Dr Yuwei Pan, Preventive Treatment of Disease, Tianhe Traditional Chinese Medicine Hospital, 9 Tangshi Road, Guangzhou, Guangdong 510665, P.R. China
*Contributed equally
The aim of the present study was to assess the protective effects of 18β-GA against hydrogen peroxide (H2O2)-induced injury. First, the SMILES annotation for 18β-GA was used to search PubChem and for reverse molecular docking in Swiss Target Prediction, the Similarity Ensemble Approach Search Server and the TargetNet database to obtain potential targets. Injury-related molecules were obtained from the GeneCards database and the predicted targets of 18β-GA for injury treatment were selected by Wayne diagram analysis. Subsequently, Kyoto Encyclopedia of Genes and Genomes analysis was performed by WebGestalt. The experimental cells were assorted into control, model, 10 µM SB203580-treated, 5 µM 18β-GA-treated and 10 µM 18β-GA-treated groups. Hoechst 33258 staining was performed and intracellular reactive oxygen species (ROS) levels, cell apoptosis, Bcl-xl, Bcl-2, Bad, Bax, cleaved-caspase 3, cleaved-caspase 7, transient receptor potential ankyrin 1 (TRPA1) and transient receptor potential vanilloid 1 (TRPV1) levels, as well as p38 MAPK phosphorylation were measured. The ‘Inflammatory mediator regulation of TRP channels’ pathway was selected for experimental verification. The results indicated that 10 µM 18β-GA significantly increased cell viability as compared with the H2O2-treated model group. As suggested by the difference in intracellular ROS fluorescence intensity, 18β-GA inhibited H2O2-induced ROS production in Schwann cells. Hoechst 33258 staining indicated that 18β-GA reversed chromatin condensation and the increase in apoptotic nuclei following H2O2 treatment. Furthermore, flow cytometry suggested that 18β-GA substantially inhibited H2O2-induced apoptosis. Pre-treatment with 18β-GA obviously reduced Bad, Bax, cleaved-caspase3, cleaved-caspase 7, TRPA1 and TRPV1 levels and p38 MAPK phosphorylation after H2O2 treatment and increased Bcl-2 and Bcl-xl levels. In conclusion, 18β-GA inhibited Schwann cell injury and apoptosis induced by H2O2 and may be a potential drug to prevent peripheral nerve injury.
18β-Glycyrrhetinic acid (18β-GA) and 18α-GA are the active components of
Peripheral nerve injury is a common problem and may result in severe disability and an economic burden (
Network pharmacology has illustrated the synergistic effects and underlying mechanisms of herbs via network analysis, which is an appropriate way to measure the effectiveness and demonstrate the functional mechanisms of novel bioactive compounds. In the present study, network pharmacology was applied to identify related targets of 18β-GA for the treatment of neuronal injury and these targets were then experimentally verified. This experimental verification suggested that 18β-GA protected Schwann cells from H2O2-induced injury by inhibiting the phosphorylation of p38 MAPK.
