MicroRNAs (miRs) serve a key role in carcinogenesis. miR-148a-3p has been demonstrated to act as a tumor suppressor in several tumors, such as epithelial ovarian cancer and esophageal cancer. However, to the best of our knowledge, the role of miR-148a-3p in cervical cancer remains unclear. In the present study, the expression levels of miR-148a-3p measured by reverse transcription-quantitative PCR were significantly decreased in cervical cancer tissues compared with that in normal cervical tissues. Furthermore, overexpression of miR-148a-3p markedly suppressed the proliferation of cervical cancer cells. The luciferase reporter assay demonstrated that DNA methyltransferase 1 (DNMT1) was the target gene of miR-148a-3p and that its expression measured by western blotting was inhibited by miR-148a-3p in cervical cancer cells. Correlation analysis highlighted that the expression levels of the undifferentiated embryonic cell transcription factor-1 (UTF1) were negatively associated with the expression levels of DNMT1 in cervical cancer tissues. Furthermore, DNMT1 knockdown increased the expression of UTF1 and decreased the methylation level of UTF1 promoter. These data demonstrated the expression levels of UTF1 were regulated by DNMT1 methylation in cervical cancer cells. Collectively, the results of the present study suggested that miR-148a-3p may inhibit the proliferation of cervical cancer cells by regulating the expression levels of DNMT1/UTF1, which provides potential therapeutic targets for cervical cancer.
Cervical cancer is one of the most common malignant tumors to occur in women (
MicroRNAs (miRNAs/miRs) have been demonstrated to serve an important role in tumorigenesis (
A total of 20 cervical cancer (mean ± SD age, 56±10.05 years; age range, 39–68 years old, all female) and 8 normal cervical samples (mean ± SD age, 53±9.13 years; age range, 40–65 years old, all female) were collected from patients that underwent surgical resection at The Second Affiliated Hospital of Xi'an Jiaotong University (Xi'an, China) between February 2017 and February 2018. In cases with histologically confirmed cervical cancer, only patients who underwent diagnostic procedures, such as biopsy were included. Any patients with non-epithelial cervical cancer, recurrent disease and other malignancies were excluded from the present study. The normal cervical tissues were obtained from patients with uterine leiomyoma. None of the patients had received chemotherapy, immunotherapy or radiotherapy prior to specimen collection. All tissue samples were frozen in liquid nitrogen at −80°C until required for further experiments. The present study was approved by the Ethics Committee of The Second Affiliated Hospital of Xi'an Jiaotong University (Xi'an, China) and the patients provided written informed consent prior to sample collection.
The HeLa and SiHa human cervical cancer cell lines and human embryonic kidney cell line 293T were purchased from American Type Culture Collection and cultured in DMEM (Sigma-Aldrich; Merck KGaA) supplemented with 10% heat-inactivated FBS (Invitrogen; Thermo Fisher Scientific, Inc.), 80 U/ml penicillin and 80 ug/ml streptomycin. The cells were maintained at 37°C with 5% CO2.
Total RNA was extracted from frozen samples and cell lines using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). RT reactions were performed using the PrimeScript RT reagent kit (Takara Bio, Inc.) according to the manufacturer's protocol. Subsequently, qPCR was performed using the SYBR-Green Master mix (Takara Bio, Inc.) according to the manufacturer's protocol. GAPDH and U6 spliceosomal RNA were used as an internal control for the quantification of mRNAs and miRNAs, respectively. The primer sequences are shown in
Cell proliferation was measured using a CCK-8 assay (Beyotime Institute of Biotechnology). Briefly, 1×103 cells/well were cultured in 96-well plates and assessed the following day. The assessment was carried out for 6 days in total. At the same time point on 2, 4, 6 days, 10 µl CCK-8 solution was added to each well and the samples were incubated for 4 h at 37°C. The absorbance was measured at a wavelength of 450 nm using a plate reader. Each experiment was performed in triplicate.
Total protein was extracted from frozen samples and cell lines using RIPA lysis buffer (Beyotime Institute of Biotechnology). The protein concentration was estimated using a BCA assay and 20 µg protein/lane was separated via 10% SDS-PAGE, and then transferred onto PVDF membranes (MilliporeSigma). The membranes were blocked with 5% skimmed milk suspended in TBST at room temperature for 2 h. The membranes were incubated with primary antibodies against UTF1 (1:100; cat. no. ab65453; Abcam); DNMT1 (1:200; cat. no. SC-20701; Santa Cruz Biotechnology, Inc.) or GAPDH (1:1,000; cat. no. AB-P-R 001; Hangzhou Xianzhi Biological Co., Ltd.) at 4°C overnight. Following the primary antibody incubation, the membranes were incubated with horseradish peroxidase-conjugated secondary antibodies (1:10,000; cat. no. BA1054; Wuhan Boster Biological Technology Co. Ltd.) at 37°C for 2 h. The membranes were briefly incubated with an enhanced chemiluminescence reagent (MilliporeSigma) at room temperature for 2 min and visualized using X-ray films. GAPDH was used to normalize the expression of the genes. Protein level was quantified using Quantity One software v.4.6, (Bio-Rad Laboratories, Inc.).
