Dr Jingdong Tang, Department of Vascular Surgery, Shanghai Pudong Hospital Affiliated to Fudan University, 2800 Gongwei Road, Shanghai 201399, P.R. China
A previous bioinformatic analysis from our group predicted that the interaction of microRNA (miRNA/miR)-15b with the acyl-CoA synthetase short chain family member 2 (ACSS2) gene was important for the development of abdominal aortic aneurysm (AAA). Apoptosis of aortic vascular smooth muscle cells (VSMCs) is a pathological feature of AAA. The present study aimed to explain the roles of miR-15b/ACSS2 in AAA by exploring their effects on the proliferation and apoptosis of aortic VSMCs. Human aortic VSMCs (T/G HA-VSMC cell line) were divided into six groups and were transfected with miR-15b-5p mimics, mimic negative control (NC), miR-15b-5p inhibitors, inhibitor NC, miR-15b-5p mimics+pcDNA3.1 and miR-15b-5p mimics+ACSS2-overexpessing vector. CCK-8 assay was used to determine cell proliferation. Annexin V-FITC/PI staining and flow cytometry assays were used to measure cell apoptosis. Dual-luciferase reporter assays were used to confirm the targeted relationship between miR-15b-5p and ACSS2. Reverse transcription-quantitative PCR and/or western blotting were used to examine the expression levels of miR-15b-5p, ACSS2 and prostaglandin-endoperoxide synthase 2 (PTGS2). Following transfection of T/G HA-VSMCs with mimics and inhibitors to respectively upregulate and downregulate miR-15b-5p, the results demonstrated that overexpression of miR-15b-5p inhibited cell proliferation and promoted cell apoptosis; silencing of miR-15b-5p obtained the opposite results. ACSS2 may be a direct target of miR-15b-5p, since the luciferase activity of a ACSS2 wild-type vector, but not that of a ACSS2 mutant reporter, was significantly inhibited by miR-15b-5p mimics compared with controls. Additionally, the expression levels of ACSS2 and its downstream gene PTGS2 were significantly reduced or increased following transfection with miR-15b-5p mimics or inhibitors, respectively. Furthermore, overexpression of ACSS2 reversed the antiproliferative and proapoptotic effects of miR-15b-5p mimics by blocking the production of PTGS2 protein. In conclusion, miR-15b-5p may promote the apoptosis and inhibit the proliferation of aortic VSMCs via targeting the ACSS2/PTGS2 axis. The present study provided preliminary evidence indicating that the miR-15b-5p/ACSS2/PTGS2 axis may be a potential target for the treatment of AAA.
Abdominal aortic aneurysm (AAA), defined as a focal dilation of the abdominal aorta by ≥1.5 times the normal diameter or to a diameter of >3 cm (
Although the pathogenesis is complex, loss of aortic vascular smooth muscle cells (VSMCs) is an evident pathological feature of AAA (
A previous study from our group integrated the miRNA and mRNA expression profile datasets of aortic samples from patients with AAA and identified several novel miRNA/mRNA interaction pairs that may be crucial in the development of human AAA. These previous results included the predicted interaction pair of miR-15b (which was upregulated in AAA) with the mRNA for acyl-CoA synthetase short chain family member 2 (ACSS2; which was downregulated in AAA) (
A human aortic VSMC line (T/G HA-VSMC) was purchased from Procell Life Science & Technology Co., Ltd.. Human aortic VSMCs were cultured in smooth muscle cell medium (SMCM; ScienCell Research Laboratories, Inc.) which contained basic medium, 2% fetal bovine serum, 1% smooth muscle cell growth supplement and 1% penicillin/streptomycin solution. A human embryonic kidney (HEK)-293T cell line was purchased from the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences (Beijing, China) and maintained in Dulbecco's modified Eagle's medium (Hyclone; Cytiva) containing 10% fetal calf serum (Gibco; Thermo Fisher Scientific, Inc.). Both cell lines were kept in a humidified atmosphere of 5% CO2 at 37˚C.
