BV-2 is a murine-derived immortalized microglial cell line and were purchased from ScienCell Research Laboratories, Inc., which were routinely cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 2 mM L-glutamine, penicillin (100 U/ml) and streptomycin (100 g/ml; Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO₂ and 95% humidity. For treatment, BV-2 cells were incubated in a six-well plate at a density of 1×10⁵ cells/ml at 37°C with 5% CO₂ for 24 h, and were then cultured in the absence or presence of 100 ng/ml LPS (Sigma-Aldrich; Merck KGaA) for 6 h (27).

Foxc1 adenovirus (Ad-Foxc; adenoviral plasmid name: GV345; target gene ID: 17300; sequence: GGTATAAGAGGCGCGACCAG; accession no. NC_000079; 4×10⁸ TU/ml; Shanghai GeneChem Co., Ltd.) or the adenovirus control (Ad-Ctrl), which is the adenovirus containing the empty vector without the Foxc1 gene (1.5×10⁹ TU/ml; Shanghai GeneChem Co., Ltd.), was added into the media for transfection into BV-2 cells at a 60–80% confluence. Transfection was for 8 h at 37°C with 5% CO₂ (Multiplicity of infection, 100). The medium was then removed and replaced with fresh medium. Cells stably overexpressing Foxc1 were then selected using puromycin incubation (2.5 µg/ml; cat. no. ST551; Beyotime Institute of Biotechnology) at 37°C with 5% CO₂ for 7 days. Reverse transcription-quantitative PCR (RT-qPCR), western blotting and immunofluorescence analysis were used to detect transfection efficiency.

BV-2 cells were seeded in 6-well plates at a density of 5×10⁴ cells/ml for culturing at 37°C with 5% CO₂ for 12 h before siRNA transfections (50 nM) were performed at ~80% confluency. IκBα expression in BV-2 cells was knocked down using siRNA (siRNA-IκBα sense, 5′-ACUCAUUGGUUCCUUUAAGGG-3′ and antisense, 5′-CUUAAAGGAACCAAUGAGUCC-3′). A non-targeting siRNA (siRNA-NT) was used as a negative control (Santa Cruz Biotechnology, Inc.). Transfection of siRNAs into BV-2 cells was performed using the Lipofectamine^® 3000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO₂ for 10 h. Transfection efficiency was measured using RT-qPCR and western blot analysis.

A total of 48 C57BL/6J mice, aged 8–10 weeks (weight, 25±5 g), were obtained from the Department of Experimental Animal Science, School of Medicine, Shanghai Jiao Tong University (license no. SYXK 2018-0027; Shanghai, China). All study procedures were approved by the Institutional Animal Care and Use Committee of Shanghai Jiao Tong University School of Medicine. All experimental procedures were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals (National Institutes of Health, revised in 1996) (28). Mice were housed in a temperature of 23±2°C and humidity of 40–60% on a 12-h light-dark cycle with free access to food and water. Only male mice were used in the present study to minimize the risk of heterogeneity due to sex differences in the pathology of encephalopathy.

For the generation of Foxc1-overexpressing (Foxc1 OE) mice, embryonic stem (ES) cells (B6/BLU; cat. no. SCSP-226; The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences) were cultured with the ES complete medium [600 ml, comprising DMEM (cat. no. 12430; Gibco; Thermo Fisher Scientific, Inc.) 497 ml; fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), 90 ml; Glutamax (cat. no. 35050-061; Gibco; Thermo Fisher Scientific, Inc.) 6 ml; MEM Non-Essential Amino Acids Solution (cat. no. 11140-050; Gibco; Thermo Fisher Scientific, Inc.), 6 ml; LIF (cat. no. ESG1107; MilliporeSigma), 60 µl (concentration, 1,000 U/ml), 2-Mercaptoethanol (cat. no. 21985023; Gibco; Thermo Fisher Scientific, Inc.) 1.5 ml] at 37°C with 5% CO₂ and obtained from School of Medicine, Shanghai Jiao Tong University and transfected with the Foxc1 overexpression adenovirus (MOI, 100) for 72 h in vitro. The Foxc1-overexpressing ES cells were then transplanted into the uterus of female mice (10 male mice and 20 female mice were used in this study). In total, two litters of first-generation male and female mice were bred to obtain the Foxc1-overexpressing mice, where the Foxc1-overexpressing mice were reproduced indefinitely.

