Diffuse large B-cell lymphoma (DLBCL) is a common and fatal malignant tumor caused by B-lymphocytes. Long non-coding RNA (lncRNA) GAS5 (growth arrest specific 5) has been reported to function as a tumor suppressor gene, and is differentially expressed in DLBCL. The present study aimed to explore the potential mechanisms of action of lncRNA GAS5 in the proliferation of DLBCL cells. The expression levels of GAS5, miR-18a-5p and Runt-related transcription factor 1 (RUNX1) in DLBCL cell lines were detected using reverse transcription-quantitative polymerase chain reaction, and their effects on cell proliferation, the cell cycle and apoptosis were determined using 5-ethynyl-2′-deoxyuridine assay and flow cytometry. Dual-luciferase reporter and RNA pull-down assays were used to evaluate the interaction between GAS5 and miR-18a-5p, or between miR-18a-5p and RUNX1. Chromatin immunoprecipitation assay was used to identify the interaction between RUNX1 and BAX. The expression levels of GAS5 and RUNX1 were downregulated; however, miR-18a-5p expression was upregulated in the DLBCL cell lines compared with the normal controls. GAS5 directly interacted with miR-18a-5p by acting as a competing endogenous RNA (ceRNA) and reversed the low expression of RUNX1 induced by miR-18a-5p. Additionally, the knockdown of RUNX1 reversed the inhibitory effects of GAS5 on the proliferation and cell cycle G1 arrest, and its promoting effects on the apoptosis of OCI-Ly3 and TMD8 cells. Moreover, RUNX1 enhanced BAX expression by directly binding to the BAX promoter. On the whole, the present study demonstrates that GAS5 functions as a ceRNA, inhibiting DLBCL cell proliferation by sponging miR-18a-5p to upregulate RUNX1 expression. These findings may provide a potential therapeutic strategy for DLBCL.
Diffuse large B-cell lymphoma (DLBCL) is a type of lymphoid malignancy that accounts for 25-35% of non-Hodgkin's lymphoma (NHL) and 37% of B-cell tumors (
Long non-coding RNAs (lncRNAs) refer to RNA molecules of >200 nucleotides in length that do not encode proteins. There is evidence to indicate that lncRNAs play an important role in malignant B-cells and serve as potential markers for the diagnosis and progression of DLBCL; thus, they may play carcinogenic or tumor suppressive functions in the DLBCL process. For example, lncRNA MALAT1 (
MicroRNAs (miRNAs or miRs) are small single-stranded RNAs that play an important regulatory role by regulating target gene transcription. miR-18a-5p has been demonstrated to play an oncogenic role in lung, nasopharyngeal, prostate, colorectal and breast cancers, and is widely involved in cell proliferation, apoptosis and other phenotypes (
The transcription factor, Runt-related transcription factor 1 (RUNX1), also known as acute myeloid leukemia 1 (AML1), is involved in regulating the development of hematopoietic stem cells and is closely related to the occurrence and development of hematological malignancies (
The present study aimed to determine the expression levels of GAS5, miR-18a-5p and RUNX1 in DLBCL cell lines, and to further investigate the potential molecular mechanisms among them in DLBCL. The findings presented herein may provide novel therapeutic targets for DLBCL.
The ABC DLBCL cell line (OCI-Ly3, BNCC338435), GCB DLBCL cell line (TMD8, BNCC340121) (
TRIzol® reagent (500
The location of GAS5 in two cell lines (OCI-Ly3 and TMD8) was identified using the Ribo™ FISH kit (Guangzhou RiboBio Co., Ltd.) according to the manufacturer's instructions. Briefly, 6×104 cells/well were fixed with 4% paraformaldehyde for 10 min at room temperature, followed by permeabilization with 0.5% Triton, and washing three times with phosphate-buffered saline (PBS) after discarding the permeabilization solution. Each well was then supplemented with a pre-hybridization solution (Reagent A, derived from the RiboBio FISH kit) and blocked with blocking solution (Reagent C, derived from the RiboBio FISH kit) at 37°C for 30 min. Cy3-labeled lncRNA FISH probes (included with the kit) were then synthesized and used to identify GAS5. The probe mix (2.5
Cell viability was assessed using the 3-(4,5-dimethylthiazol-2-yl)-5-(3-carbox ymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) kit (ab197010; Abcam). Briefly, the cells were seeded in a 96-well plate at 5.0×103/well, and 20
The cells were collected by centrifugation at 1,000 × g for 5 min at 4°C. Subsequently, cells were fixed with 1 ml pre-cooled 70% ethanol overnight at 4°C. Propidium iodide (PI) staining solution (0.5 ml) was then added to each tube of cell samples for resuspension, followed by incubation at 37°C in a dark environment for 30 min. Finally, the red fluorescence and light scattering at the excitation wavelength of 488 nm were detected using a flow cytometer (FACScan; BD Biosciences). The data were analyzed using FlowJo 10 software.