Empty pcDNA3.1 vector, ACSS2 overexpression plasmid (pcDNA3.1/ACSS2), miR-15b mimics/inhibitors and mimic/inhibitor negative controls (NC) were obtained from RiboBio Co., Ltd.. At 24 h before the transient transfections, an appropriate number of human aortic VSMCs were seeded into six-well plates with 2 ml of SMCM and grown to 60-70% confluency at 37˚C in an atmosphere containing 5% CO2. Then, the aortic VSMCs were divided into six groups, and miR-15b-5p mimic NC (5'-UCACAACCUCCUAGAAAGAGUAGA-3'; double stranded; 100 nM), miR-15b-5p mimic (5'-UAGCAGCACAUCAUGGUUUACA-3'; double stranded; 100 nM), miR-15b-5p inhibitor NC (5'-UCUACUCUUUCUAGGAGGUUGUGA-3'; single stranded; 200 nM), miR-15b-5p inhibitor (5'-AUCGUCGUGUAGUACCAAAUGU-3'; single stranded; 200 nM), pcDNA3.1 plasmid (4 µg/well), pcDNA3.1/ACSS2 plasmid (4 µg/well), miR-15b-5p mimics+pcDNA3.1 plasmid, or miR-15b-5p mimics+pcDNA3.1/ACSS2 plasmid were added into the plates. The transient transfections of these mimics or inhibitors were performed using the Exfect Transfection reagent (Vazyme Biotech Co.) according to the manufacturer's instructions.
At 60-70% confluence, human aortic VSMCs (2x103/well) were plated into 96-well plates with 200 µl of SMCM and underwent the different transfection treatments as aforementioned. Cell viability was determined at 0, 24, 48 and 72 h post-transfection using the Cell Counting Kit-8 (CCK-8; Beyotime Institute of Biotechnology). The absorbance of each well was measured using a microplate reader (MK3; Thermo Fisher Scientific, Inc.) at 450 nm.
At 60-70% confluence, human aortic VSMCs (2x103/well) were plated into six-well plates with 2 ml of SMCM and subjected to various transfection treatments as aforementioned. At 48 h after transfection, human aortic VSMCs were digested with 0.25% trypsin for 3-5 min, centrifuged at 1,000 x g for 5 min and washed with precooled phosphate-buffered saline twice. Cell pellets were resuspended with 1X binding buffer at a density of 106 cells/ml. A total of 105 cells were then stained with 5 µl Annexin V and 5 µl propidium iodide for 15 min at room temperature in the dark (MultiSciences Biotech Co., Ltd.). Cell apoptosis was analyzed by flow cytometry using CytExpert software (version 2.0; Beckman Coulter, Inc.).
At 48 h after transfection, human aortic VSMCs were treated with TRIzol® reagent (Tiangen Biotech Co., Ltd.) to isolate the total RNA. For amplification of ACSS2, total RNA was reverse transcribed to cDNA using the FastQuant cDNA synthesis kit (Tiangen Biotech Co., Ltd.), and then qPCR was performed using SuperReal PreMix (Tiangen Biotech Co., Ltd.). For amplification of miR-15b-5p, first strand cDNA synthesis was conducted with the miRNA 1st-Strand cDNA Synthesis kit (by stem-loop; Vazyme Biotech Co., Ltd.), and qPCR was run according to the instructions of the miRNA Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd.). Primers were synthesized by the Beijing Dingguo Changsheng Biotechnology Co., Ltd., and were as follows: ACSS2, CGTGATGGGGCTTCCTGAG (forward) and GTTGTACCGAAGGAATGGGC (reverse); miR-15b-5p, CGCGTAGCAGCACATCATGG (forward) and GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGTAAA (reverse); β-actin, ACACTGTGCCCATCTACG (forward) and TGTCACGCACGATTTCC (reverse); and U6, CTCGCTTCGGCAGCACA (forward) and AACGCTTCACGAATTTGCGT (reverse). β-actin and U6 served as an endogenous reference for mRNAs and miRNAs, respectively. The PCR procedure was: Denaturation at 95˚C for 15 min, followed by 40 cycles of 95˚C for 10 sec, 60˚C for 20 sec and 72˚C for 30 sec. The relative expression levels of mRNAs and miRNAs were determined using the 2-ΔΔCq method (
