing glutathione S-transferase (GST)-p85α or GST-p85β fusion proteins.

MYC-CD9 expression vector (2.5 µg) was mixed with Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, Inc.) and incubated for 20 min at 37°C. Then, 293T cells in 10-cm dishes were grown to 90% confluence and transfected with the mixture. At 48 h after transfection, the cells were harvested and lysed by RIPA lysis buffer (Beyotime Institute of Biotechnology). After centrifugation at 16,560 × g for 15 min at 4°C, the supernatants were isolated. On the other hand, BL-21 bacterial cells were transformed with plasmids encoding the GST-tagged proteins and then grown at 37°C until reaching log phase. GST protein expression was induced by incubation with isopropyl-1-thio-β-galactopyranoside (IPTG; 1 mmol/l) for 6 h. In order to purify the GST fusion proteins, cells were lysed by sonication in lysis buffer [50 mmol/l Tris (pH 7.4), 150 mmol/l NaCl and 1% NP-40], and the resulting lysate was incubated for 1 h at 4°C with glutathione-agarose beads (cat. no. G4510; Sigma-Aldrich; Merck KGaA). The beads were harvested by centrifugation and washed with lysis buffer.

For CD9 binding, 50 µl of whole cell lysate from transfected 293T cells were incubated for 48 h with the GST-tagged proteins bound to beads. Unbound CD9 protein was removed by three washes with lysis buffer (1 ml each). Bound proteins were eluted by boiling in 1X loading buffer, separated by 10% SDS-PAGE, and examined by immunoblot analysis with anti-MYC antibody (1:1,000 dilution; cat. no. A7470; Sigma-Aldrich; Merck KGaA).

MYC-CD9 expression vector (2.5 µg) and either 2.5 µg of HA-PI3K-p85α or HA-PI3K-p85β expression vector were mixed with Lipofectamine 2000 transfection reagent (Thermo Fisher Scientific, Inc.) and incubated for 20 min at 37°C. Then, 293T cells in 10-cm dishes were grown to 70–90% confluence and transfected with the mixture. At 48 h after transfection, the cells were harvested and lysed by RIPA lysis buffer (Beyotime Institute of Biotechnology). Following the centrifugation using the same method described previously, the supernatants were isolated and immunoprecipitated with 5 µl anti-MYC antibody (cat. no. A7470; Sigma-Aldrich; Merck KGaA). Detection of the co-precipitated HA-PI3K-p85α or HA-PI3K-p85β was performed using western blotting by incubating with an anti-HA antibody (1:1,000 dilution, cat. no. ab49969; Abcam, Inc.). The supernatants described above were also subjected to direct western blot analysis to confirm the expression of MYC-CD9 and either HA-PI3K-p85α or HA-PI3K-p85β.

SUP-B15 cells (5×10³) were treated with the PI3K/AKT pathway inhibitor LY294002 (0.6 µmol/l; cat. no. HY-10108, MedChemExpress) at 37°C for 24 h, and then subjected to cell proliferation, drug sensitivity, adhesion, migration, invasion, ELISA and western blot assays, respectively.

Data are expressed as the mean ± standard deviation (SD) from at least three independent experiments. Statistical significance among groups was assessed with unpaired Student's t-test and two-way ANOVA followed by Sidak's multiple comparisons test. A P-value of <0.05 was considered as indicative of a statistically significant difference. All statistical analyses were performed using GraphPad Prism version 8.0.1 (GraphPad Software, Inc.).