The number of apoptotic cells was detected using flow cytometry. Firstly, the cells were washed twice with pre-cooled PBS and centrifuged at 300 × g for 5 min at 4°C. Following PBS absorption, 100
The wild-type and mutant-type 3′UTR sequences of RUNX1 were inserted into the pmirGLO dual luciferase reporter vector (E1330; Promega Corporation) to construct wild-type (WT) and mutated-type (MUT) luciferase reporter plasmids. The luciferase plasmid (200 ng) was then combined with 60 nM miR-18a-5p mimics/inhibitor and co-transfected into OCI-Ly3 cells. Lipofectamine 2000® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) was used for transfection. Following transfection, the cells were washed with pre-cooled PBS, and then lysed using a dual luciferase reporter gene detection kit (E1960; Promega Corporation). Subsequently, 30
The cells were washed with pre-cooled PBS and the culture plate was then placed on ice. Subsequently, 10
The binding effect of GAS5 and miR-18a-5p was detected using the RAP kit (Bes5103; BersinBio) and RNA pull down kit (Thermo Fisher Scientific, Inc.). The biotin-labeled GAS5 probe (Guangzhou RiboBio Co., Ltd.) was combined with the connection region of GAS5, and the oligonucleotide probe (Guangzhou RiboBio Co., Ltd.) was used as a control. The probe was added to the lysed cells in proportion, and incubated with a vertical mixer for 5 h at room temperature. Subsequently, the RNA enriched on the magnetic beads (Thermo Fisher Scientific, Inc.) was washed multiple times with RNA elution buffer, and the miRNA bound in the complex was then extracted using TRIzol reagent (R0016, Beyotime Institute of Biotechnology) and quantitatively analyzed using RT-qPCR. Subsequently, 50 nmol/l biotin-labeled miR-18a-5p was transfected into the OCI-ly3 cells for 48 h, and the cells were then lysed with 0.1% NP-40 (P0013F; Beyotime Institute of Biotechnology), centrifugation at 12,000 × g for 5 min at 4°C. incubated for 1 h. The combination of 500
The protein-gene interactions were identified using ChIP assay with the Simple Chip Enzymatic Chromatin IP kit (9002S; Cell Signaling Technology, Inc.). The cells were treated with formaldehyde and incubated at 37°C for 15 min, and cross-linking was terminated using glycine. The cells were washed and centrifuged at 1,000 × g for 5 min at room temperature, and 2 ml cell lysis buffer were then added to resuspend cells. Subsequently, the cells were placed on ice for incubation for 15 min for lysis, and were finally sonicated to share DNA to an average size of 500 bp. The chromatin solution was cleaned with protein A-agarose beads (Cell Signaling Technology, Inc) and incubated overnight with normal IgG (ab172730, 5
The targeted miRNA of lncRNA GAS5 was predicted using online tools, including starBase (
GraphPad Prism 8.0 (GraphPad Software, Inc.) was used for statistical analysis. These data are presented as the mean ± standard deviation (SD). One-way ANOVA (followed by Tukey's test) and an unpaired t-test were used for the determination of significant differences between groups. The experiments were carried out independently three times under the same conditions. P<0.05 was considered to indicate a statistically significant difference.
