Contributed equally
It is important to determine the mechanism of liver fibrosis for targeted therapy and the development of targeted therapies for liver fibrosis may offer promise for patients with liver disease. Long non-coding RNAs (lncRNAs) serve a role in hepatic fibrosis. The lncRNA maternally expressed gene 3 (MEG3) has been confirmed to inhibit liver fibrosis. The present study investigated the role of the MEG3 in healthy patients and patients with liver fibrosis. The expression levels of MEG3 and microRNA (miR)-145 in the serum of healthy volunteers and patients with liver fibrosis and in LX-2 cells were detected using reverse transcription-quantitative PCR. A dual-luciferase reporter assay was used to determine the targeting relationship between MEG3 and miR-145, and the targeting relationship between miR-145 and peroxisome proliferator-activated receptor γ (PPARγ). The protein expression levels of PPARγ, α-smooth muscle actin (α-SMA) and collagen I (COL1A1) were detected using western blotting. The expression levels of α-SMA and COL1A1 were also determined using immunofluorescence. Finally, a Cell Counting Kit-8 assay was performed to assess the proliferative ability of LX-2 cells. A significantly reduced MEG3 expression level was demonstrated in serum from patients with liver fibrosis compared with serum from healthy controls. TGF-β1 induced a significantly decreased MEG3 expression level in LX-2 human hepatic stellate cells
Hepatic fibrosis is a pathophysiological process that results from the wound-healing response as a consequence of chronic liver injury from such conditions as viral hepatitis, metabolic disorder, alcohol abuse, cholestasis and autoimmune diseases (
Human protein-coding genes account for <2% of the entire genome and most transcripts consist of non-coding RNAs (ncRNAs), such as microRNAs (miRNAs/miRs), circular RNAs and long non-coding RNAs (lncRNAs) (
In addition, lncRNAs can function as competitive endogenous RNAs (ceRNAs), which mainly sponge miRNAs and protect mRNAs from miRNA-mediated post-translational regulation (
Healthy patients (n=25) and patients with liver fibrosis (mild and severe; n=25) were recruited between January and September 2020. Hepatic fibrosis was evaluated, according to the fibrosis index based on the 4 factor (FIB-4) index, which can be used for the diagnosis and staging of liver fibrosis (
The LX-2 human hepatic stellate cell line was obtained from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. Cells were cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 1% penicillin-streptomycin solution (Beijing Solarbio Science & Technology Co., Ltd.) and 10% fetal bovine serum (Invitrogen; Thermo Fisher Scientific, Inc.). Cells were cultured in a humidified 37°C incubator with 5% CO2. For certain experiments, cells were cultured at 37°C for 8–12 h and then incubated with 10 ng/ml human recombinant TGF-β1 (R&D Systems, Inc.) for 24 h (
Short hairpin RNAs (shRNAs/sh) targeting MEG3 (forward, 5′-CCGGATAGAGGAGGTGATCAGCAAACTCGAGTTTGCTGATCACCTCCTCTATTTTTTG-3′ and reverse, 5′-AATTCAAAAAATAGAGGAGGTGATCAGCAAACTCGAGTTTGCTGATCACCTCCTCTAT-3′), miR-145 mimic (forward, 5′-GUCCAGUUUUCCCAGGAAUCCCU-3′ and reverse, 5′-AGGGAUUCCUGGGAAAACUGGAC-3′) and negative control (NC)-mimic (forward, 5′-UCACAACCUCCUAGAAAGAGUAGA-3′ and reverse, 5′-UCUACUCUUUCUAGGAGGUUGUGA-3′), miR-145 inhibitor (5′-AGGGAUUCCUGGGAAAACUGGAC-3′) and NC-inhibitor (5′-UCUACUCUUUCUAGGAGGUUGUGA-3′) were obtained from Shanghai GenePharma Co. Ltd. An empty plasmid cloning (pc)DNA3.1(+) vector (Addgene, Inc.) was used as a control for MEG3 and PPARγ overexpression pcDNA3.1(+) constructs. LX-2 cells (5×105 cells/well) were seeded into 6-well plates for 24 h, and then transfected with the aforementioned recombinant vectors (2 µg), shRNA (1 µg), miR-145 mimic (20 nM), miR-145 inhibitor (20 nM) or the controls, at 40–60% confluence using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Transfected cells were harvested 48 h after transfection.
