Tuberculosis (TB) is caused by
Tuberculosis (TB) is caused by the etiological agent
MicroRNAs (miRNAs/miRs) are a class of non-coding RNAs (~22 nucleotides long) that serve a role in silencing target gene expression and are associated with immune signaling pathways (
Rho-associated coiled-coil-forming protein kinase 1 (ROCK1) is a downstream effector of RhoA; it acts as a ‘molecular switch’ in the activation of the monocyte pro-inflammatory response (
In the present study, upregulated miRNAs in patients with TB were identified using the Gene Expression Omnibus (GEO) datasets, GSE34608 and GSE116542. miR-502-3p was selected for further studies. The aim of the present study was to investigate the function of miR-502-3p in
The GEO (
The human leukemia monocytic THP-1 and the mouse macrophage-like RAW 264.7 cell lines were purchased from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences. Cells were maintained in an incubator (37°C; 5% CO2; 70% relative humidity) in RPMI-1640 medium containing 10% fetal bovine serum (Hyclone; Cytiva).
THP-1 and RAW 264.7 cells were plated on 12-well plates at a seeding density of 3×105 cells/well and transfected with miR-502-3p mimic, miR-502-3p inhibitor, pcDNA3.1-ROCK1 (Shanghai GenePharma Co., Ltd.), or their negative controls (NCs), mimic NC, inhibitor NC and pcDNA3.1-NC (50 pg/well) at 37°C for 24 h, using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). At 24 h following transfection, the transfected macrophages were used for other experimental assays. The sequences are listed in
Total RNA was extracted from the transfected and infected THP-1 and RAW 264.7 cells using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Total RNA (1 µg) was reverse transcribed into cDNA using the M-MLV First Strand Kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. qPCR was subsequently performed using the SYBR-Green PCR master mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) in a 7900HT Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was conducted under the following conditions: Initial denaturation at 95°C for 20 sec, followed by 40 cycles of 95°C for 5 sec, 60°C for 30 sec and 72°C for 15 sec. The primers used for qPCR are provided in
Following transfection, cells (3×105 cells/well) were infected with
TargetScan was used to predict the mRNAs that may have a target site of miR-502-3p. Wild-type (WT) and mutant (MUT) ROCK1 3′-untranslated regions (UTRs) were cloned into the firefly luciferase reporter plasmid psi-CHECK2 (Qiagen China Co., Ltd.) to synthesize the ROCK1-WT and ROCK1-Mut reporter plasmids. 293T cells (American Type Culture Collection) at 5×104 cells/well in 24-well plates were co-transfected with WT or Mut ROCK1 3′-UTR reporter plasmids and miR-502-3p mimic or mimic NC using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C. After 48 h transfection, luciferase activity was detected using a Dual-Luciferase Reporter Assay System (Promega Corporation), according to the manufacturer's protocol.
Total protein was extracted from THP-1 and RAW 264.7 cells (5×105 cells/well) using RIPA lysis buffer (Beyotime Institute of Biotechnology). The protein content was assessed using the BCA method. Total protein (50 µg protein/lane) was separated by SDS-PAGE on a 12% gel. The separated proteins were transferred onto a nitrocellulose membrane (Invitrogen; Thermo Fisher Scientific, Inc.). The membranes were blocked using 5% skimmed milk for 2 h at 25°C. The membranes were incubated with primary antibodies against the following: ROCK1 (1:1,000; cat. no. 4035), TLR4 (1:1,000; cat. no. 14358; Cell Signaling Technology, Inc.; cat. no. ab13556, Abcam), phosphorylated (p)-p65 (1:1,000; cat. no. 3033; Cell Signaling Technology, Inc.), p65 (1:1,000; cat. no. 8242; Cell Signaling Technology, Inc.), p-IκBα (1:1,000; cat. no. 2859; Cell Signaling Technology, Inc.), IκBα (1,000; cat. no. 4812; Cell Signaling Technology, Inc.) and β-actin (1:2,000; cat. no. 4970; Cell Signaling Technology, Inc.) overnight at 4°C. Following three washes of 5 min each with TBS-0.1% Tween-20, the membranes were incubated with HRP-conjugated anti-rabbit secondary antibodies (1:3,000; cat. no. A0208; Beyotime Institute of Biotechnology) at 25°C for 1 h. Protein bands were visualized using an ECL reagent (Beyotime Institute of Biotechnology) and a gel imaging system (Tanon Science & Technology Co., Ltd.). Protein bands were semi-quantified using ImageJ software v1.8.0 (National Institutes of Health). β-actin was used as the loading control.
THP-1 and RAW 264.7 cells (5×104) were fixed in 24-well plates using 4% paraformaldehyde at 25°C for 30 min (Beyotime Institute of Biotechnology), permeabilized using 0.3% Triton X-100 at 25°C for 20 min and blocked with 5% goat serum (Gibco; Thermo Fisher Scientific, Inc.) at 25°C for 30 min. Cells were incubated with primary antibody against p-p65 (1:1,600; cat. no. 3033; Cell Signaling Technology, Inc.) overnight at 4°C. Cells were subsequently incubated with Alexa Fluor 594-conjugated goat anti-rabbit IgG secondary antibody (1:500; cat. no. ab150080; Abcam) for 1 h in the dark at room temperature. Cell nuclei were stained using DAPI (Beyotime Institute of Biotechnology) at 25°C for 30 min. Images were captured using a BX51 fluorescence microscope (Olympus Corporation).