The sepsis mouse model was established using CLP surgery as described previously (29). Mice were randomly divided into the following four groups (n=12 per group): i) Naive; ii) sham operated; iii) CLP; and iv) CLP + Foxc1 overexpression (OE). A total of 6 days before and 10 days after CLP surgery, mice were subjected to the Morris water maze (MWM) trial for 6 days. The mice were then sacrificed after MWM trial, and the hippocampus tissues were removed for RT-qPCR and western blot analysis.

Mice with the following symptoms (humane endpoints) were be euthanized during the experiment: i) Inactivity or do not respond to gentle stimulation; ii) dyspnea, including signs of salivation and/or cyanosis from the nose and mouth; iii) diarrhea or urinary incontinence; iv) 20% weight loss; v) Inability to eat or drink; vi) clear signs of anxiety and irritability in animals; vii) paralysis, persistent epilepsy or rigid behavior and viii) infection and pus at the site of operation.

For the CLP surgery itself (29), the mice were anesthetized using intraperitoneal injections of ketamine (80 mg/kg) and xylazine (5 mg/kg). After disinfection an incision was made below the xiphoid to expose the abdominal cavity. The cecum was then isolated, ligated and punctured twice using a 22-gauge needle. Intestinal contents were gently extruded into the peritoneal cavity. The abdomen was then sutured after the cecum was reinserted into the peritoneum. For the sham operated mice, the cecum was only exposed without ligation or perforation, before 1 ml sterile saline pre-warmed to 37°C was put into the abdominal cavity. After surgery, mice were returned to their cages with a warm cotton pad and free access to food and water. Naive mice did not undergo laparotomy.

Spatial learning and memory were assessed using the MWM trial as described previously (30). Briefly, the water temperature was kept at 22–24°C. Acquisition test was performed four times per day for 5 consecutive days; mice were put into the pool from four different directions and allowed to swim freely until they climbed up to platform under the water surface. If they did not find the platform within 60 sec, they were be guided to the platform and stayed on the platform for 10 sec. Four tests were conducted 20 min apart and their swimming track was recorded. The time of climbing to the hidden platform was defined as the escape latency. The platform was then removed on day 6 before retention tests were performed, mice were put into the pool from the same orientation and allowed to swim freely in the pool for 60 sec and the swimming track was recorded. The time of climbing to the hidden platform, the number of crossings over the platform area and the swimming speed were recorded. Experimental parameters were recorded using a SuperMaze Morris Water Maze video analysis system (model, XR-XM101; Shanghai XinRuan Information Technology Co., Ltd.).

From March to June 2021, mice were anesthetized using an intraperitoneal injection of 1% pentobarbital sodium (50 mg/kg). Mice were sacrificed by CO₂ inhalation using 30%/min volume displacement rate after cardiac saline perfusion, and the hippocampus tissues were then collected for subsequent experimentation.

RT-qPCR was performed as described previously (31). In brief, total RNA was extracted from BV-2 cells and hippocampal tissues using RNAiso Plus reagent (Takara Bio, Inc.), and then subjected to reverse transcription using a PrimeScript™ RT Master Mix kit (cat. no. RR036A; Takara Bio, Inc.) according to manufacturer's protocol. cDNA was used for qPCR with a TB Green^® Premix Ex Taq™ (Tli RNaseH Plus) kit (cat. no. RR420A; Takara Bio, Inc.) according to the manufacturer's protocol. All procedures were performed in triplicate. The mRNA expression levels were calculated relative to the GAPDH using the the 2^−ΔΔCq method. The sequences of the primers used were as follows: Foxc1 forward, 5′-AAGACGGAGAACGGTACGTG-3′ and reverse, 5′-TCACCGGGGAGTTGTTCAAG-3′; IκBα forward, 5′-TGTGCTTCGAGTGACTGACC-3′ and reverse, 5′-TCACCCCACATCACTGAACG-3′ and GAPDH forward, 5′-AGGTCGGTGTGAACGGATTTG-3′ and reverse, 5′-TGTAGACCATGTAGTTGAGGTCA-3′. The full thermocycling conditions used for qPCR were as follows: Initial denaturation at 95°C for 30 sec; followed by 40 cycles at 95°C for 5 sec, 60°C for 34 sec, 95°C for 15 sec, 60°C for 60 sec and 95°C for 15 sec.