The expression of GAS5 in three DLBCL cell lines (Raji, OCI-ly3 and TMD8) and a human normal lymphocyte cell line (GM12878) was detected using RT-qPCR. The results revealed that the expression level of GAS5 in the DLBCL cells was significantly lower than that in the GM12878 cell lines (
To evaluate the function of GAS5 in the proliferation, cell cycle progression and apoptosis of DLBCL cells, firstly, lentiviral vector containing the GAS5-encoding sequence was transfected into the OCI-Ly3 and TMD8 cells. The results revealed transfection with the GAS5 vector significantly promoted its expression level when compared with the empty vector group (
Three databases (starBase, DIANA and NPInter) were used to predict the target miRNAs of GAS5 (
Four databases (TargetScan, PicTar, TarBase and microT_CDS) were used to predict the target genes of miR-18a-5p (
To explore whether RUNX1 was involved in the proliferation, cell cycle progression and apoptosis of DLBCL cells regulated by GAS5, the expression level of RUNX1 was examined following the knockdown of RUNX1. The results revealed that the expression of RUNX1 was significantly decreased compared with the control group (
JASPAR database query results revealed that a potential binding site ACTTGAGGT of RUNX1 was found within the sequence 2000 upstream of the promoter region of BAX. The results of RT-qPCR and western blot analysis revealed that the knockdown of RUNX1 decreased the mRNA and protein expression of BAX (
The present study first established the interaction among GAS5, miR-18a-5p and RUNX1 in DLBCL, and concluded that GAS5 inhibited the proliferation and G1 cycle progression, whereas it promoted the apoptosis of DLBCL cells by functioning as a ceRNA to sponge miR-18a-5p and modulate RUNX1 expression. These findings may provide potential novel therapeutic targets for the treatment of DLBCL (
The abnormal expression of lncRNAs has been identified as a main factor involved in the progression of DLBCL. The association between lncRNAs and cell proliferation, and the apoptosis of DLBCL has been previously demonstrated; for example, lncRNA SNHG16 (
Mechanistically, the findings of the present study validated that GAS5 functioned as a miRNA sponge in DLBCL. As previously reported, GAS5 may participate in the specific DLBCL process as a key regulator of the ceRNA network (
Of note, the present study demonstrated that RUNX1 was expressed at low levels in DLBCL and was targeted by GAS5 and miR-18a-5p, suggesting an involvement of RUNX1 in DLBCL cells. Functionally, GAS5 decreased the proliferation of DLBCL cells, and induced G1 phase arrest and cell apoptosis. However, in rescue experiments, co-transfection with GAS5 overexpression and si-RUNX1 reversed the effects of GAS5 on the proliferation, cell cycle progression and apoptosis of DLBCL cells. Similar results have also been observed in other tumors. For example, RUNX1 has been shown to markedly inhibit the lncRNA NEF-induced proliferation of gastric cancer cells (
Furthermore, RUNX1 is a transcription factor that is well known in the development of cancers for its dual role in the transcription of specific genes. For example, RUNX1 binds to the promoter region of the glioma oncogene astrocyte elevated gene-1 (AEG-1), enhances the activity of the AEG-1, and then induces the proliferation of glioma cells (
In conclusion, the present study provides evidence that lncRNA GAS5 plays an anti-tumor and anti-proliferative role in DLBCL cells. In addition, the potential mechanism identified was that it inhibited the proliferation and G1 cycle progression, and promoted the apoptosis of DLBCL cells by functioning as a ceRNA to regulate RUNX1. These findings provide potential novel therapeutic targets for DLBCL.
All data generated or analyzed during this study are included in this published article.
YM and YJ performed the experiments and collected the data, and confirmed the authenticity of all the raw data. YM was a major contributor to the writing of the manuscript. XC and MQ were responsible for data analysis and visualization. WZ and YW conceived and designed the study, and they were major contributors in critically revising the manuscript. All authors have read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Not applicable.
Detection of GAS5 expression. (A) The expression level of GAS5 in DLBCL cell lines (Raji, OCI-Ly3 and TMD8) and normal human B lymphocyte lines (GM12878) was detected using reverse transcription-quantitative PCR. (B) Location of GAS5 in the cytoplasm (red) and nucleus (blue) of OCI-Ly3, TMD8 and GM12878 cell lines was detected using fluorescence in situ hybridization. *P<0.05 and **P<0.01. GAS5, growth arrest specific 5; DLBCL, diffuse large B-cell lymphoma.
