TCGA-LUAD data on ISLR expression in patients with LUAD were retrieved from the UALCAN web tool (http://ualcan.path.uab.edu/index.html). The UALCAN web tool was also used to plot the gene expression figures by using 'TCGA Gene analysis' panel (16). The potential effect of ISLR on the OS rates of patients with NSCLC was analysed using the Kaplan-Meier method with Kaplan-Meier Plotter web tools (https://kmplot.com/analysis/) in 'Lung cancer' panel (17,18).

Human NSCLC cell lines (H1299, H23 and A549) and normal immortalised lung epithelial cell lines (16HBE) were obtained from the China Infrastructure of Cell Line Resources, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. The 16HBE cells were maintained in DMEM/high glucose medium (HyClone; Cytiva) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin and streptomycin. Moreover, H1299, H23 and A549 cell lines were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) with 10% FBS and placed in a constant-temperature incubator (Thermo Fisher Scientific, Inc.) with 5% CO₂ at 37°C.

Human recombinant IL-6 (cat. no. I1395-50UG; Sigma-Aldrich; Merck KGaA) was dissolved in PBS to a concentration of 100 µg/ml as a stock solution and stored at temperature of -20°C. The cells were pre-treated with 100 ng/ml IL-6 for 48 h at room temperature.

ISLR small interfering RNA (siRNA/si) packaged in lentivirus was purchased from Shanghai GenePharma Co., Ltd., and pcDNA3.1-ISLR plasmid was synthesised by Genomeditech Biotechnology. Human NSCLC cell lines were seeded and cultured in 24-well plates for 1 day. After reaching 80% confluency, according to the manufacturer's instructions for Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.), A549 cells (1×10⁵ cells) were transfected with si-negative control (NC) or si-ISLR (10 µl; 2×10⁸ TU/ml) to construct the ISLR knockdown cell model, and H1299 cells (1×10⁵cells) transfected with pcDNA3.1-ISLR plasmid (4 µg), vector only (pcDNA3.1-NC) or blank control to construct the ISLR overexpression cell model at 37°C for 48 h. The 24-well plates were then placed in an incubator. After 6 h, the medium in each well was replaced with the fresh RPMI-1640 medium supplemented with 10% FBS. At 48 h after transfection, the cells were used for the subsequent experiments. The following sequences (from 5′→3′) were used: si-ISLR-1, CAGCCACAATCTCATCTCTGACTTT; si-NC-1, CAGACACTAACTTCTGTCCACCTTT; si-ISLR-2, TGCACAACCTCAGTGCCCTCCAATT; and si-NC-2, TGC CAACTCTGACCGCTCACACATT.

RNA was extracted using an RNA kit (Takara Bio, Inc.) and reverse transcribed into cDNA using a PrimeScript RT reagent kit (Invitrogen; Thermo Fisher Scientific, Inc.). Then, cDNA was amplified using a real-time PCR kit (Takara Bio, Inc.) in a reaction mixture containing 7 µl dH₂O, 1 µl cDNA, 2 µl ISLR primers (Applied Biosystems; Thermo Fisher Scientific, Inc.) and 10 µl SYBR-Green qPCR mix according to the manufacturer's instructions. The conditions for RT were as follows: 25°C for 5 min, 55°C for 20 min and 85°C for 5 min. qPCR was performed using a 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The reaction conditions were as follows: Initial denaturation at 96°C for 3 min; followed by 40 cycles of denaturation at 96°C for 15 sec; annealing and extension, both at 58°C for 30 sec; final extension at 72°C for 50 sec. The final relative expression of ISLR was calculated using the 2^−ΔΔCq method (19) and normalised to that of GAPDH. The primers were synthesised by Genomeditech Biotechnology. The sequences (from 5′→3′) of primers of ISLR were TGTTGCTGCAGAGAAGCAGT (forward) and CCTGCATGGTGCCTCCTTCA (reverse); and GAPDH, TCCTCTGACTTCAACAGCGACAC (forward) and CACCCTGTTGCTGTAGCCAAATTC (reverse).

Cell viability was estimated using the Cell Counting Kit (CCK)-8 assay (Shanghai GenePharma Co., Ltd.) according to the manufacturer's instructions. In total, ~10⁴ NSCLC cells were seeded in the 96-well plates with 100 µl medium in each well and incubated at 37°C for 0, 24, 48, 72 and 96 h. Then, 10 µg CCK-8 solution was added to each well and incubated at 37°C for 4 h. Finally, the absorbance at 450 nm was measured using a Thermomax microplate reader (Molecular Devices, LLC).