All presented data were obtained from at least three independent experiments. Data are shown as the mean ± SD. Statistical comparisons between two groups were determined by Student's unpaired t-test, whereas comparisons between multiple groups were determined using one-way ANOVA followed by Tukey's post-hoc test. P<0.05 was considered to indicate a statistically significant difference.
miRNAs with markedly high expression levels in TB compared with the healthy control group were selected by analyzing the GSE34608 and GSE116542 datasets from the GEO database. A total of seven miRNAs were identified as being the same between the datasets (
To further determine the potential role of miR-502-3p in the cellular immune response during
Using TargetScan, ROCK1 was predicted to have a potential miR-502-3p target site in its 3′UTR (
A previous study has shown that TLR-4/miR-125a/NF-κB signaling modulates the immune response to
The effect of ROCK1 overexpression on cytokine production in miR-502-3p-overexpressing macrophages was investigated. ROCK1 overexpression was successfully achieved by transfecting THP-1 and RAW 264.7 cells with pcDNA3.1-ROCK1 (
miRNAs have been reported to serve important roles in the host response to intracellular
The production of inflammatory cytokines by macrophages is regarded as a bactericidal pathway for
Furthermore, previous studies have demonstrated that the association between miRNAs and mRNAs serves an important role during
In conclusion, miR-502-3p promoted
Not applicable.
No funding was received.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
FL, YZ and ZD designed the study. YL, HY and PW performed the research and analyzed the data. FL and ZD confirmed the authenticity of all the raw data. YZ and PW wrote the paper and FL and ZD reviewed the article. All authors approved the final version of the manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
miR-502-3p facilitates
miR-502-3p suppresses cytokine mRNA expression levels in
miR-502-3p directly targets ROCK1. (A) Predicted target site of miR-502-3p in the ROCK1 3′UTR. (B) Dual-luciferase reporter assay verified the targeting relationship between miR-502-3p and ROCK1. **P<0.01 vs. mimic NC. (C) ROCK1 protein expression levels of ROCK1 were measured by western blotting following transfections and infection. Untreated macrophages were used as the control. ***P<0.001 vs. control; ###P<0.001 vs. M.tb. Hsa,
miR-502-3p regulates the TLR4/NF-κB signaling pathway in
miR-502-3p inhibits the expression of NF-κB p-p65 in nucleus. NF-κB p-p65 expression was evaluated by immunofluorescence staining. Scale bar, 50 µm. Untreated macrophages were used as the control. ***P<0.001 vs. control; ##P<0.01 and ###P<0.001 vs. M.tb. miR, microRNA; M.tb,
ROCK1 overexpression reverses the miR-502-3p inhibitory effect on cytokine mRNA expression levels in
Primer sequences used in transfection.
Gene | Primer sequence (5′→3′) |
---|---|
miR-502-3p mimic | AAUGCACCUGGGCAAGGAUUCA |
Mimic NC | UCACAACCUCCUAGAAAGAGUAGA |
miR-502-3p inhibitor | UGAAUCCUUGCCCAGGUGCAUU |
Inhibitor NC | UCUACUCUUUCUAGGAGGUUGUGA |
miR, microRNA; NC, negative control.
Sequences of primers used for reverse transcription-quantitative PCR.
Gene | Primer sequence (5′→3′) |
---|---|
miR-502-3p | F: ACACTCCAGCTGGGAATGCACCTGGGCAAGG |
R: CTCAACTGGTGTCGTGGA | |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT | |
IL-6 (human) | F: ACAACCACGGCCTTCCCTACT |
R: CACGATTTCCCAGAGAACATGTG | |
IL-6 (mouse) | F: GGGCTGCGATGGAGTCAGAG |
R: TCCCTCACACAGGGCTCGAC | |
TNF-α (human) | F: GCCTCTTCTCATTCCTGCTTG |
R: GGCCATTTGGGAACTTCTCA | |
TNF-α (mouse) | F: TGACCCCCATTACTCTGACC |
R: TTCAGCGTCTCGTGTGTTTC | |
IL-1β (human) | F: GTGGCAATGAGGATGACTTGTTC |
R: GGTGGTCGGAGATTCGTAGCT | |
IL-1β (mouse) | F: GAGCAACAAGTGGTGTTCTCC |
R: AACACGCAGGACAGGTACAG | |
β-actin (human) | F: CATGTACGTTGCTATCCAGGC |
R: CTCCTTAATGTCACGCACGAT | |
β-actin (mouse) | F: GTGTGGGCATTTGATGAGCC |
R: AGGTCACTTACCTGGTGCCT |
F, forward; R, reverse; miR, microRNA.