Western blot analysis was performed as described previously (32). The total protein content of cells and hippocampal samples was extracted using RIPA solution (cat. no. P0013B; Beyotime Institute of Biotechnology) for 30 min, and a BCA assay kit (cat. no. P0012S; Beyotime Institute of Biotechnology) was used to detect the total protein concentration. The extracted proteins (30 µg/lane) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis on 10% gels (Invitrogen; Thermo Fisher Scientific, Inc.) and were then transferred onto nitrocellulose membranes (MilliporeSigma), which were blocked with 5% non-fat milk at room temperature for 2 h, incubated with the corresponding primary at 4°C overnight and secondary antibodies at room temperature for 2 h. The mouse antibodies used in the present study are listed: Foxc1 (1:1,000; cat. no. ab227977; Abcam), p65 (1:1,000; cat. no. ab32536; Abcam), IκBα (1:1,000; cat. no. ab32518; Abcam), allograft inflammatory factor 1 (Iba-1; 1:1,000; cat. no. ab178846; Abcam), IL-1β (1:1,000; cat. no. ab254360; Abcam), TNF-α (1:1,000; cat. no. ab215188; Abcam), and β-actin (1:1,000; cat. no. ab179467; Abcam), HRP-conjugated goat anti-rabbit IgG H&L secondary antibody (1:2,000; cat. no. ab7090; Abcam). Protein bands were detected using an enhanced chemiluminescence reagent (cat. no. WBKLS0100; MilliporeSigma), visualized using a Bio-Rad ChemiDoc XRS imaging system (Bio-Rad Laboratories, Inc.) and analyzed by Image J software (version no: 1.51, National Institute of Health) and normalized to that of β-actin.

The viability of BV-2 cells was evaluated using the Cell Counting Kit-8 (CCK-8; MedChemExpress) assay in accordance with the manufacturer's protocol. Briefly, the BV-2 cells with or without Foxc1 overexpression were seeded into 96-well plates (2×10⁵ cells/well) and cultured at 37°C for 12 h. After treatment with or without LPS at 37°C for 6 h, 10 ml CCK-8 solution was added into each well and cultured at 37°C for 2 h, after which the optical density of each well was determined at 450 nm using a multiplate reader.

The effect of Foxc1 on the migration of BV-2 cells was examined using Transwell chambers (pore size, 8-µm). Cells in different groups suspended in serum-free DMEM were seeded into the top chamber at a density of 3×10⁵ cells/well, whereas 500 µl complete DMEM containing 10% FBS was added to the lower chamber. The cells were allowed to migrate for 24 h at 37°C in 5% CO₂. Cells on the upper surfaces of each chamber were removed using a cotton swab, before the chambers were fixed with 4% paraformaldehyde at room temperature for 30 min followed by 0.4% crystal violet staining at room temperature for 15 min. In total, five random fields of view were counted per chamber using an inverted microscope under a light field (×40 magnification; Olympus BX51; Olympus Corporation).

The hippocampal tissues were fixed with 4% paraformaldehyde at room temperature overnight, embedded in paraffin, sliced into 40-µm sections and dewaxed at 65°C for 30 min. Sections were then incubated twice with xylene for 8 min and once for 5 min, followed by incubated three times with 100% alcohol for 5 min and once with 75% alcohol for 3 min, and rinsed with water for 5 min. Finally, slices were stained at room temperature with hematoxylin for 3 min and eosin for 25 sec, and were observed using an inverted microscope under a light field (×40 magnification; Olympus BX51; Olympus Corporation).