Cell proliferation was detected using a colony formation assay. After 48 h of transfection, the cells (500 cells) were seeded in 6-well plates with complete medium for 2 weeks, which was replaced every 3 days. Colonies with >50 cells were then fixed with 4% formaldehyde for 15 min at 37°C, stained with crystal violet for 10-20 min at 37°C and counted under a light microscope (Olympus Corporation; magnification, ×10). Finally, the data obtained from five stochastic fields were used for the statistical analysis.

Cell motility was confirmed using a wound healing assay. After 48 h of transfection, A549 and H1299 cells were digested with trypsin, and the cell suspension (50 µl; 4.5×10⁵ cells/ml) was prepared and seeded into each well of a 6-well plate using serum-free medium. When the confluency of cells reached 80%, a horizontal line was drawn on each well with a 200 µl pipette tip, and cells were flushed twice with PBS. Cell movement and migration in the entire wound area were observed using an inverted optical microscope (Olympus Corporation; magnification, ×100). Finally, to evaluate healing, the cells were imaged using a microscope (Olympus Corporation; magnification, ×100) at 48 h after the scratch. The migration rate was quantified as the average distance travelled by the cells to the original wound surface.

Cell invasive abilities were evaluated using Transwell chambers with 8-µm porous membranes coated with Matrigel (BD Biosciences) at 37°C for 48 h. According to the manufacturer's protocols, A549 and H1299 cells (5×10⁵ cells/ml) in RPMI-1640 medium without FBS were seeded into the upper chamber of a Transwell insert. RPMI-1640 medium with 10% FBS was added to the lower chamber. After 24 h, cells on the upper side of the membrane were removed using a cotton swab, followed by washing with PBS three times. The cells on the lower surface of the membrane were fixed with 4% paraformaldehyde for 10 min at room temperature and stained with 0.2% crystal violet (Biotechnology) for 10 min at room temperature. Finally, the images were captured using an inverted microscope (Nikon Corporation; magnification, ×100).

The Annexin V-FITC Apoptosis Detection kit (BD Biosciences) was used for staining, and flow cytometry was used to detect cell apoptosis. Briefly, the harvested NSCLC cells were flushed with PBS and resuspended in 500 µl conjugate buffer. Then, 10 µl Annexin V-FITC and 10 µl PI (BD Pharmingen; BD Biosciences) were added to the buffer at 37°C for 15 min. A FACScan flow cytometer (BD Biosciences) was used to analyse cell apoptosis after 1 h (early + late apoptosis). FlowJo (version 10.6.2; FlowJo LLC) was used to analyse the data.

Cells were lysed using RIPA buffer (Thermo Fisher Scientific, Inc.) containing protease and phosphatase inhibitors for 30 min on ice. The density of all proteins extracted from the supernatant of the cell lysate was detected using a BCA Protein Assay kit (Takara Bio, Inc.). Next, the proteins (40 µg per lane) were separated with 10% SDS-polyacrylamide gels, and the specific proteins were transferred to PVDF membranes (Thermo Fisher Scientific, Inc.). The membrane was blocked with 5% non-fat dry milk for 1 h at 37°C and incubated with primary antibodies (all from Cell Signaling Technology, Inc.) against vimentin (cat. no. 5741; 1:1,000), N-cadherin (cat. no. 13116; 1:1,000), E-cadherin (cat. no. 3195; 1:1,000), glucose transporter 1 (Glut-1; cat. no. 73015; 1:1,000), hexokinase 2 (HK-2; cat. no. 2867; 1:1,000), lactate dehydrogenase A (LDHA; cat. no. 3582; 1:1,000), Bcl-2 (cat. no. 4223; 1:1,000), Bax (cat. no. 2774; 1:1,000), cleaved caspase-3 (cat. no. 9654; 1:1,000), Janus kinase (JAK)2 (cat. no. 3230; 1:1,000), phosphorylated (p)-JAK2 (Tyr1,007/1,008; cat. no. 3776; 1:1,000), STAT3 (cat. no. 12640; 1:1,000), p-STAT3 (Tyr705; cat. no. 9145; 1:1,000) and GADPH (cat. no. 5174; 1:1,000) overnight at 4°C. After three washes with TBS-0.1% Tween-20, the membranes were incubated with HRP-conjugated secondary antibody (cat. no. 7076; 1:3,000; Cell Signaling Technology, Inc.) for 45 min at room temperature. GAPDH served as the control. The intensity of protein expression was measured using an ECL reagent (Thermo Fisher Scientific, Inc.). ImageJ software (version 6.0; National Institutes of Health) was used to semi-quantify the protein expression.

The glucose uptake colorimetric assay, lactate colorimetric assay and ATP colorimetric assay kits (Biovision, Inc.) were used to examine glucose consumption and lactate and ATP production in A549 and H1299 cells, according to the manufacturer's protocols.