The SMILES annotation for the drug 18β-GA was found in PubChem. After searching Swiss Target Prediction, the Similarity Ensemble Approach (SEA) Search Server and TargetNet (
18β-GA (cat. no. G109796; 98.0%) was acquired from Shanghai Aladdin Biochemical Technology Co., Ltd. PBS, Triton X, TBS and neutral balsam were purchased from Shuyan Biological Technology Co., Ltd. Trypsin was acquired from Guangzhou Saiguo Biological Co., Ltd. PageRµLer Prestained Protein Ladder and Marker (cat. no. P12083) were obtained from Shanghai Bioscience Technology Co. Ltd. SB203580 (a p38 MAPK inhibitor) was purchased from Selleck Chemicals. Polyvinylidene difluoride (PVDF) membranes were obtained from MilliporeSigma. Hoechst 33258 stain (cat. no. RYS580), phosphatase inhibitor cocktail 1 (cat. no. RBG2012) and a BCA protein content kit (cat. no. P0010S) were acquired from Guangzhou Junji Biotechnology Co., Ltd. RIPA buffer (cat. no. WB-0071) was purchased from Beijing Dingguo Biological Co., Ltd. Rabbit antibodies against TRP vanilloid 1 (TRPV1), TRP ankyrin 1 (TRPA1), β-actin, cleaved-caspase-3, cleaved-caspase-7, Bcl-xL, p38 MAPK, phosphorylated (p)-p38 MAPK, Bcl-2, Bax and Bad (cat. nos. ab6166, NB110-40763, 9662S, 9664S, 8438S, 2764S, 8690S, 4511S, ab117115, 2772 and 9292, respectively) were acquired from Guangzhou Juyan Biological Co., Ltd. Goat anti-rabbit secondary antibody (cat. no. CW0103) was acquired from Guangzhou Juyan Biological Co., Ltd. Meilunbio® ECL reagent (cat. no. MA0186-100ML) was acquired by Guangzhou Jiayan Biological Co., Ltd. A Cell Counting Kit-8 (CCK-8; cat. no. 96992) was acquired from Sigma-Aldrich (Merck KGaA). The Annexin V FITC Apoptosis Detection Kit I (cat. no. 556547) was obtained from Guangzhou Juyan Biological Co., Ltd. Diluted primary antibody, diluted secondary antibody, western blot transfer solution and western blot electrophoresis solution were obtained from Servicebio. RNAiso Plus was acquired from Takara Biotechnology, Co., Ltd. SYBR®-Green Premix qPCR, an Evo M-MLV RT-PCR kit and RNase-free water (cat. nos. AG11701, AG11602 and AG11012) were obtained from Accurate Biotechnology Co., Ltd. The Schwann cell line RSC96 was acquired from Shanghai Institute of Cell (cat. no. GNR6). The cell line used in the experiments was between passages 8 and 13.
The viability of Schwann cells was determined by the CCK-8 assay. First, Schwann cells were seeded into 96-well plates at a density of 6x103 cells/well for 24 h. To assess H2O2-induced injury, cells were incubated with H2O2 at various concentrations (0, 20, 50, 100, 150, 200, 250 and 300 µM) for 4 h and then subjected to the CCK-8 assay. For the 18β-GA-mediated protection assay, Schwann cells were pre-treated with 18β-GA (0, 2.5, 5, 7.5, 10, 15, 20 and 30 µM) 24 h prior to being exposed to H2O2 (200 µM) for 4 h. After the incubation, the medium was discarded and the cells were then incubated with CCK-8 solution at 37˚C for 1 h. The absorbance (450 nm) was them measured by using a microplate reader (Bio-Tek Instruments, Inc.).
The experimental groups were as follows: Control, model (200 µM H2O2), 10 µM SB203580 (200 µM H2O2 + 10 µM SB203580), 5 µM GA (H2O2 200 µM + 5 µM 18β-GA; GA5) and 10 µM GA (200 µM H2O2 + 10 µM 18β-GA; GA10) groups. In brief, Schwann cells (1.2x105 cells/well) were cultivated in 6-well plates. The medium was then discarded and the cells were washed with PBS. The cells were then incubated with 18β-GA at 5 or 10 µM concentrations or SB203580 for 24 h. After the medium was discarded, the cells were washed with PBS and they were incubated with 200 µM H2O2 (dissolved in PBS) for 4 h at 37˚C.
An intracellular ROS measurement assay was performed as previously described (
After pre-treatment and incubation with 200 µM H2O2 in PBS at 37˚C for 4 h, cells were incubated with Hoechst 33258 (5 µl in 1.0 ml of PBS) in each well for 20 min. After washing twice with PBS, fluorescence images were acquired using an inverted fluorescence microscope. Three photomicrographs were captured per well, and Image-Pro Plus 6.0 was used for analysis.
Annexin V FITC and propidium iodide (PI) were used to evaluate the apoptotic rates of Schwann cells in different groups. After pre-treatment, cells were incubated with 200 µM H2O2 in PBS at 37˚C for 4 h. Cells were collected with trypsin and washed with PBS. Subsequently, 1x106 cells were placed in binding buffer and double-stained with Annexin V FITC and PI in the dark for 15 min at 4˚C. The proportion of early + late apoptotic cells was then analysed on a flow cytometer (CytExpert 2.3; Beckman Coulter, Inc.) to determine the apoptotic rate.
