*Contributed equally
Human periodontal ligament cells (hPDLCs) play a notable role in periodontal tissue homeostasis and regeneration. However, the effect of
Periodontal ligaments (PDL) connect the cementum to the alveolar bone and provide mechanical support to the periodontium (
Proliferation is controlled by cell cycle progression, which is a complex and stepwise process. Cyclins and cyclin-dependent kinases (CDKs) are the predominant proteins that regulate the progression of the cell cycle. Cyclin D1 plays a notable role in G1 phase progression of the cell cycle via CDK4 activation (
Ethical approval for the present study was granted by the Institutional Review Board of the University of Hong Kong/Hospital Authority Hong Kong West Cluster (approval no. IRB UW13-120; Hong Kong, China). hPDLCs were isolated from the non-decayed, healthy teeth of three donors (two females aged 13 and 15 years old separately; one male aged 14 years old) who had undergone premolar extraction for orthodontic treatment at the Division of Paediatric Dentistry and Orthodontics in The Faculty of Dentistry, The University of Hong Kong from 10th January 2017 to 31st December 2018. Written consent to use the samples in scientific research was signed by the parents or legal guardians of the donors. The PDL tissues of the root were scraped and collected from the middle third of the premolar root surfaces to avoid contamination by cells derived from the gingiva and dental germ. The primary hPDLCs were cultured in modified Eagle's medium-α (α-MEM) containing 10% foetal bovine serum (HyClone; Cytiva) and 1% antibiotic solution (100 U/ml penicillin and 100 µg/ml streptomycin) at 37˚C in a humidified 5% CO2 atmosphere. After achieving 80% confluence, cells were detached by treatment with 0.25% trypsin (Thermo Fisher Scientific, Inc.) and sub-cultured in fresh α-MEM. The hPDLCs were characterised by immunocytochemical staining for vimentin and cytokeratin. The 3rd to 5th passages of the hPDLCs were used as the test (treated with
The hPDLCs were seeded into 96-well plates at 5x103 cells/well. After serum starvation, the cells were treated with
The dose- and time-dependent effects of
A RT-qPCR assay was carried out to analyse the mRNA expression of genes associated with different stages of proliferation. After hPDLCs were stimulated with 0.01 µg/ml
After the hPDLCs were incubated with 0.01 µg/ml
Statistical analysis was carried out using SPSS 19.0 software (IBM Corp.). A one-way analysis of variance (ANOVA) and Tukey's post hoc test were conducted for the data of flow cytometry and WB. A two-way ANOVA followed by Bonferroni test was performed for the CCK-8 and RT-qPCR data. All data were expressed as the mean ± standard deviation from four independent experiments. P<0.05 was considered to indicate a statistically significant difference.
As presented in
After serum starvation for 24 h, the majority of cells were at the G0/G1 stage and few were in the S or G2/M phases of the cell cycle (
The mRNA expression levels of cyclin A and cyclin D1 were significantly increased in the LPS-treated hPDLCs at 18 and 24 h compared with their control groups at the same time point (P<0.01), and the levels of cyclin B1 were also increased at 24 h (P<0.01;
hPDLCs were incubated in the presence or absence of 0.01 µg/ml
The results of the present study indicated that high concentrations of
These aforementioned findings highlight differences in both the dose- and time-dependent effects of
In the present study, the 3rd to 5th passages of hPDLCs from young patients with good oral health were selected to eliminate the influence of ageing or diseases on proliferative ability (
As the cell cycle progresses, the preparatory G0/G1 phase ensures that everything is ready for DNA synthesis, after which DNA replication occurs during the S phase (
The cell cycle is a complex process that is needed for the proliferation of cells. CDKs and cyclins are central to this process. Extensive work on gene knockout mouse models of cell cycle regulators has revealed compensatory mechanisms that regulate the interactions among cyclins and CDKs (
Upon further investigating the time dependency of cell proliferation after exposure to
Currently, the intrinsic mechanisms by which
In summary,
The authors would like to acknowledge Mr Tong Wai Man (flow cytometry and reverse transcription-quantitative PCR technical support), Ms Yu Ching Lam (cell culture technical support) and Ms Tong Hoi Yee (western blotting technical support), all from Centralized Research Laboratory, Faculty of Dentistry, The University of Hong Kong (Hong Kong, China).
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
YY, CZ and LJ made substantial contributions to the overall structural design of the study, methodology and data analysis. JL, YH and ZT performed the experiments. JL detected the cell proliferation and cell cycle by flow cytometry and analysed mRNA expression levels of the cyclins and CDKs by RT-qPCR. YH performed the western blotting of the cyclins. ZT and MG were major contributors in the CCK-8 assay for cell proliferation. JL and YH analyzed the data, drafted and revised the manuscript under the guidance of CZ, LJ and YY. JL and YH confirmed the authenticity of all the raw data. All authors have read and approved the final manuscript.
Ethical approval for the present study was granted by the Institutional Review Board of the University of Hong Kong/Hospital Authority Hong Kong West Cluster (approval no. IRB UW13-120; Hong Kong, China).
Not applicable.
The authors declare that they have no competing interests.
Effects of
Effects of 0.01 µg/ml
Changes of the proliferation index and SPF in hPDLCs induced by 0.01 µg/ml
mRNA expression levels of cyclins A, B1, D1 and D2, and CDK1, 2 and 4 in hPDLCs treated with or without 0.01 µg/ml
Protein expression levels of cyclins A, B1 and D1 in hPDLCs incubated in the presence or absence of 0.01 µg/ml
Primer sequences used in reverse transcription-quantitative PCR.
Gene name | Forward sequence (5'-3') | Reverse sequence (5'-3') |
---|---|---|
Cyclin A | GCCTTTCATTTAGCACTC | TGAAGGTCCATGAGACAA |
Cyclin B1 | GGAAACATGAGAGCCATCCT | TTCTGCATGAACCGATCAAT |
Cyclin D1 | CAAACAGATCATCCGCAAAC | GCGTGTGAGGCGGTAGT |
CDK1 | TGAAACTGCTCGCACTTG | ATGGTAGATCCCGGCTTATT |
CDK2 | CAGAAACAAGTTGACGGGAGA | GACATCCAGCAGCTTGACAATA |
CDK4 | ACAGCTACCAGATGGCACTTACA | CAAAGATACAGCCAACACTCCAC |
Cyclin D2 | GTGTGATGCCATATCAAGTCC | TCGCATACACTGATCATGC |
GAPDH | TCCCTGAGCTGAACGGGAAG | GGAGGAGTGGGTGTCGCTGT |
CDK, cyclin-dependent kinase.