*Contributed equally
Ankylosing spondylitis (AS), characterized by inflammatory lesions and osteophyte formation, is a common immune rheumatic disease affecting the sacroiliac and axial joints. A high-intensity mechanical load is known to accelerate the heterotopic ossification associated with enthesitis in AS. Thus, the present study explored whether decreased mechanical load could delay the heterotopic ossification in AS. First, 24-week-old female BALB/c mice were induced with proteoglycan (PG) to establish an AS model. The AS-induced pathological and bone morphological changes of the sacroiliac joint were confirmed by hematoxylin and eosin staining and microCT analysis, respectively. Subsequently, the mice were treated with interventions of different mechanical loads. Using reverse transcription-quantitative PCR, it was revealed that expression levels of the osteogenesis-related genes bone morphogenetic protein-2, runt-related transcription factor 2 and osteocalcin were significantly reduced in sacroiliac bone tissue after intervention with a reduced mechanical load. The level of mechanosensory microRNA (miR)-103 increased in response to reduced mechanical loads. Consistently, in groups with reduced mechanical load, proteins with mechanical functions, including ρ-associated coiled-coil-containing protein kinase 1 (ROCK1), phosphorylated (p)-Erk1/2 and β-catenin, were reduced compared with the PG control. A dual-luciferase assay verified that miR-103 binds to the 3'-untranslated region end of
Ankylosing spondylitis (AS) is a typical chronic autoimmune disease characterized by sacroiliac and spinal arthritis (
Treatments for AS include not only drugs, but also non-pharmacological therapy. Because mechanical load stimulation plays an important role in disease progression, exercise therapy allows for training under reduced mechanical load, which may slow the progression of AS (
MicroRNAs (miRNAs/miRs) are small non-coding RNAs involved in a wide range of biological regulatory processes; a number of studies have shown that numerous miRNAs play important roles in mechanical regulation (
The present study aimed to explore the pathogenesis of mechanical load in AS disease and to investigate whether reducing mechanical load, such as suspension, could delay the heterotopic ossification of AS mice. To the best of our knowledge, this is the first study to investigate the therapeutic effect and mechanism of suspension for AS.
All animal experiments were performed following The Laboratory Animal Care and Use Guidelines of Southern Medical University (
A total of 50 female specific pathogen-free BALB/c mice (24-week-old; 25.02±3.36 g; Beijing Vital River Laboratory Animal Technology Co., Ltd.) were used in the present study. The proteoglycan (PG)-induced spondylitis (PGIS) mouse model was used (
The experiment was initiated at week 10 after PG induction, followed by continuous intervention for 12 weeks for 6 h/day. The reduced mechanical load experiments were based on studies that observed simulating microgravity could cause bone loss (
At week 12 of PGIS model induction, the mice in the model and control groups were anesthetized via i.p. injection of sodium pentobarbital (50 mg/kg). microCT imaging and histological analysis was performed to assess the bone morphology in the PGIS mice and to observe the typical characteristics of these mice. Scans of the sacroiliac joint were conducted using a microCT instrument (SCANCO Medical AG) with 80 kV scanning voltage, 180 µA, 9 W and 12-µm scan thickness. For the sacroiliac joint, a 3.1-mm region consisting of 209 slices at the center of the joint were scanned at 15 µm nominal voxel size. The two-dimensional images of the joint center were reconstructed using the software in the microCT system. The outcome variables were also analyzed using the microCT.
After PGIS modeling and experimental interventions, the PG-induced mice were sacrificed. The sacroiliac joint tissue was collected, fixed in 4% paraformaldehyde for 24-48 h at 4˚C and decalcified for 3-4 weeks (
The sequence for miR-103 mimic was 5'-AGCAGCAUUGUACAGGGCUAUGA-3', and the nonsense sequence for miR-103 mimic negative control (NC-mimic) was 5'-UUCUCCGAACGUGUCACGUTT-3'. The sequence for miR-103 inhibitor was 5'-TCATAGCCCTGTACAATGCTGCT-3' and the nonsense sequence for miR-103 inhibitor negative control (NC-inhibitor) was 5'-CAGUACUUUUGUGUAGUACAA-3'. The sequences were all designed and synthesized by Guangzhou RiboBio Co., Ltd. The 293T cells (China Center for Type Culture Collection) were transfected with 100 nmol/l miR-103 mimic or NC-mimic using Lipofectamine® 3000 transfection reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The 293T cells were cultured in DMEM (HyClone; Cytiva) with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific Inc.) at 37˚C and 5% CO2 for 24 h. For miR-103 inhibitor groups, the 293T cells were transfected with 100 nmol/l miR-103 inhibitor and NC-inhibitor using Lipofectamine® 3000 transfection reagent for 12 h at 37˚C. The medium was changed after 12 h and the cells were incubated for additional 2 days.