LX-2 cells and peripheral blood samples were harvested and total RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Total RNA was reverse transcribed into cDNA using an iScript™ cDNA Synthesis kit (Bio-Rad Laboratories, Inc.) according to the manufacturer's protocol. qPCR was subsequently performed using the SYBR Green Real-Time PCR Assay kit (Takara Bio, Inc.) according to the manufacturer's protocol. qPCR thermocycling conditions were as follows: Initial denaturation at 95°C for 10 min, followed by 45 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min. The relative expression levels were quantified using the 2−ΔΔCq method and normalized to the internal reference genes GAPDH or U6 (
LX-2 cells were seeded at a density of 5×103 cells/well into 96-well plates and placed in a 5% CO2 incubator at 37°C. Following incubation for various durations (1, 2, 3, 4 and 5 days), 10 µl CCK-8 reagent (Shanghai Obio Technology Corp., Ltd.) was added to each well. Following incubation for 4 h, the optical density at 450 nm was quantified using a microplate reader (Bio-Tek Instruments, Inc.).
To detect α-SMA and COL1A1 expression, LX-2 cells were seeded at a density of 5×105 cells/well into 12-well culture plates with poly-D-lysine-coated glass coverslips on the bottom. The cells were fixed with 4% paraformaldehyde (dissolved in PBS, pH 7.4) for 10 min at room temperature. The cells were then washed three times with cooled PBS. Following cell attachment, a blocking solution of 5% BSA (Shanghai Lianmai Biological Engineering Co., Ltd.) was applied for 1 h at room temperature and washed twice with PBS for 10 min. Subsequently, cells were incubated with primary antibodies targeting α-SMA (1:500; Abcam; cat. no. ab7817) or COL1A1 (1:500; Abcam; cat. no. ab260043) at 37°C for 30 min. Cells were than incubated with the following secondary antibodies: Alexa Fluor 488-conjugated goat anti-mouse IgG (Invitrogen; Thermo Fisher Scientific, Inc. cat. no. SA510212) or Alexa Fluor 594-conjugated goat anti-rabbit IgG (Invitrogen; Thermo Fisher Scientific, Inc. cat. no. A-11012) at 37°C for 30 min. DAPI (Sigma-Aldrich; Merck KGaA) staining was performed at room temperature for 15 min, then the cells were rinsed with 0.1% Tween-20 PBS at room temperature three times for 10 min each. Images were captured under fluorescence microscopy (Leica Microsystems GmbH; magnification, ×100).
LX-2 cells and patient serum were cytolyzed to obtain the total protein using RIPA lysis buffer (Beyotime Institute of Biotechnology) on ice for 30 min. Total protein was quantified using a BCA Protein Assay Reagent kit (Thermo Fisher Scientific, Inc.) and 50 µg total protein/lane was separated by SDS-PAGE on a 10% gel. The separated proteins were subsequently transferred onto a PVDF membrane. Membranes were blocked using 5% skimmed milk at room temperature for 1 h and incubated with the following specific primary antibodies overnight at 4°C: α-SMA (1:1,000; Abcam; cat. no. ab7817), COL1A1 (1:1,000; Abcam; cat. no. ab260043), PPARγ (1:1,000; Abcam; cat. no. EPR21244) and β-actin (1:3,000; Abcam; cat. no. ab8226). Membranes were washed three times with TBS containing 0.1% Tween-20. Following the primary antibody incubation, membranes were incubated with HRP-labeled secondary antibody goat anti-mouse IgG (1:5,000; Sigma-Aldrich; Merck KGaA; cat. no. 12-349) or goat anti-rabbit IgG (1:5,000; Sigma-Aldrich; Merck KGaA; cat. no. 12-348) at room temperature for 2 h. Protein bands were visualized using Clarity™ Western ECL substrate (Bio-Rad Laboratories, Inc.). Semi-quantitative densitometry of the immunoblot images was analyzed using ImageJ software (National Institutes of Health; 1.8.0 version). β-actin was used as the internal reference gene.