Detection of the effects of GAS5 on cell proliferation, cell cycle progression and apoptosis. (A) The transfection efficiency of the overexpression of GAS5 in OCI-Ly3 and TMD8 cell lines was detected using reverse transcription-quantitative PCR. (B and C) The viability and proliferative ability of OCI-Ly3 and TMD8 cells overexpressing GAS5 was detected using MTS and EdU assays. (D and E) The cell cycle of OCI-Ly3 and TMD8 overexpressing GAS5 was detected using flow cytometry. The apoptosis of (F) OCI-Ly3 and (G) TMD8 cells overexpressing GAS5 was detected using flow cytometry. (H) Quantitative analysis of cell apoptosis. ns, not significant; *P<0.05, **P<0.01 and ***P<0.001. GAS5, growth arrest specific 5; EdU, 5-ethynyl-2′-deoxyuridine.
GAS5 functions as a molecular sponge for miR-18a-5p. (A) Venn diagram shows the targeted miRNAs that were predicted and screened using three online tools, including StarBase, DIANA and NPInter. (B) The expression level of miR-18a-5p in DLBCL cell lines (Raji, OCI-Ly3 and TMD8) and normal human B-lymphocyte lines (GM12878). (C) Schematic diagram illustrating the putative miR-18a-5p binding sites with the GAS5. (D) The relative luciferase activity in OCI-Ly3 cells co-transfected with luciferase reporter vectors of WT or MUT GAS5 and miR-18a-5p mimics. (E) The specificity of biotin-labeled GAS5 probe binding GAS5 and the pull-down of miR-18a-5p by GAS5 in total RNA from OCI-Ly3 cells. (F) Specificity binding of biotin-labeled miR-18a-5p and GAS5, and the pull-down of GAS5 by miR-18a-5p was detected using reverse transcription-quantitative PCR. (G) Relative expression level of miR-18a-5p in OCI-Ly3 and TMD8 cells overexpressing GAS5. ns, not significant; **P<0.01 and ***P<0.001. GAS5, growth arrest specific 5.
RUNX1 is predicted as a direct target of miR-18a-5p. (A) The Venn diagram shows the targeted mRNAs that were predicted and screened by four online tools including TargetScan, PicTar, Tarbase and microT_CDS. (B) The expression level of RUNX1 in DLBCL cell lines (Raji, OCI-Ly3 and TMD8) and a normal human B-lymphocyte cell line (GM12878). (C) Schematic diagram illustrating the predicted miR-18a-5p binding sites with the 3′UTR of RUNX1. (D) The relative luciferase activity in OCI-Ly3 cells co-transfected with luciferase reporter vectors of RUNX1-WT or RUNX1-MUT and miR-18a-5p mimics. (E) The transfection efficiency of miR-18a-5p mimics/inhibitor in OCI-Ly3 and TMD8 cell lines. *P<0.05, **P<0.01 and ***P<0.001; ##P<0.01. ns, not significant; RT-qPCR, reverse transcription-quantitative PCR; RUNX1, Runt-related transcription factor 1.
RUNX1 is regulated by GAS5 and miR-18a-5p. (A and B) RUNX1 expression was detected using RT-qPCR and western blot analysis following after transfection with miR-18a-5p mimics/inhibitor into OCI-Ly3 and TMD8 cells. (C and D) The mRNA and protein expression of RUNX1 in OCI-Ly3 and TMD8 cells overexpressing GAS5 was detected using RT-qPCR and western blot analysis. (E and F) The mRNA and protein expression of RUNX1 in OCI-Ly3 and TMD8 cells transfected with GAS5 overexpression vector and/or miR-18a-5p mimics was detected using RT-qPCR and western blot analysis. ns, not significant; **P<0.01 and ***P<0.001; ##P<0.01. RT-qPCR, reverse transcription-quantitative PCR; GAS5, growth arrest specific 5; RUNX1, Runt-related transcription factor 1.