The
The sacroiliac bone tissues from the experimental and control groups were flash-frozen upon collection and stored at -80˚C until total RNA extraction using TRIzol® reagent (Takara Bio, Inc.). RNA was reversed transcribed into cDNA and amplified using the systems from Vazyme Biotech Co., Ltd. The cDNA Synthesis kit (cat. no. FSQ-101; Toyobo Life Science) was used to perform RT-qPCR using the following conditions: 15 min at 37˚C; 5 min at 98˚C; and 4˚C hold (
After the PGIS mice underwent 12 weeks of intervention with different mechanical loads, they were sacrificed using CO2. The tissues surrounding the sacroiliac joints were harvested to preserve their integrity. The samples were fixed in 4% paraformaldehyde at 4˚C for 24 h, decalcified in EDTA solution for 4 weeks, dehydrated in xylene and descending ethanol (100, 95, 90, 80 and 70%), paraffin-embedded and cut into 4-µm sections. For anti-DKK1 IHC, antigen retrieval was performed using proteinase K at 20 µg/ml and room temperature for 15 min. After the quenching of endogenous peroxidase with 3% H2O2 (cat. no. AR1108; Wuhan Boster Biological Technology, Ltd.), the slides were blocked in TNB buffer (Perkin-Elmer, Inc.) at 37˚C for 30 min and stained with the anti-DKK1 antibody (1:200; cat. no. ab61275, Abcam) for 1 h at room temperature. The sections were washed and incubated with HRP-coupled goat anti-mouse IgG antibodies (1:500; cat. no. BM3894; Wuhan Boster Biological Technology, Ltd.) at for 30 min at 37˚C; their signals were amplified using tyramide signal amplification. HRP detection was performed using 3,3'-diaminobenzidine (DAB kit; Invitrogen; Thermo Fisher Scientific Inc.) at room temperature for 2-3 min. The slides were briefly counterstained with hematoxylin at room temperature for 1 min before mounting. Three discontinuous images per sample were captured at a magnification of x100-200 using a digital light microscope (Nikon ECLIPSE Ti-S; Nikon Corporation). The percentage DKK1-positive cells was quantified using ImageJ software v.1.51 (National Institutes of Health) (
The ligaments in the sacroiliac joint obtained from the five different groups and were flash-frozen in liquid nitrogen. RIPA lysis and extraction buffer (cat. no. 89901; Thermo Fisher Scientific, Inc.) containing 50X protease phosphatase inhibitor mix (cat. no. P1045; Beyotime Institute of Biotechnology) was used to lyse the ligament tissues. The samples were then centrifuged at 10,000 x g and 4˚C for 10 min to collect the supernatant, which contained the target proteins. A bicinchoninic acid assay kit (cat. no. KGP902; Nanjing KeyGen Biotech Co., Ltd.) was used to detect and adjust protein concentrations.
A total of 10 µg/lane target protein were separated via 10-15% SDS-PAGE gels and transferred to a polyvinylidene difluoride membrane. The membrane was blocked with 5% BSA (Wuhan Boster Biological Technology, Ltd.) at room temperature for 1 h and incubated with primary antibodies against ROCK1 (1:1,000; cat. no. ab134181), β-catenin (1:1,000; cat. no. ab32572), DKK1 (1:1,000; cat. no. ab61275), β-tubulin (1:1,000; cat. no. ab6046), or Erk1/2 (1:1,000; cat. no. ab17942; all Abcam) or phosphorylated (p-)Erk1/2 (1:1,000; cat. no. 4377; Cell Signaling Technology, Inc.) at 4˚C overnight. Subsequently, the membrane was incubated with the appropriate horse-radish peroxidase (HRP)-conjugated Goat Anti-Rabbit IgG secondary antibodies (1:5,000; cat. no. BM3894; Wuhan Boster Biological Technology, Ltd.) for 1 h at room temperature. The level of β-tubulin was used as a standard internal control. Finally, an enhanced chemiluminescence detection system (Thermo Fisher Scientific Inc.) and ChemiDoc Touch Imaging System (Bio-Rad Laboratories, Inc.) were used to identify the relative levels of proteins.