To study the effect of CD9 on the PI3K/AKT pathway, we assessed activation of the pathway in a CD9-knockdown B-ALL cell line SUP-B15. We used the lentiviral-mediated shRNA approach in SUP-B15 cells to establish an efficient permanent method of downregulating the expression of CD9. Lentiviral delivery of shRNA targeted against CD9 led to a significantly downregulation of CD9 mRNA in SUP-B15 cells, as measured by RT-qPCR (Fig. S1). ELISA results showed that the level of p-PI3K protein was significantly reduced in the SUP-B15 cells transduced with the PHY-310 lentiviral vector containing shRNA targeting CD9 (SUP-B15-shCD9 group) compared with wide-type SUP-B15 cells (SUP-B15-WT group) and those cells transduced with a blank PHY-310 vector (SUP-B15-shControl group; Fig. 1A). In addition, western blot analysis revealed a significant reduction in the p-AKT/AKT ratio in SUP-B15 cells after CD9 knockdown (Fig. 1B and C). In addition to p-PI3K and p-AKT, we also tested their downstream targets, including drug resistance-(such as P-gp, MRP1 and BCRP) and cell motility-related molecules (such as MMP2 and p-FAK), by western blotting in SUP-B15 cells after CD9 knockdown. Silencing of CD9 significantly decreased P-gp, MRP1, BCRP, MMP2 expression and the p-FAK/FAK ratio (Fig. 1B and C).

To confirm the interaction between CD9 and PI3K-p85, we constructed GST-PI3K-p85α and GST-PI3K-p85β prokaryotic expression vectors, as well as MYC-CD9 mammalian expression vector. Using these vectors we assessed the interaction between CD9 protein and either PI3K-p85α or PI3K-p85β by GST pull-down assay. Successful transfection of 293T cells with the CD9 expression plasmid was confirmed by western blot analysis (Fig. S2). As shown in Fig. 2, MYC-CD9 recombinant protein was able to bind to either GST-PI3K-p85α or GST-PI3K-p85β fusion protein instead of the GST control protein, suggesting that CD9 directly binds to both PI3K-p85α and PI3K-p85β in vitro.

Since CD9 interacts directly with both PI3K-p85α and PI3K-p85β in vitro, we next investigated whether CD9 binds to PI3K-p85 in vivo. We constructed expression vectors for MYC-tagged CD9 as well as HA-tagged PI3K-p85α or PI3K-p85β. Successful transfection of 293T cells with PI3K-p85α expression plasmid or PI3K-p85β expression plasmid was confirmed by western blot analysis (Figs. S3 and 4). Then, MYC-CD9 expression vector and either the HA-PI3K-p85α or HA-PI3K-p85β expression vector were transfected into 293T cells and the cell extracts were subjected to the co-immunoprecipitation assay using an anti-MYC antibody. Both PI3K-p85α and PI3K-p85β were detected in immune complexes of MYC-CD9 (Fig. 3), supporting that CD9 interacts with both PI3K-p85α and PI3K-p85β in vivo.

Since CD9 is involved in the regulation of the biological behavior of B-ALL cells through the PI3K/AKT pathway, we furthermore investigated the anti-leukemia effects of the inhibition of the PI3K/AKT pathway in SUP-B15 cells using LY294002, a PI3K/AKT pathway inhibitor. The results showed that the PI3K/AKT inhibitor LY294002 mirrored the effects of CD9 knockdown in SUP-B15 cells. Treatment with LY294002 inhibited cell proliferation (Fig. 4A) as well as increased the inhibitory response of SUP-B15 cells to VCR (Fig. 4B), DNR (Fig. 4C), CPM (Fig. 4D) and DXM (Fig. 4E), respectively. In addition, treatment with LY294002 inhibited adhesion (Fig. 4F), migration (Fig. 4G) and invasion (Fig. 4H) of SUP-B15 cells. To test the effect of LY294002 on the expression of p-PI3K, ELISA was performed after exposure to the compound for 24 h. The protein level of p-PI3K was significantly reduced after treatment with LY294002 (Fig. 5A). Western blot assay also showed a reduction in the p-AKT/AKT ratio by LY294002 treatment (Fig. 5B and C), suggesting that PI3K/AKT signaling was inhibited. Additionally, the treatment with LY294002 increased the protein levels of p53, p21 and cleaved caspase-3, while decreasing P-gp, MRP1, BCRP, MMP-2 expression and the p-FAK/FAK ratio (Fig. 5B and C).