miR-148a-3p mimic (5′-UCAGUGCACUACAGAACUUUGU-3′), miRNA mimic control (5′-TTCTCCGAACGTGTCACGT-3′), DNMT1-short hairpin (sh) RNA plasmid expression vector (pGPU6/GFP/Neo, 5′-GGAUGAGUCCAUCAAGGAATT-3′) and control-shRNA (5′-UUCUCCGAACGUGUCACGUTT-3′) were purchased from Shanghai GenePharma Co., Ltd. Cells were incubated (1×105) in a 6-well plate for at 37°C for 24 h before transfection and transfected with either miR-148a-3p mimic, control mimic, DNMT1-shRNA and control-shRNA at a final concentration of 50 nM using Lipofectamine® 2000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C for 5 h according to the manufacturer's protocol. After 48 h, the cells were used for subsequent experiments.
293T cells were seeded into a 24 well plate at a density of 5×104 cells/well. Following incubation at 37°C for 24 h, a wild type or mutated DNMT1 3′-UTR luciferase reporter vector (Promega Corporation), combined with miR-148a-3p mimics (5′-UCAGUGCACUACAGAACUUUGU-3′; Shanghai GenePharma Co., Ltd.) or miRNA mimic control (5′-TTCTCCGAACGTGTCACGT-3′, Shanghai GenePharma Co., Ltd.), were transfected into the cells at a final concentration of 20 nM using a Vigofect transfection reagent [Weiglas Biotechnology (Beijing) Co., Ltd.] according to the manufacturer's protocol. At 48 h post-transfection, the firefly and
Bisulfite sequencing was carried out as previously described (
Statistical analysis was performed using SPSS version 16.0 software (SPSS, Inc.). Data are presented as the mean ± SD. An independent sample unpaired t-test and one-way ANOVA followed by Tukey's post hoc test were used for group comparisons. Correlation analysis was performed using Pearson's correlation analysis. The experiments were performed in triplicate and repeated three times independently. P<0.05 was considered to indicate a statistically significant difference.
To explore the role of miR-148a-3p in cervical cancer, its expression levels were assessed in cervical cancer and normal cervical tissues by RT-qPCR analysis. miR-148a-3p expression was significantly decreased in cervical cancer tissues compared with in normal cervical tissues (P<0.01;
To assess the effects of miR-148a-3p on the proliferation of cervical cancer cells, miR-148a-3p mimics were successfully transfected into HeLa and SiHa cells (
The protein expression levels of DNMT1 were significantly increased in cervical cancer tissues compared with in normal cervical tissues (P<0.001;
In addition, to further verify the regulatory effect of miR-148a-3p on DNMT1 expression, the expression of DNMT1 in miR-148a-3p overexpressing HeLa and SiHa cells were measured. DNMT1 mRNA (
In our previous study, UTF1 was demonstrated to serve an important tumor suppressive role in cervical carcinogenesis (
Numerous miRNAs have been reported to serve important roles in the pathogenesis of tumors by regulating cell proliferation, apoptosis and invasion (
The antiproliferative mechanism of action of miR-148a-3p was investigated by identifying its target gene, DNMT1, using bioinformatic analysis. Furthermore, a previous study has reported that miR-148a-3p directly represses the expression levels of DNMT1 in human colon cancer cells (
UTF1 is a stem cell-associated transcription factor, which serves a critical role in cell differentiation and development (
In summary, the results of the present study demonstrated that miR-148a-3p inhibited the proliferation of cervical cancer cells. The mechanism of action was associated with the regulation of the expression of DNMT1 and UTF1, which may provide potential therapeutic targets for cervical cancer.
Not applicable.
The present study was supported by the National Natural Science Foundation of China (grant no. 81702578).
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
QC and YW performed the experiments and data analysis. XW conceived and designed the study. QC and HD confirmed the authenticity of all the raw data. XW and HD reviewed and revised the manuscript for important intellectual content. HD participated in data analysis and draft writing. All authors read and approved the final manuscript.
The present study was approved by the Ethics Committee of The Second Affiliated Hospital of Xi'an Jiaotong University (approval no. 2017-113; Xi'an, China). All the patients signed written informed consent prior to participation in the present study.
Not applicable.
The authors declare that they have no competing interests.
Expression levels of miR-148a-3p in NC and CC tissues. CC, cervical cancer; NC, normal cervix; miR-148a-3p, microRNA-148a-3p.
miR-148a-3p inhibits the proliferation of HeLa and SiHa cervical cancer cells. The expression of miR-148a-3p in (A) HeLa and (B) SiHa cells by transfection with miR-148a-3p and control mimics. (C) miR-148a-3p expressing HeLa and (D) SiHa cell proliferation was inhibited compared with the control mimics. **P<0.01 vs. Ctr-mimics. Ctr, control; miR-148a-3p, microRNA-148a-3p.