Each experiment was performed in triplicate and data were expressed as the mean ± SD. The statistically significant differences between experimental groups were determined using GraphPad Prism v6.02 (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference. Analysis of the relative protein levels and gene expression among the experimental groups was conducted using one-way ANOVA followed by multiple comparisons with Bonferroni's post hoc test.
Representative images of different groups in an AS animal model and mechanical interventions are presented below (n=10/group;
The various mechanical interventions were demonstrated to cause significant differences in the levels of the mechanosensory miR-103 compared with the control groups, as presented in
The expression levels of essential osteogenesis-related genes, such as bone morphogenetic protein-2 (
The expression level of DKK1 in various experimental groups was analyzed using IHC. It was revealed that the expression of DKK1, a Wnt/β-catenin pathway inhibitor, was elevated in the two tail suspension groups (PG + NLB and PG + PLB), but was reduced in the upright PG + FLB group (
Western blotting revealed significantly decreased expression levels of β-catenin, an essential component of the Wnt/β-catenin signaling pathway, in the two tail suspension groups (PG + NLB and PG + PLB) compared with the PG group (
The present study explored whether mechanical load reduction induced by tail suspension could delay the heterotopic ossification following enthesitis in AS mice. The results suggested that tail suspension with reduced mechanical load could alleviate pathological bone formation. Furthermore, tail suspension could inhibit the activation of mechanical ROCK1 kinase and the p-Erk1/2 MAPK signaling pathway, and upregulate mechanosensitive miR-103. Meanwhile, the Wnt/β-catenin pathway is positively associated with ectopic osteogenesis in AS; furthermore, DKK1, an inhibitor of the Wnt pathway, is increased with a reduced mechanical load, thus inhibiting the activation of the Wnt pathway associated with AS osteogenesis (
AS, a chronic autoimmune disease, is characterized by inflammation of the axial skeleton and attachment points, which eventually leads to pathological ossification at attachment sites, including ligaments, tendons and joint capsules (
The pathogenesis of AS has not yet been fully elucidated. Inflammation is generally associated with tissue destruction, such as ankylosis following new cartilage and bone formation (
The effect of tail suspension on the progression of AS was investigated by monitoring changes in the expression of genes involved in osteogenesis. RT-qPCR analysis revealed that the expression levels of bone formation-related marker genes, including
Available evidence indicates that increasing mechanical stress can significantly promote the activation of the p-Erk1/2 MAPK and Wnt/β-catenin signaling pathways (
As miR-103 mainly inhibits osteoblast proliferation by inhibiting the expression of
In summary, the present study performed various interventions, including tail suspensions for reduced mechanical load and full upright load-bearing, in AS model mice. It was revealed that under reduced mechanical load conditions, the expression levels of osteogenesis-related genes and mechanical pathway signals were decreased, and the expression of the osteogenic Wnt pathway inhibitor DKK1 was increased, indicating reduced bone formation. However, the difference between the PG + NLB and PG + PLB groups was not statistically significant. Furthermore, tail suspension affected control of the mechanical kinase ROCK1 and p-Erk1/2 in the MAPK pathway by upregulating the expression of miR-103, further suppressing the osteogenic Wnt/β-catenin pathway associated with AS. The results indicated that reducing mechanical stress could delay ectopic osteogenesis in the sacroiliac joint by regulating the Wnt pathway and its inhibitor DKK1, thereby delaying the progression of AS.
The current study investigated the effect of reducing mechanical stress on AS mice and examined its potential as a basis for clinical therapy. For humans, spinal traction is a common clinical treatment for reducing mechanical stress, which is similar to suspension (
In conclusion, the results demonstrated that mechanical load played a notable role in ectopic bone formation and AS progression. Tail suspension resulting in reduced mechanical load alleviated ectopic osteogenesis in the sacroiliac joints of AS mice by upregulating the expression of miR-103, suppressing mechanical signaling pathways and inhibiting the classical Wnt/β-catenin pathway involved in bone formation. In summary, tail suspension to reduce mechanical stress offers a promising adjuvant therapy for attenuating ectopic bone formation associated with AS and requires further investigation.
Not applicable.
All data generated or analyzed during this study are included in this published article.
GL and YZ designed the experiments. ZZ and JZ performed the experiments and wrote the manuscript. QL and YL analyzed the data. DH analyzed the data and revised the manuscript. GL and ZZ confirmed the authenticity of all the raw data. All authors have read and approved the final manuscript.