A human IL-6 ELISA kit (cat. no. PI330; Beyotime Institute of Biotechnology) was used to detect the concentrations of human IL-6 in the cell supernatant according to the manufacturer's instructions. The cell supernatant was harvested via centrifugation (500 × g; 4°C; 10 min). Cells were seeded in 6-well plates and cultured for 48 h, and 200 µl culture supernatant was used for detection.

Non-tumorous lung tissue and primary lung cancer tissues (2 cm away from the tumour margin) were collected from 38 patients (21 men and 17 women; age range, 27-81 years; median age, 54 years) who underwent surgical resection at The Shandong Second Provincial General Hospital between June 2020 and March 2021. The inclusion criteria were as follows: i) None of the patients received neoadjuvant therapy; ii) study patients were diagnosed with lung cancer via histopathology; and iii) diagnosis was confirmed by two independent pathologists. The exclusion criteria were as follows: i) Lung cancer cases with unconfirmed pathology; ii) lung cancer cases with incomplete data records; and iii) patients receiving chemotherapy and radiotherapy prior to the surgery. The use of patient samples was approved by the Ethics Committee of The Shandong Second Provincial General Hospital (approval no. XYK20200511).

Tissue samples were fixed in 4% formaldehyde (Thermo Fisher Scientific, Inc.) at 25°C for 24 h, dehydrated and made transparent using gradient alcohol, following which they were paraffin embedded. The sections (thickness, 5 µm) separated from lung tissue were soaked in citrate buffer solution (pH 6.0) and heated in a 850 W power microwave oven for 10 min to conduct antigen repair. Tissue sections were incubated in 3% H₂O₂ for 15 min at room temperature and blocked in 10% normal goat serum (Sigma-Aldrich; Merck KGaA) for 30 min at room temperature. Then, the tissues were incubated with primary antibody against ISLR (cat. no. ab232986; Abcam) overnight at 4°C. Next the sections were incubated with goat anti-rabbit IgG H&L secondary antibody (1:1,000; Abcam; cat. no. ab150077) at room temperature for 30 min. The sections were stained with haematoxylin at room temperature for 30 sec (Sigma-Aldrich; Merck KGaA), dried in an oven at 65°C, rinsed in water, then mixed with alcohol (Sigma-Aldrich; Merck KGaA) and xylene (Sigma-Aldrich; Merck KGaA) and naturally dried. Finally, the sections were observed under a stereomicroscope (magnification, ×200; Thermo Fisher Scientific, Inc.).

Gene set enrichment analysis (GSEA) (20) was performed on TCGA database datasets (LUAD; https://cancergenome.nih.gov/) of ISLR expression using the R package 'clusterProfiler' (21). For GSEA, ISLR expression was treated as a numeric variable. The Pearson correlation coefficients of other genes and ISLR expression were calculated, and the genes were sequenced according to the correlation coefficients. The hallmark gene sets were deposited in the GSEA Molecular Signatures Database resource (h.all. v7.1.symbols.gmt; https://www.gsea-msigdb.org/gsea/index.jsp), the differential pathways between the high- and low-ISLR expression specimens were identified. The number of permutations was 1,000. Normalised enrichment score >1 and false discovery rate q-value <0.05 were established as cut-offs for significant enrichment.

All the data were analysed using SPSS software (version 18.0; SPSS, Inc.). Survival curves were analysed using Kaplan-Meier survival curves and log-rank tests. All the experiments were conducted in triplicate, and all data are expressed as the mean ± SD. An unpaired Student's t-test was used to compare differences between two groups, while one-way ANOVA and Tukey's post hoc test were used to compare differences between multiple groups. P<0.05 was considered to indicate a statistically significant difference.

To identify ISLR expression in NSCLC, TCGA-LUAD cohort datasets were analysed and it was found that ISLR expression was upregulated in the NSCLC tumour tissues compared with that in the normal tissues (Fig. 1A). TCGA cohort data-sets showed that ISLR expression in both NSCLC (at different stages) and nodal metastasis cancers were significantly higher compared with those in normal tissues (Fig. 1B and C). Kaplan-Meier analysis demonstrated that NSCLC cases with high expression of ISLR had poorer OS compared with patients with low ISLR expression (Fig. 1D). The immunohistochemical results identified that ISLR expression in lung cancer tissues was higher than that in non-tumorous lung tissues (Fig. 1E).