According to the manufacturer's protocol, total RNA was isolated using RNAiso Plus. Subsequently, cDNA was synthesized based on the instructions of the RT-PCR kit. Then, a Bio-Rad CFX96 Real-Time PCR System (Bio-Rad Laboratories, Inc.) was used to perform qPCR. The amplification parameters were 95˚C for 30 sec, followed by 40 cycles of 95˚C for 5 sec and 60˚C for 34 sec, 95˚C for 15 sec, 60˚C for 60 sec and 95˚C for 15 sec. The relative expression of mRNA was calculated by the 2-ΔΔCq method (
Changes in the expression of Bcl-xl, Bcl-2, Bad, Bax, cleaved-caspase 3 and cleaved-caspase 7, which are related to apoptosis pathways, were assessed by western blot analysis. The levels of TRPA1 and TRPV1, which are closely related to injury, were also measured. RIPA buffer was used to lyse the cells and obtain the proteins from the supernatant. The protein concentration was determined via a BCA assay, and samples (30 µg) were separated via 4-10% SDS-PAGE followed by transfer to PVDF membranes and blocking with 5% skim milk at 37˚C for 1 h. PVDF membranes were incubated with primary antibody (1:1,000 dilution) overnight at 4˚C for 24 h and then with secondary antibody (1:5,000 dilution) for 45 min at 37˚C. Finally, chemiluminescence was used to visualize the bands for assessment of the images via Image-Lab 3.0 (Bio-Rad Laboratories, Inc.).
Values are expressed as the mean ± standard deviation. Experiments were repeated three times. GraphPad Prism 8 (GraphPad Software, Inc.) and SPSS 13.0 (SPSS, Inc.) software were used to perform statistical analysis. The data were analyzed by one-way ANOVA. Bonferroni's test was the post hoc test after ANOVA. P<0.05 was considered to indicate a statistically significant difference.
Through PubChem, the SMILES annotation for 18β-GA was obtained, which is ‘CC1(C2CCC3(C(C2(CCC1O)C)C(=O)C=C4C3(CCC5(C4CC (CC5)(C)C(=O)O)C)C)C)C’. This sequence was inputted into Swiss Target Prediction, the SEA Search Server and TargetNet, which identified 126 active targets. In addition, 15,327 targets associated with injury were identified. A total of 111 potential targets associated with 18β-GA for injury management were further identified. Targets of 18β-GA with potential for injury treatment were inputted into the STRING database along with the species. The top 10 pathways were ranked and are presented in
H2O2 decreased cell viability in a concentration-dependent manner. A moderate response (~50%) was induced by 200 µM H2O2 (
To determine whether the cytoprotective effects of 18β-GA are an intracellular effect, it was investigated whether 18β-GA is able to be transported into Schwann cells to inhibit H2O2-induced intracellular radical production. In brief, cells were first stressed with 18β-GA; 20 µM DCFH-DA was then added before intracellular ROS levels were evaluated. In this way, as 18β-GA and H2O2 did not come into contact in the extracellular space, any reduction in ROS levels was attributed to an intracellular effect. Treatment of Schwann cells with H2O2 increased intracellular ROS levels compared with those of untreated cells. However, 18β-GA and SB203580 attenuated ROS accumulation. The difference in ROS production under treatment with 200 µM H2O2 with and without 18β-GA was significant (
To determine whether 18β-GA protects the nucleus from damage, nuclei were subjected to Hoechst 33258 staining. After H2O2 treatment, Schwann cells exhibited apoptotic nuclei, but pre-treatment with 18β-GA and SB203580 markedly abrogated these effects. 18β-GA and SB203580 inhibited the formation of apoptotic nuclei induced by H2O2 treatment (
Flow cytometry was performed to investigate whether 18β-GA protects Schwann cells against H2O2-induced apoptosis (
To explore the mRNA expression of TRPV1, TRPA1, IL-1β and TNF-α, RT-qPCR analysis was applied (
Western blot analysis was used to determine the expression of various proteins (
The levels of TRPV1, TRPA1 and p-p38 MAPK in the model group were clearly increased after treatment with H2O2 (P<0.05). However, the p38 MAPK levels did not vary among the groups. 18β-GA and SB203580 reduced the expression of the three proteins compared with those in the model group (P<0.05). Furthermore, 18β-GA decreased TRPA1 to near-normal levels. However, SB203580 only slightly decreased the levels of TRPA1 and they remained significantly higher than those in the control group (P<0.05). Overall, the inhibitory effects of 18β-GA and SB203580 at different concentrations were similar, suggesting that 18β-GA was able to suppress the activation of p38 MAPK and the protein levels of TRPA1 and TRPV1.