The experimental scheme was approved by The Institutional Animal Care and Use Committee of the Southern Medical University (Guangzhou, China).
Not applicable.
The authors declare that they have no competing interests.
Representative images of the mouse groups and experimental design. (A) Ctl, the natural crawling PG-induced group, PG-induced mice with tail suspension for PG + NLB, PG + PLB and vertical PG + FLB groups (n=10/group). (B) Timeline diagram of experimental design. Ctl, control; PG, proteoglycan; FLB, full load bearing; PLB, partial load bearing; NLB, no load bearing.
Mechanical load reduction relieves the typical characteristic changes of the AS model. (A) Ctl: H&E Staining of the sacroiliac joint of control group demonstrated little inflammatory infiltration. PG: Representative H&E staining of the sacroiliac joints of AS mice demonstrated synovitis, cartilage hyperplasia and bone erosion. Local bone and hypertrophic cartilage hyperplasia filled the entire joint space (arrow; n=4). PG + NLB/PLB: Bone erosion and joint fusion were partially relieved. PG + FLB: Bone erosion of the sacroiliac joint increased. (B) microCT images of the sacroiliac joint from each group. Arrows show the narrowed sacroiliac space and unclear edges (n=4) *P<0.05, **P<0.01, ***P<0.001. H&E, hematoxylin and eosin; BV/TV, ratio of the segmented bone volume to the total volume of the region of interest; Tt.Ar, total cross-sectional area; Ct.Ar, cortical bone area; Ct.Th, average cortical thickness; Ctl, control; PG, proteoglycan; NLB, no load bearing; PLB, partial load bearing; FLB, full load bearing; AS, ankylosing spondylitis; ns, not significant.
miR-103 expression is increased in the tail suspension group and may affect the pathological ossification of AS by combining with the 3'-UTR of ROCK1. (A) Expression levels of miR-103 were increased in the PG + NLB and PG + PLB groups compared with the PG group, while the PG + FLB group demonstrated decreased expression levels. (B) Alignment of miR-103 with the 3'-UTR of
RT-qPCR results of sacroiliac joint bone tissue indicate that tail suspension reduces osteogenesis, while upright intervention increases osteogenesis. RT-qPCR analysis demonstrated that the expression levels of osteo-specific genes (
Reduced mechanical load upregulates the expression of Wnt pathway inhibitor DKK1. DKK1-positive cells were quantified using ImageJ software. Immunohistochemistry analysis indicated that PG + NLB and PG + PLB groups increased DKK1-positive expression compared with the PG group, while the PG + FLB group exhibited lower DKK1 expression levels (n=4). Scale bar: Top row, 400 µm; bottom row, 200 µm; *P<0.05, **P<0.01. DKK1, dickkopf Wnt signaling pathway inhibitor 1; Ctl, control; PG, proteoglycan; NLB, no load bearing; PLB, partial load bearing; FLB, full load bearing; ns, not significant.
Changes in the mechanical pathway proteins ROCK1 and p-Erk1/2 MAPK and osteogenic Wnt/β-catenin pathway proteins. Western blotting and quantitative data demonstrated reduced expression levels of ROCK1, p-Erk/Erk and β-catenin in the PG + NLB and PG + PLB groups, and an increase in these expressions in the PG + FLB group compared with the PG group. *P<0.05, **P<0.01. ROCK1, ρ-associated coiled-coil containing protein kinase 1; MAPK, mitogen-activated protein kinase; p-, phosphorylated; Ctl, control; PG, proteoglycan; NLB, no load bearing; PLB, partial load bearing; FLB, full load bearing; ns, not significant.
Primers used for quantitative PCR.
Gene name | Forward, 5'-3' | Reverse, 5'-3' |
---|---|---|
TCTTCCGGGAACAGATACAGG | TGGTGTCCAATAGTCTGGTCA | |
GACTGTGGTTACCGTCATGGC | ACTTGGTTTTTCATAACAGCGGA | |
GAAGCCCAGCGGTGCA | CACTACCTCGCTGCCCTCC | |
GACTGGGGACAGTTTTGAGAC | GGGCATCCAATCCATCCAGC | |
miR-103 | GCGAGCAGCATTGTACAGGG | AGTGCAGGGTCCGAGGTATT |
CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT | |
TCCACCACCCTGTTGCTGTA | ACCACAGTCCATGCCATCAC |