At 48 h after transfection, human aortic VSMCs were treated with the RIPA lysis buffer (Solarbio Science & Technology Co., Ltd.) to extract the total proteins. The concentration of total proteins was determined using the BCA Protein Assay kit (Beyotime Institute of Biotechnology). The protein samples (30 µg) were separated by 10% sodium dodecyl sulfonate-polyacrylamide gel electrophoresis and then electrophoretically transferred to polyvinylidene fluoride membranes (EMD Millipore). After being blocked with 5% skim milk for 1 h at room temperature, the membranes were incubated with primary antibodies against ACSS2 (1:2,000; cat. no. 16087-1-AP; ProteinTech Group, Inc.), prostaglandin-endoperoxide synthase 2 (PTGS2; 1:2,000; cat. no. 27308-1-AP; ProteinTech Group, Inc.) and GAPDH (1:1,000; cat. no. ab181602; Abcam) overnight at 4˚C. The membranes were then incubated with the horseradish peroxidase-conjugated secondary antibody at room temperature for 1 h (1:5,000; cat. no. E030120; EarthOx Life Sciences). Protein bands were visualized using an enhanced chemiluminescence kit (Beyotime Institute of Biotechnology) and quantified using ImageJ software (version 1.46; National Institutes of Health). GAPDH was used as an internal control. Protein expression levels were calculated as relative to the mimic NC group, which was set as 1.0.
TargetScan software (version 7.0;
All experiments were performed at least two independent times. Data were expressed as mean ± standard deviation. Differences between two groups were analyzed by Student's t-test. Differences among more than two groups were tested using one-way analysis of variance followed by post hoc Tukey's (equal variances) or Dunnett's T3 (unequal variances) test. Statistical analysis was conducted using SPSS 18.0 (SPSS, Inc.) and graphs were generated in GraphPad Prism 5.0 (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.
To explore the potential roles of miR-15-5p,
CCK-8 assay was used to evaluate the impact of miR-15b-5p on the proliferation of human aortic VSMCs. The results demonstrated that the absorbance value of aortic VSMCs was significantly lower at 48 and 72 h after transfection with miR-15b-5p mimics compared with the mimic NC group, but no statistical difference was observed at 24 h (
Annexin V-FITC/PI staining and flow cytometry analysis were used to investigate the effects of miR-15b-5p on the apoptosis of aortic VSMCs. As shown in
Bioinformatic analysis predicted that the 3'-UTR region of ACSS2 had the binding site for miR-15b-5p (
To further confirm their interaction, the expression levels of ACSS2 were measured in aortic VSMCs following different transfections. In line with the dual-luciferase reporter assay, both the mRNA and protein expression levels of ACSS2 in aortic VSMCs were found to be significantly reduced after transfection with miR-15b-5p mimics, but significantly increased after transfection with miR-15b-5p inhibitors (
To further explore whether the proapoptotic and antiproliferative effects of miR-15b-5p was achieved through ACSS2, rescue experiments were performed. Firstly, pcDNA3.1/ACSS2 was confirmed to have an effective transfection efficiency (
Furthermore, our previous bioinformatics prediction analysis revealed that miR-15b-5p may function in the development of AAA by regulating ACSS2 and then affecting the lipid biosynthetic process (
The present study, for the first time, demonstrated that overexpression of miR-15b-5p promoted the apoptosis and inhibited the proliferation of human aortic VSMCs by downregulating the expression of ACSS2 and subsequently upregulating PTGS2. Of note, silencing of miR-15b-5p obtained the opposite results. The present findings were in line with the pathological feature of aortic VSMCs loss in AAA (
Although there were no studies to explore the role of miR-15b-5p in AAA, its function in cancer may indirectly explain the importance of miR-15b-5p for the development and progression of AAA. Dong
The known downstream target genes of miR-15b-5p include axin 2(
There were several limitations in the present study. Firstly, the present study provided preliminary evidence to show that the miR-15b-5p/ACSS2/PTGS2 axis may be a potential target for the treatment of AAA by changing the apoptosis and proliferation of aortic VSMCs.