For network pharmacology research, the top 10 KEGG pathways are typically selected. In the present study, the pathway ‘Inflammatory mediator regulation of TRP channels’ was selected, which contains IL-1β, phospholipase Cγ1 (PLCG1), protein kinase Cα (PRKCA), PRKCH, prostaglandin E receptor 2 (PTGER2), PTGER4 and TRPA1, for experimental verification. The experiments of the present study demonstrated that H2O2 induced oxidative stress and increased the proportion of apoptotic nuclei and the apoptotic rate in Schwann cells. H2O2 increased intracellular ROS and the levels of Bax, Bad, cleaved-caspase-3 and cleaved-caspase-7, while decreasing the levels of Bcl-2, Bcl-xl, TRPA1 and TRPV1 and p-p38 MAPK. In addition, H2O2 exposure increased the mRNA levels of TRPA1, TRPV1, IL-1β and TNF-α. However, pre-treatment with 18β-GA and SB203580 notably decreased the level of ROS and particularly prevented nuclear and Schwann cell apoptosis. In addition, pre-treatment with 18β-GA and SB203580 clearly reduced the protein levels of Bax, Bad, cleaved-caspase-3, cleaved-caspase-7, TRPA1, TRPV1 and p-p38 MAPK and the mRNA levels of TRPA1, TRPV1, IL-1β and TNF-α, and enhanced the levels of Bcl-xl and Bcl-2 in comparison with the model group.
Regarding the inflammatory pathway by which TRP channels are regulated, IL-1β, PLCG1, PRKCA, PRKCH, PTGER2 and PTGER4 are the upstream targets of TRPA1, as indicated in a signalling pathway on the official KEGG website (pathway map: map04750). Through this pathway of inflammation-mediated regulation of TRP channels, the expression of TRPA1 may be regulated by the p38 signalling pathway. Indeed, TRPA1 and TRPV1 are generally co-expressed in cells (
Oxidative stress is involved in injury and apoptosis. The accumulation of ROS may result in various forms of oxidative protein, lipid and DNA modifications, leading to cellular damage. 18β-GA pre-treatment strongly regulated these oxidative conditions, and 18β-GA and SB203580 attenuated ROS accumulation. Previous studies demonstrated that Bcl-xl and Bcl-2 were associated with apoptosis induced by ROS accumulation (
Coskun
18β-GA increased the expression of Bcl-xl and Bcl-2 after H2O2 treatment and decreased the expression of Bax, Bad, cleaved-caspase-3 and cleaved-caspase-7. In addition, the proportion of apoptotic cells was notably higher in the group treated with H2O2 alone than in the group pre-treated with 18β-GA. 18β-GA similarly inhibited the protein levels of p-p38 MAPK. Su
There was no significant difference between 5 and 10 µM 18β-GA in terms of their anti-apoptosis effect and regulation of various signaling factors. These two concentrations were selected with the aim of obtaining a dose-effect relationship, but this was not achieved. A CCK-8 assay was used to detect cell viability. However, whilst this experiment indicates the toxicity of 18β-GA to cells, it may not reveal anti-damage effects of a compound; this may be the reason why the two concentrations of 18β-GA had the same effect.