The potential binding sites of MEG3 and miR-145 were predicted using miRBase (
Dual-luciferase reporter assay. The lncRNA MEG3 and PPARγ 3′UTR fragments containing the wild-type (WT) or mutant (MUT) miR-145 putative binding sites were amplified by PCR from human genomic DNA and cloned into the psi-CHECK2 reporter vector (Promega Corporation). The WT or MUT reporter vector were co-transfected with miR-145 mimic or mimic negative control into LX-2 cells (5×104 cells/well) using Lipofectamine 2000 at room temperature. At 48 h after transfection, luciferase activity was detected using a Dual-Luciferase Reporter Assay System (Promega Corporation) according to the manufacturer's protocol. Firefly luciferase activity was normalized to
Data are presented as the mean ± standard deviation or median + interquartile range. At least three times experiments were performed independently. SPSS 16.0 software (SPSS, Inc.) was used for statistical analysis. An unpaired Student's t-test was used to draw statistical comparisons between two groups, and one-way ANOVA followed by a Tukey's post hoc test was used to make comparisons between multiple groups. P<0.05 was considered to indicate a statistically significant difference.
To determine whether MEG3 participated in the progression of liver fibrosis, peripheral blood samples from healthy patients (25 samples) and patients with liver fibrosis were obtained (12 mild fibrosis samples and 13 severe fibrosis samples). MEG3 expression levels were determined using RT-qPCR, and the results demonstrated that MEG3 expression was significantly decreased in the mild and severe fibrosis groups compared with the healthy group (
To investigate the role of MEG3 in HSC activation, LX-cells were transfected with pcMEG3 overexpression vector. RT-qPCR demonstrated that MEG3 expression levels were significantly increased by pcMEG3 in LX-2 cells in the absence or presence of TGF-β1 stimulation compared with the vector and TGF-β1+vector controls, respectively (
lncRNAs were reported to function as regulators of miRNAs (
To explore the role of miR-145 in HSCs, LX-2 cells were transfected with miR-145 inhibitor with or without shMEG3 co-transfection. miR-145 expression levels in LX-2 cells were significantly decreased by the miR-145 inhibitor compared with the NC-inhibitor. Downregulation of MEG3 significantly reversed the decrease in miR-145 expression levels compared with miR-145 inhibitor (
The putative targets of miR-145 were investigated using the starBase prediction tool. The results indicated that PPARγ was a possible miR-145 target; the putative miR-145 target sites in PPARγ-WT and the designed mutant sequence, PPARγ-MUT, are indicated in
To determine whether PPARγ is involved in MEG3/miR-145-mediated activation of HSCs, LX-2 cells were transfected with pcPPARγ, miR-145 mimic and shMEG3. Following transfection with pcPPARγ, PPARγ mRNA expression levels significantly increased compared with the empty vector group (
Liver fibrosis occurs in most types of chronic liver disease. Following persistent liver injury, HSCs are the main collagen-producing cells activated by damaged hepatocytes; they release TGF-β1 and reactive oxygen species, whereas Kupffer cells release TNF-α and TGF-β1 (
MEG3, part of the Delta-like homolog 1-MEG3 imprinting locus located at human chromosome 14q32 and at mouse distal chromosome 12, is expressed in a number of healthy tissues (
Emerging evidence indicates that certain lncRNAs may participate in the ceRNA regulatory circuit. For example, it has been reported that MEG3 negatively regulates miR-145 in diabetic nephropathy (
In conclusion, the present study demonstrated that MEG3 was downregulated in patients with liver fibrosis and that TGF-β1-induced HSC activation was depressed by MEG3
Not applicable.
This research was supported by The Health Research Project of Kunming Municipal Health Commission (Kunming, China; grant nos. 2020-03-03-113, 2020-03-03-111 and 2019-03-10-001), the Science and Technology Plan Project of Yunnan Provincial Science and Technology Department-Kunming Medical Joint Special Project (grant no. 202001AY070001-266) and Kunming Health Science and Technology Talents Training Project: 2019-sw (Backup)-05
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
RQ conceived the study, wrote the manuscript and performed the experiments. WH conceived the study, wrote the manuscript and performed the data analysis. YH participated in the experiments and data collection. ZZ performed the data analysis and assembled the figures. YS performed the experiments. SC performed the statistical analysis and summarized the experimental results. HW designed and supervised the study and edited the manuscript. RQ and HW confirm the authenticity of all the raw data. All authors read and approved the final manuscript.