ISLR expression was also detected in several NSCLC cell lines and normal immortalised lung epithelial cell lines via RT-qPCR and western blotting. As shown in Fig. 1F and G, compared with 16HBE cells, ISLR expression was significantly upregulated in all evaluated NSCLC cell lines, with that in A549 cells being the most pronounced, followed by H23 and H1299 cells exhibiting the least upregulation. These results indicated that the abnormal expression of ISLR may be associated with NSCLC progression. The selection of cell types was determined according to the expression of ISLR. A549 cells expressed relatively high levels of ISLR, whereas H1299 cells expressed relatively low levels of ISLR; therefore, H1299 and A549 cells were used in subsequent experiments with pcDNA3.1-ISLR vectors and siRNA, respectively.

To further investigate the role of ISLR in the progression of NSCLC, A549 and H1299 cells were selected for the follow-up experiments. Subsequently, ISLR was knocked down in A549 cells and overexpressed in H1299 cells, and the expression levels were verified using RT-qPCR (Fig. 2A). Cell viability and proliferation were detected using the CCK-8 and colony formation assays, respectively. The results demonstrated that ISLR knockdown suppressed proliferation and colony number in A549 cells, whereas ISLR overexpression promoted the proliferation of H1299 cells (Fig. 2B and C), suggesting that si-ISLR inhibited the proliferation of NSCLC cells.

Wound healing and Transwell assays were performed to investigate the effect of ISLR on cell migration and invasiveness. As shown in Fig. 3A, ISLR knockdown significantly decreased A549 cell adhesion ability and the number of migrated cells; however, ISLR overexpression produced contrary effects on H1299 cells. Moreover, the invasion assays indicated that the ISLR knockdown significantly inhibited the invasion of A549 cells, whereas the opposite effect was observed when ISLR was overexpressed in H1299 cells (Fig. 3B).

The expression levels of proteins involved in epithelial-mesenchymal transition (EMT) were evaluated using western blotting. Compared with the respective control cells, ISLR silencing increased the expression level of the epithelial marker E-cadherin and reduced the expression levels of mesenchymal markers, such as N-cadherin and vimentin, in A549 cells (Fig. 3C). Conversely, ISLR overexpression produced the opposite effect on the EMT-related proteins in H1299 cells. These results indicated that ISLR silencing suppressed the EMT, migration and invasion of NSCLC cells.

The present results demonstrated that ISLR silencing increased the apoptosis of A549 cells, while overexpression of ISLR suppressed the apoptosis of H1299 cells, compared with the corresponding control group (Fig. 4A). To further determine the mechanism involving ISLR in the apoptosis of NSCLC cells, western blotting was performed to detect the expression levels of related genes. Interestingly, ISLR silencing decreased the expression levels of Bcl-2, but increased the expression levels of Bax and cleaved caspase-3 in A549 cells. By contrast, ISLR overexpression exhibited the opposite effect on the expression levels of Bcl-2, Bax and cleaved caspase-3 in H1299 cells (Fig. 4B). Collectively, these results demonstrated that ISLR silencing may promote the apoptosis of NSCLC cells.

To examine the potential role of ISLR in NSCLC glycolysis, A549 and H1299 cells were transfected with si-ISLR or pcDNA3.1-ISLR; glucose consumption, lactate production and ATP production were subsequently analysed. The results demonstrated that the silencing of ISLR expression in A549 cells inhibited cellular glucose uptake (Fig. 5A), lactate consumption (Fig. 5B) and ATP/ADP ratios (Fig. 5C), while ISLR overexpression produced the opposite effects on glycolysis progression. The western blotting results indicated that the expression levels of glycolytic target proteins (including HK-2, Glut-1 and LDHA) were downregulated in A549 cells with ISLR knockdown, whereas they were upregulated in H1299 cells with ISLR overexpression (Fig. 5D). Overall, these results indicated that the silencing of ISLR could inhibit aerobic glycolysis in NSCLC cells.

The GSEA results suggested that the IL-6/JAK/STAT3 pathway was enriched in ISLR-related NSCLC (Fig. 6A and B). ELISA results demonstrated that IL-6 levels in the culture supernatants of NSCLC cell lines were reduced by knockdown of ISLR (Fig. 6C). The knockdown of ISLR decreased the phosphorylation levels of JAK2 and STAT3, while the overexpression of ISLR increased these phosphorylation levels (Fig. 6D).

To further determine the molecular mechanism of action of ISLR in the IL-6/JAK/STAT3 pathway, IL-6 (pathway activator) was used to treat si-ISLR-transfected cells. Notably, the knockdown of ISLR reversed the promotion effects on cell proliferation (Fig. 7A), invasion (Fig. 7B), apoptosis (Fig. 7C) and glycolysis (Fig. 7D) caused by IL-6. Collectively, it was suggested that the IL-6/JAK/STAT3 signalling pathway may be involved in the effect of ISLR on NSCLC cell progression (Fig. 7E).