After tissue fixation, embedding, slicing and dewaxing as aforementioned, the antigen retrieval was performed using Improved Citrate Antigen Retrieval Solution (cat. no. P0083; Beyotime Institute of Biotechnology) at 95–100°C for 20 min. Slices were then blocked with Immunol Staining Blocking Buffer (cat. no. P0102; Beyotime Institute of Biotechnology) at room temperature for 60 min, and were incubated with primary antibodies as follows: Iba-1 (1:100; cat. no. ab178846; Abcam) at 4°C overnight.

Cells were fixed with 4% paraformaldehyde at room temperature for 15 min followed by permeabilization with 0.03% Triton X-100 and blocked with 5% BSA (cat. no. ST025; Beyotime Institute of Biotechnology) at room temperature for 30 min. They were then incubated with the Foxc1 antibody (1:100; cat. no. ab227977; Abcam) at 4°C overnight in a humidified box. Antibodies were diluted using Immunol Staining Primary and secondary Antibody Dilution Buffer (cat. nos. P0103 and P0108; Beyotime Institute of Biotechnology).

On the following morning, the cells or tissue sections were washed with 1× TBST solution (cat. no. XY51287; Shanghai Xinyu Biotechnology Co., Ltd.) and incubated with Alexa Fluor^® 647-conjugated goat anti-mouse IgG (1:100, cat. no. ab150115, Abcam) at room temperature for 1 h and labeled with DAPI (1 mg/ml; cat. no. 62247; Thermo Fisher Scientific, Inc.) at room temperature for 5 min. The fluorescence intensity was observed in three fields of view using fluorescence microscopy (×40 magnification; Olympus BX51; Olympus Corporation) and analyzed by ImageJ software.

Apoptosis was detected using the TUNEL Apoptosis Assay kit (cat. no. C1088; Beyotime Institute of Biotechnology). Briefly, after tissue fixation, embedding, slicing, dewaxing and antigen retrieval as aforementioned, 40-µm tissue sections were treated with 0.1% Triton X-100 for 10 min, and then incubated with TUNEL reagent at 37°C in the dark for 60 min. The nuclei were stained with 5 µg/ml DAPI at room temperature for 5 min. The morphological changes of apoptotic cells were observed under a fluorescence microscope in three fields of view (Olympus BX51; Olympus Corporation). Green fluorescence was considered to indicate apoptotic cells.

BV-2 cells with or with Foxc1 overexpression were seeded into 12-well plates (5×10⁵ cells/well) and cultured at 37°C for 12 hBV-2 cells were treated with or without LPS at 37°C for 6 h. Finally, IL-1β and TNF-α in supernatants were measured by ELISA kits (cat. nos. 432601 and 430907; BioLegend, Inc.) following the manufacturers' protocols.

HT-22 neuronal cells were purchased from The Cell Bank of Type Culture Collection of the Chinese Academy of Sciences to explore the effects of microglia-mediated inflammatory response on neuronal cells. HT-22 cells were routinely cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.) and 2 mM L-glutamine, penicillin (100 U/ml) and streptomycin (100 g/ml; Gibco; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO₂. HT-22 cells (1×10⁵ cells/ml) were cultured with the BV-2 cell-conditioned medium under different conditions at 37°C with 5% CO₂ for 12 h. Suspended HT-22 cells were washed twice with PBS containing 2% FBS and stained with Annexin V FITC Apop Dtec Kit (cat. no. 556547; Becton-Dickinson and Company). In brief, 100 µl binding buffer before 5 µl FITC-labelled Annexin V (20 µg/ml) and 5 µl PI (50 µg/ml) were added and incubated in the dark at room temperature for 15 min. A tube without Annexin V FITC and PI was used as Blank, whereas Annexin V or PI was used the single-standard control. In total, 400 µl binding buffer was added at the end of the experiment and then assessed by flow cytometry (CytoFlex; Beckman Coulter, Inc.). The percentage of early- and late-stage apoptotic cells was calculated using FlowJo v10 software (FlowJo, LLC).