Written informed consent was obtained from all patients. The present study was approved by the Ethics Committee of Yan'an Hospital of Kunming (Kunming, China; approval no. YXLL-AF-SC-022/01).
Not applicable.
The authors declare that they have no competing interests.
Long non-coding RNA MEG3 expression level is associated with the progression of liver fibrosis. (A) MEG3 expression levels in the serum of healthy volunteers and in patients with mild or severe hepatic fibrosis. (B) MEG3 expression levels in LX-2 cells were quantified by reverse transcription-quantitative PCR. **P<0.01; #P<0.05. MEG3, maternally expressed gene 3.
Overexpression of MEG3 alleviates TGF-β1-stimulated hepatic stellate cell activation. (A) Following overexpression vector transfection, MEG3 expression levels in LX-2 cells were detected by RT-qPCR. (B) Following MEG3 overexpression and TGF-β1 treatment, MEG3 expression levels in LX-2 cells were detected by RT-qPCR. (C) LX-2 cell proliferation was quantified using the Cell Counting Kit-8 assay. ##P<0.01 vs. control, **P<0.01 vs. TGF-β1+vector. (D) Immunofluorescence was used to determine α-SMA and COL1A1 expression in LX-2 cells. Representative images from each group are presented (magnification, ×100). (E) Protein expression levels of α-SMA and COL1A1 in LX-2 cells were detected by western blotting. **P<0.01 vs. Control; #P<0.05 vs. TGF-β1+vector. α-SMA, α-smooth muscle actin; COL1A1, collagen type 1 α1; MEG3, maternally expressed gene 3; RT-qPCR, reverse transcription-quantitative PCR.
MEG3 acts as a sponge of miR-145. (A) Predicted miR-145 binding sites on MEG3. (B) miR-145 expression levels in serum from healthy patients and patients with mild and severe fibrosis were detected by RT-qPCR. (C) miR-145 expression levels in LX-2 cells following TGF-β1 treatment were detected by RT-qPCR. (D) Dual-luciferase reporter assays were performed to verify the relationship between miR-145 and MEG3. (E) Verification of MEG3 knock down following shMEG3 transfection. (F) Following transfection with pcMEG3 or shMEG3, miR-145 expression levels in LX-2 cells was detected by RT-qPCR. **P<0.01; #P<0.05, ##P<0.01. MEG3, maternally expressed gene 3; miR, microRNA; MUT, mutant; NC, negative control; pc, plasmid cloning DNA3.1 overexpression vector; RT-qPCR, reverse transcription-quantitative PCR; sh, short hairpin RNA; WT, wild-type.
miR-145 promotes hepatic stellate cell activation and is susceptible to MEG3. (A) Following transfection, miR-145 expression levels in LX-2 cells were detected by RT-qPCR. (B) Following transfection and TGF-β1 treatment, miR-145 expression levels in LX-2 cells were detected by RT-qPCR. (C) LX-2 cell proliferation was quantified using the Cell Counting Kit-8 assay. (D) Immunofluorescence was used to determine α-SMA and COL1A1 expression in LX-2 cells. Representative images from each group are presented; magnification, ×100. (E) α-SMA and COL1A1 protein expression levels in LX-2 cells were detected by western blotting. **P<0.01. α-SMA, α-smooth muscle actin; COL1A1, collagen type 1 α1; MEG3, maternally expressed gene 3; miR, microRNA; NC, negative control; RT-qPCR, reverse transcription-quantitative PCR; sh, short hairpin RNA.
miR-145 negatively regulates PPARγ in LX-2 cells. (A) Predicted miR-145 target sites on PPARγ 3′untranslated region. (B) Dual-luciferase reporter assays were performed to verify the relationship between miR-145 and PPARγ. **P<0.01. PPARγ (C) protein and (D) mRNA expression levels in serum from healthy patients and patients with mild and severe fibrosis were detected by western blotting and reverse transcription-quantitative PCR, respectively. **P<0.01; #P<0.05. (E) Verification of miR-145 mimic and inhibitor transfection efficiency. **P<0.01 vs. NC-mimic; ##P<0.01 vs. NC-inhibitor. (F) Following transfection with miR-145 mimic or inhibitor, PPARγ protein expression levels in LX-2 cells were detected by western blotting. **P<0.01 vs. NC-mimic; ##P<0.01 vs. NC-inhibitor. miR, microRNA; MUT, mutant; NC, negative control; PPARγ, peroxisome proliferator-activated receptor γ; WT, wild-type.