In conclusion, the present study suggested that miR-15b-5p may promote the apoptosis and inhibit the proliferation of aortic VSMCs via targeting the ACSS2/PTGS2 axis. Targeted regulation of the miR-15b-5p/ACSS2/PTGS2 axis may serve as a potential approach for the treatment of AAA, a disease characterized pathologically by loss of VSMCs.
Not applicable.
All data generated or analyzed during this study are included in this published article.
SG, JT and ZQ contributed to the conception and design of this study. SG performed the experiments and the statistical analyses. JM and YP were involved in the interpretation of the data. SG and JT drafted the manuscript. ZQ edited and revised the manuscript. SG and ZQ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Expression levels of miR-15b-5p in human aortic vascular smooth muscle cells after different transfections, as determined by reverse transcription quantitative-PCR. Results are presented as the average+standard deviation of three independent experiments. *P<0.05 vs. mimic NC; #P<0.05 vs. miR-15b-5p mimics; &P<0.05 vs. inhibitor NC. miR, microRNA; NC, negative control.
Proliferation of human aortic VSMCs after different transfections, as determined by CCK-8 assay. (A) miR-15b-5p mimics and NC groups. (B) miR-15b-5p inhibitors and NC groups. (C) Rescue experiments by simultaneous overexpression of ACSS2 in aortic VSMCs transfected with miR-15b-5p mimics. The OD was detected at 0, 24, 48 and 72 h after transfection. Results are presented as the average ± standard deviation of four independent experiments. *P<0.05 vs. mimic NC; &P<0.05 vs. inhibitor NC; $P<0.05 vs. miR-15b-5p mimics+pcDNA3.1 empty vector. VSMCs, vascular smooth muscle cells; miR, microRNA; NC, negative control; ACSS2, acyl-CoA synthetase short chain family member 2; OD, optical density.
Apoptosis of human aortic VSMCs at 48 h after different transfections, as determined by flow cytometry assay. (A) miR-15b-5p mimics and NC groups. (B) miR-15b-5p inhibitors and NC groups. (C) Rescue experiments by simultaneous overexpression of ACSS2 in aortic VSMCs transfected with miR-15b-5p mimics. Representative flow cytometry plots and quantifications are shown. Results are presented as the average+standard deviation of two independent experiments. *P<0.05 vs. mimic NC; &P<0.05 vs. inhibitor NC; $P<0.05 vs. miR-15b-5p mimics+pcDNA3.1 empty vector. VSMCs, vascular smooth muscle cells; miR, microRNA; NC, negative control; ACSS2, acyl-CoA synthetase short chain family member 2.
ACSS2 is a direct target of miR-15b-5p. (A) Schematic of the predicted binding site between miR-15b-5p and the 3'-UTR of ACSS2. (B) Luciferase reporter assays were conducted to confirm the binding ability between miR-15b-5p and ACSS2. WT or MUT constructs of the 3'-UTR of ACSS2 were co-transfected with miR-15b-5p mimics or NC in HEK-293T cells. The firefly luciferase activity was normalized against
ACSS2 and PTGS2 expression levels are regulated by miR-15b-5p. (A) RT-qPCR was performed to confirm the successful overexpression of ACSS2. (B) RT-qPCR was performed to measure the mRNA expression levels of ACSS2 after miR-15b-5p transfection treatments. (C) Representative images from western blot analysis showing the protein expression levels of ACSS2 and PTGS2 in the different transfection groups. (D) Quantitative results of ACSS2 protein. (E) Quantitative results of PTGS2 protein. Results are presented as the average+standard deviation of three independent experiments for mRNAs and two independent experiments for proteins. £P<0.05 vs. pcDNA3.1; *P<0.05 vs. mimic NC; #P<0.05 vs. miR-15b-5p mimics; &P<0.05 vs. inhibitor NC; @P<0.05 vs. miR-15b-5p inhibitors; $P<0.05 vs. miR-15b-5p mimics+pcDNA3.1 empty vector. ACSS2, acyl-CoA synthetase short chain family member 2; PTGS2, prostaglandin-endoperoxide synthase 2; miR, microRNA; RT-qPCR, reverse transcription-quantitative PCR; NC, negative control.