The typical manifestations of peripheral nerve injury are increased oxidative stress (
However, there were limitations to the present
In conclusion, H2O2 increased intracellular ROS and the levels of Bax, Bad, cleaved-caspase-3 and cleaved-caspase-7 and decreased the levels of Bcl-xl and Bcl-2. Furthermore, H2O2 exposure increased the protein levels of TRPA1 and TRPV1 and the phosphorylation of p38 MAPK. 18β-GA and SB203580 attenuated ROS accumulation, inhibited the phosphorylation of p38 MAPK, enhanced the expression of Bcl-xl and Bcl-2 and decreased the levels of cleaved-caspase-7, cleaved-caspase-3, Bax and Bad, which indicated that 18β-GA may be a candidate drug to prevent peripheral nerve injury.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
DZ, JS, SC and GZ made considerable contributions to the experimental design, statistical data analysis and experimental procedures. XL, HS, BJ, YZ, YL, GQ and YP assisted with the English writing, and made substantial contributions towards the experimental design and statistical analysis. DZ and JS checked and confirmed the authenticity of the raw data. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
KEGG pathway analysis of target genes of 18β-GA. KEGG pathway enrichment analysis of 18β-GA targets with potential for treating damage was performed via DAVID. The top 10 pathways were ranked. KEGG, Kyoto Encyclopedia of Genes and Genomes; 18β-GA, 18β-glycyrrhetinic acid.
Cell viability and cytotoxicity assay. (A) H2O2 decreased cell viability in a concentration-dependent manner. (B) 18β-GA affected Schwann cell viability. *P<0.05 vs. control (0 µM H2O2 or 18β-GA). 18β-GA, 18β-glycyrrhetinic acid.
18β-GA inhibits H2O2-induced ROS production. H2O2, 18β-GA and SB203580 affected the levels of intracellular ROS (scale bar, 20 µm). #P<0.05 vs. control group; *P<0.05 vs. model group. 18β-GA, 18β-glycyrrhetinic acid; ROS, reactive oxygen species; GA5, 5 µM 18β-GA; GA10, 10 µM 18β-GA. ROS, reactive oxygen species.
18β-GA reverses H2O2-induced changes in condensed chromatin and apoptotic nuclei. H2O2, 18β-GA and SB203580 affected changes in the nuclei (scale bar, 20 µm). #P<0.05 vs. control group; *P<0.05 vs. model group. 18β-GA, 18β-glycyrrhetinic acid; GA5, 5 µM 18β-GA; GA10, 10 µM 18β-GA.
Protective effect of 18β-GA against H2O2-induced apoptosis. Flow cytometry revealed that H2O2, 18β-GA and SB203580 affected the levels of cell apoptosis. #P<0.05 vs. control group; *P<0.05 vs. model group. 18β-GA, 18β-glycyrrhetinic acid; PI, propidium iodide; Q, quadrant; UL, upper left; UR, upper right; LL, lower left; LR, lower right; GA5, 5 µM 18β-GA; GA10, 10 µM 18β-GA.
mRNA analysis of inflammatory markers. mRNA levels of (A) IL-1β, (B) TNF-α, (C) TRPA1 and (D) TRPV1 in the different groups determined by reverse transcription-quantitative PCR. #P<0.05 vs. control group; *P<0.05 vs. model group. 18β-GA, 18β-glycyrrhetinic acid; TRPA1, transient receptor potential ankyrin 1; TRPV1, transient receptor potential vanilloid 1; GA5, 5 µM 18β-GA; GA10, 10 µM 18β-GA.
Expression of TRP, apoptotic, antiapoptotic and p38 MAPK proteins in different groups determined by western blot analysis. #P<0.05 vs. control group; *P<0.05 vs. model group. 18β-GA, 18β-glycyrrhetinic acid; TRPA1, transient receptor potential ankyrin 1; TRPV1, transient receptor potential vanilloid 1; p-p38, phosphorylated p38; GA5, 5 µM 18β-GA; GA10, 10 µM 18β-GA.
Primer sequences used for PCR.
Gene | Forward primer (5'-3') | Reverse primer (5'-3') |
---|---|---|
TRPA1 | AAATGCCACAGTTCTCAA | TCTTCGTGTTGCCCTTAT |
TRPV1 | TTCAAGGGTTCCACGAGA | AGTGCCGACACCTATCCA |
TNF-α | GCGTGTTCATCCGTTCTCTACC | TACTTCAGCGTCTCGTGTGTTTCT |
IL-1β | AGGAGAGACAAGCAACGACA | CTTTTCCATCTTCTTCTTTGGGTAT |
β-actin | GAGAGGGAAATCGTGCGT | GGAGGAAGAGGATGCGG |
TRPA1, transient receptor potential ankyrin 1; TRPV1, transient receptor potential vanilloid 1.