MEG3/miR-145/PPARγ axis regulates TGF-β1-stimulated hepatic stellate cell activation. (A) Following transfection with pcPPARγ, the expression of pcPPARγ was detected by RT-qPCR. **P<0.01 vs. empty vector. (B) Following transfection, PPARγ mRNA expression levels in LX-2 cells were detected by reverse transcription-quantitative PCR. **P<0.01 vs. TGF-β1+pcPPARγ. (C) Following transfection and TGF-β1 treatment, PPARγ protein expression levels in LX-2 cells were detected by western blotting. **P<0.01 vs. TGF-β1+pcPPARγ. (D) LX-2 cell proliferation was quantified using the Cell Counting Kit-8 assay. **P<0.01 vs. TGF-β1+pcPPARγ. (E) Immunofluorescence was used to determine α-SMA and COL1A1 expression in LX-2 cells. Representative images from each group are presented; magnification, ×100. (F) Protein expression levels of α-SMA in LX-2 cells were detected by western blotting. **P<0.01 vs. TGF-β1+pcPPARγ. α-SMA, α-smooth muscle actin; COL1A1, collagen type 1 α1; MEG3, maternally expressed gene 3; miR, microRNA; PPARγ, peroxisome proliferator-activated receptor γ; pc, plasmid cloning DNA3.1 overexpression vector; sh, short hairpin RNA.
Pathological characteristics of patients with hepatic fibrosis.
Characteristic | Healthy donors, n=25 | Patients (F<2), n=12 | Patients (2≤F<4), n=13 |
---|---|---|---|
Age, n (range) | 55.44 (23–84) | 55.83 (25–80) | 56.92 (31–77) |
Sex, n (%) | |||
Male | 14 (56) | 7 (58.3) | 5 (38.5) |
Female | 11 (44) | 5 (41.7) | 8 (61.5) |
HCV, n (%) | |||
With | n/a | 2 (16.7) | 3 (23) |
Without | n/a | 10 (83.3) | 10 (77) |
Serum ALT, U/l | 35.40±16.92 | 90.92±53.68 | 134.8±86 |
Serum AST, U/l | 37.52±19.92 | 97.25±64.62 | 150.6±74.8 |
ALT, alanine aminotransferase; AST, aspartate aminotransferase; HCV, hepatitis C virus; n/a, not applicable; FIB-4 (F), fibrosis index based on the 4 factors.
Sequences of primers used for reverse transcription--quantitative PCR.
Gene | Primer sequence (5′→3′) |
---|---|
PPARγ | F: ATTTTCTGGAGAGCTTGGC |
R: GTGAGGGTCTCTCTCTTCCT | |
α-SMA | F: GACGAAGCACAGAGCAAAAG |
R: ACAGCACCGCCTGGATAG | |
COL1A1 | F: GAGGCATGTCTGGTTCGG |
R: TGGTAGGTGATGTTCTGGGAG | |
MEG3 | F: CCTGCTGCCCATCTACACCTC |
R: CCTCTTCATCCTTTGCCATCCTGG | |
miR-145 | F: ATATCTCGAGGGAGAGAGATGCCTTCAGCA |
R: ATTTATAAGCTTGGAATCCTTCTCAACACTGAATATCTAC | |
U6 | F: CTCGCTTCGGCAGCACA |
R: AACGCTTCACGAATTTGCGT | |
GAPDH | F: AATCCCATCACCATCTTC |
R: AGGCTGTTGTCATACTTC |
PPARγ, peroxisome proliferator-activated receptor γ; α-SMA, α-smooth muscle actin; COL1A1, collagen type 1 α1; F, forward; MEG3, maternally expressed gene 3; miR, microRNA; R, reverse.