Knockdown of RUNX1 reverses the effects of GAS5 overexpression on the proliferation, cell cycle progression and apoptosis of TMD8 and OCI-Ly3 cells. (A and B) The transfection efficiency of si-RUNX1 in OCI-Ly3 and TMD8 cell lines was detected using reverse transcription-quantitative PCR. (C) Viability of OCI-Ly3 and TMD8 cells was detected using MTS assay following transfection with GAS5 overexpression vector and or si-RUNX1. (D) The cell cycle was detected using flow cytometry in OCI-Ly3 and TMD8 cells transfected with GAS5 overexpression vector and or si-RUNX1. (E) Apoptosis of OCI-Ly3 and TMD8 cells was detected using flow cytometry following transfection with GAS5 overexpression vector and or si-RUNX1. *P<0.05, **P<0.01 and ***P<0.001; #P<0.05 and ##P<0.01. GAS5, growth arrest specific 5; RUNX1, Runt-related transcription factor 1.
Detection of the binding of RUNX1 and BAX promoter. (A and B) BAX expression in TMD8 and OCI-Ly3 cells transfected with si-RUNX1 was detected using reverse transcription-quantitative PCR and western blot analysis. (C) Effect of RUNX1 on BAX activity in OCI-Ly3 cells was detected using luciferase activity. (D) A ChIP-qPCR analysis of the BAX promoter sequence with the addition of antibodies, including normal IgG (negative control) and anti-RUNX1 (positive control) in OCI-Ly3 cells. R1, binding site on the BAX promoter region; R2, control region, ns, not significant; **P<0.01 and ***P<0.001. GAS5, growth arrest specific 5; RUNX1, Runt-related transcription factor 1.
Schematic diagram of the mechanisms through which lncRNA GAS5/miR-18a-5p/RUNX1 mediates DLBCL cell proliferation and apoptosis. lncRNA GAS5 attenuates the expression of miR-18a-5p, whereas it promotes that of RUNX1; miR-18a-5p attenuates the expression of RUNX1 and interferes with the expression of RUNX1 by GAS5. On the whole, lncRNA GAS5 promotes the expression of RUNX1 by sponging miR-18a-5p, which in turn promotes the cell cycle G1 phase arrest, suppresses proliferation and promotes the apoptosis of OCI-Ly3 and TMD8 cells. In addition, RUNX1 binds to the promoter region of BAX, and thus may play a role in the apoptosis and proliferation of DLBCL cells. lncRNA, long non-coding RNA; GAS5, growth arrest specific 5; RUNX1, Runt-related transcription factor 1; DLBCL, diffuse large B-cell lymphoma.
Sequences of the transfection targets in the present study.
Gene | Sequences (5′ to 3′) |
---|---|
miR-18a-5p mimics | UAAGGUGCAUCUAGUGCAGAUAG |
NC mimics | UUCUCCGAACGUGUCACGUTT |
miR-18a-5p inhibitor | CCCUAUCUGCACUAGAUGCACCU |
NC inhibitor | CAGUACUUUUGUGUAGUACAA |
si-RUNX1 | ACGAATCACACTGAATGCAAACC |
si-NC | TGCTTAGTGTGACTTACGTTTGG |
NC, negative control; RUNX1, Runt-related transcription factor 1.
Primer sequences used in RT-qPCR in the present study.
Primers | Sequences (5′ to 3′) |
---|---|
lncRNA-GAS5-Forward | GCAAGCCTAACTCAAGCCATTG |
lncRNA-GAS5-Reverse | CTTGCTCCACACAGTGTAGTC |
RUNX1-Forward | CCTCAGGTTTGTCGGTCGAA |
RUNX1-Reverse | CTTGCGGTGGGTTTGTGAAG |
BAX-Forward | CATGGGCTGGACATTGGACT |
BAX-Reverse | CAAAGTAGGAGAGGAGGCCG |
miR-18a-5p-RT | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACctatct |
miR-18a-5p-Forward | CGTTATAAGGTGCATCTAGTGC |
miR-18a-5p-Reverse | GTGCAGGGTCCGAGGT |
U6-RT | AACGCTTCACGAATTTGCGT |
U6-Forward | CTCGCTTCGGCAGCACA |
U6-Reverse | AACGCTTCACGAATTTGCGT |
GAPDH-Forward | GTTCGTCATGGGTGTGAACC |
GAPDH-Reverse | CATCCACAGTCTTCTGGGTG |
GAS5, growth arrest specific 5; RUNX1, Runt-related transcription factor 1; RT, reverse transcription.