DNMT1 expression is inversely correlated with miR-148a-3p expression in CC. (A) Detection of DNMT1 expression in NC and CC tissues was performed by western blot analysis. (B) Expression levels of DNMT1 in NC and CC tissues were normalized to GAPDH. (C) Assessment of the mRNA expression levels of DNMT1 in NC and CC tissues. (D) DNMT1 expression was negatively correlated with miR-148a-3p expression in CC tissues. CC, cervical cancer; DNMT1, DNA methyltransferase 1; miR-148a-3p, microRNA-148a-3p; NC, normal cervix.
miR-148a-3p targets the 3′-UTR of DNMT1. (A) Schematic diagram of the miR-148a-3p putative targeting site in wt and mut sequences of DNMT1. (B) Relative luciferase activity in 293T cells co-transfected with miR-148a-3p or Ctr-mimics and luciferase reporter vector constructs. The wt or mut sequences of DNMT1 3′-UTR were used. Ctr, control; DNMT1, DNA methyltransferase 1; miR-148a-3p, microRNA-148a; mut, mutant; 3′-UTR; 3′-untranslated region; wt, wild-type.
miR-148a-3p inhibits DNMT1 expression in HeLa and SiHa cells. (A) DNMT1 mRNA expression were measured in HeLa cells transfected with miR-148a-3p or control mimics by RT-qPCR. (B) DNMT1 mRNA expression were measured in SiHa cells transfected with miR-148a-3p or control mimics by RT-qPCR. (C) Protein expression of DNMT1 in HeLa cells transfected with miR-148a-3p or control mimics were measured by western blotting. (D) Relative quantitative analysis of protein expression of DNMT1 in HeLa cells transfected with miR-148a-3p or control mimics. (E) Protein expression of DNMT1 in SiHa cells transfected with miR-148a-3p or control mimics were measured by western blotting. (F) Relative quantitative analysis of protein expression of DNMT1 in SiHa cells transfected with miR-148a-3p or control mimics. Ctr, control; DNMT1, DNA methyltransferase 1; miR-148a-3p, microRNA-148a-3p; RT-q, reverse transcription-quantitative.
UTF1 expression is negatively correlated with DNMT1 expression in CC tissues. (A) UTF1 expression in CC and NC tissues were measured by western blotting. (B) UTF1 mRNA expression in CC and NC tissues were measured by RT-qPCR. (C) UTF1 protein expression exhibited a negative correlation with DNMT1 protein expression in CC. (D) UTF1 mRNA expression was negatively correlated with DNMT1 protein expression in CC. CC, cervical cancer; DNMT1, DNA methyltransferase 1; NC, normal cervix; UTF1, undifferentiated embryonic cell transcription factor-; RT-q, reverse transcription-quantitative.
DNMT1 knockdown increases the expression levels of UTF1 in HeLa and SiHa cells. DNMT1 knockdown increased the protein expression levels of UTF1 in (A) HeLa and (B) SiHa cells. The expression levels of UTF1 in (C) HeLa and (D) SiHa cells were normalized to those of GAPDH. DNMT1 knockdown increased the mRNA expression levels of UTF1 in (E) HeLa and (F) SiHa cells. Ctr, control; DNMT1, DNA methyltransferase 1; KD, knockdown; UTF1, undifferentiated embryonic cell transcription factor-1.
DNMT1 knockdown reduces the methylation levels of UTF1. (A) Methylation level of the UTF1 promoter was measured in DNMT1 knockdown HeLa cells. (B) Percentage of methylation of UTF1 promoter in DNMT1 knockdown HeLa cells was lower compared with the control. (C) Methylation level of the UTF1 promoter was measured in DNMT1 knockdown SiHa cells. (D) Percentage of methylation of UTF1 promoter in DNMT1 knockdown HeLa cells was lower compared with the control. Methylation analysis included all 18 CpG dinucleotides within the 100 base pair amplicon. The results are shown using 10 independent clones for each group. White circles indicate methylated regions, black circles indicate non-methylated regions. Ctr, control; DNMT1, DNA methyltransferase 1; KD, knockdown; UTF1, undifferentiated embryonic cell transcription factor-1.
Primer sequences.
Name | Primer | Sequence (5′-3′) |
---|---|---|
GAPDH | Forward | TCAAGAAGGTGGTGAAGCAGG |
Reverse | TCAAAGGTGGAGGAGTGGGT | |
DNMT1 | Forward | TACCACGCAGACATCAACCT |
Reverse | GCCCTTCCCTTTGTTTCCAG | |
UTF1 | Forward | ATGGGGCTGCTGGGCGACAACG |
Reverse | GGGGAGGCGTCCGCAGACTTCG | |
miR-148a-3p | Forward | TGCGCTCAGTGCACTACAGAAC |
Reverse | CCAGTGCAGGGTCCGAGGTATT | |
U6 | Forward | CGCTTCGGCAGCACATATAC |
Reverse | AAATATGGAACGCTTCACGA |
DNMT1, DNA methyltransferase 1; miR-148a-3p, microRNA-148a-3p; UTF1, undifferentiated embryonic cell transcription factor-1.