The data are presented as the mean ± standard deviation from three independent experiments. Differences between/among groups were determined using an unpaired Student's t-test or one-way ANOVA followed by Tukey's post hoc test. A two-way ANOVA was performed for cell proliferation and a mixed ANOVA was used to analyze swimming speed and latency data from the MWM followed by Bonferroni correction for multiple testing. Statistical analyses were performed using the SPSS software (version 26.0; IBM Corp.). P<0.05 was considered to indicate a statistically significant difference.

After LPS treatment, the expression levels of Foxc1, p65 and IκBα of the NF-κB signaling pathway in microglial cells was measured by both RT-qPCR and western blot analysis. Foxc1 and IκBα expression was found to be significantly decreased, whereas that of p65 was significantly increased compared with that in the control group (Fig. 1A-E). In addition, the secretion of IL-1β and TNF-α (Fig. 1F) by BV-2 cells was next examined using ELISA, where the results showed that LPS significantly increased the secretion of IL-1β and TNF-α compared with that in the control group. Subsequently, HT-22 neurons were cultured with the media conditioned by BV-2 cells in the control or LPS-treated groups, respectively. The percentage of neuronal apoptosis was then measured by flow cytometry, which showed that the levels of HT-22 cell apoptosis in the LPS-treated BV-2 media group were significantly higher compared with those in the control group (Fig. 1G and H). These results suggest that microglia-mediated inflammatory response induced by LPS resulted in neuronal apoptosis.

After adenoviral transfection, the expression of Foxc1 in BV-2 cells with or without LPS treatment was significantly increased compared with that in the Ad-Ctrl group, according to western blotting (Fig. 2A, B, D and E), RT-qPCR (Fig. 2C) and immunofluorescence analysis observations (Fig. 2F and G). Subsequently, the expression of p65 and IκBα was measured using western blot analysis, whereas the secretion of IL-1β and TNF-α by BV-2 cells was examined by ELISA. Foxc1 overexpression significantly reduced the expression of p65 whilst upregulating the expression of IκBα compared with those in the Ad-Ctrl group in the presence of LPS (Fig. 2H and I). The secretion of IL-1β and TNF-α by BV-2 cells also exhibited a similar trend as p65, in that significant reversals of the LPS-induced upregulation in secretion were observed (Fig. 2J). HT-22 neurons were next cultured with the media conditioned by BV-2 cells in the control, Ad-Ctrl and Ad-Foxc1 groups with LPS treatment. The extent of neuronal apoptosis in the Ad-Foxc1 group was significantly lower compared with that in the Ad-Ctrl group (Fig. 2K and L). These results suggest that overexpression of Foxc1 inhibited LPS-induced inflammatory responses and neuronal apoptosis by deactivating of NF-κB signaling.

To investigate the underlying regulatory mechanism of Foxc1 on the inflammatory response, microglial migration and neuronal apoptosis induced by LPS, the effect of Foxc1 overexpression on microglial migration, NF-κB signaling and neuronal apoptosis was next investigated. Transwell assay revealed that LPS markedly increased microglial migration compared with that in the blank group (BV-2 cells without any treatment). Foxc1 overexpression significantly inhibited microglial migration compared with that in the Ad-Ctrl group in the presence of LPS (Fig. 3A and B). Subsequently, the effect of Foxc1 overexpression and LPS treatment on the viability of BV-2 cells was also evaluated using CCK-8 assay, which showed that neither Foxc1 overexpression nor LPS treatment could influence the viability of BV-2 cells (Fig. 3C and D). These results suggest that Foxc1 overexpression inhibited microglial migration induced by LPS without affecting viability. Subsequently, to determine the effect of Foxc1 overexpression on NF-κB signaling during the LPS-induced inflammatory response, the expression of IκBα in Foxc1-overexpressing BV-2 cells was knocked down using siRNA-IκBα in the absence or in the presence of LPS. Both western blot analysis and RT-qPCR results showed that the expression of IκBα in the siRNA-IκBα group was significantly decreased compared with that in the siRNA-NT (the negative silenced) group, though no significant difference could be found between the siRNA-NT and control groups (Fig. 3E-I). In addition, the expression of p65 in the siRNA-IκBα group was significantly increased compared with that in siRNA-NT group, but no significant difference could be found between the siRNA-NT and the control groups (Fig. 3H and I). Transwell assay results demonstrated that knocking down IκBα expression significantly promoted microglial migration compared with that in the siRNA-NT group (Fig. 3J and K). ELISA results revealed that the secretion of IL-1β and TNF-α by BV-2 cells were significantly increased in the siRNA-IκBα group compared with that in the siRNA-NT group (Fig. 3L). Subsequently, HT-22 neurons were cultured with the media conditioned by BV-2 cells in the control, siRNA-NT and siRNA-IκBα groups in Foxc1-overexpressing BV-2 cells treated with LPS. HT-22 cell apoptosis in siRNA-IκBα group was found to be significantly increased compared with that in siRNA-NT group, but no statistical significance was found between the siRNA-NT and control groups (Fig. 3M and N). These data suggest that Foxc1 overexpression attenuated LPS-induced inflammatory response, microglial migration and neuronal apoptosis by inhibiting IκBα/NF-κB pathway.

Establishment of the mouse septic encephalopathy model by CLP, animal behavior and molecular experiments were performed as shown in Fig. 4A. Before CLP surgery, mouse cognitive ability, including learning, memory, and spatial orientation, were evaluated using the MWM test. Results showed that the learning and memory abilities of spatial orientation were not significantly different among the four groups (Fig. S1), suggesting that Foxc1 overexpression did not alter the cognitive ability of the mice. After CLP surgery, MWM test results showed that the swimming speed exhibited no statistical difference throughout the 6 consecutive days (Fig. 4B), suggesting that neither Foxc1 overexpression nor CLP surgery affected the motor ability of the mice. However, mice in the CLP surgery group exhibited significantly longer escape latency compared with that in the sham-operated group (Fig. 4C). Dwell time in the target quadrant and the frequency of passing through the target platform area were also significantly reduced in the CLP surgery group compared with those in the sham-operated group (Fig. 4D and E). The escape latency of mice in the Foxc1 overexpression group was significantly shorter compared with that in CLP group, whereas the dwell time in the target quadrant and the frequency of passing through the target platform area were significantly increased in the Foxc1 overexpression group compared with those in the CLP group (Fig. 4C and E). This suggests that CLP surgery impaired the cognitive ability of the mice, which was partially prevented by Foxc1 overexpression. Subsequently, the mRNA expression levels of Foxc1 and IκBα in the hippocampus tissues of the mice on days 3, 7 and 14 after CLP surgery were measured by RT-qPCR, which showed that the expression levels of Foxc1 (Fig. 4F) and IκBα (Fig. 4G) were significantly reduced compared with those in the sham-operated group on days 3, 7 and 14 after CLP surgery. These in vivo results suggest that CLP resulted in cognitive impairment in addition to the downregulation of Foxc1 and IκBα expression in the hippocampus of the mice. Consequently, Foxc1 and IκBα may regulate the cognitive function of mice during inflammation.

After CLP surgery, to verify the establishment of SAE, MWM trial and H&E staining were performed. Mice in the group showed significantly longer latency and shorter dwell times in the goal quadrant compared with those in the sham-operated group (Fig. 4C-E). H&E staining demonstrated that in the CLP group, the hippocampal structure was disordered, where the nuclei of neurons were condensed and the cytoplasm were swollen (Fig. 5A). The expression of Foxc1 and IκBα in hippocampal tissue of mice were measured by western blot analysis. The expression of Foxc1 and IκBα were significantly reduced in the CLP group compared with that in the Sham group (Fig. 5B and C). Additionally, the expression of p65, a subunit in NF-κB family and Iba-1, a microglia marker, were detected by western blot analysis. The expression of both p65 and Iba-1 in the hippocampal tissues of mice were found to be significantly increased in the CLP group compared with that in the Sham group (Fig. 5D and E). Subsequent western blot analysis of IL-1β and TNF-α expression in the hippocampal tissues also showed that the expression both of these cytokines were significantly increased in the CLP group compared with that in the Sham group (Fig. 5F and G). These data suggest that NF-κB pathway may serve important roles in the hippocampal inflammatory response and microglial migration during SAE.

The expression of Foxc1 in the hippocampus of mice with or without Foxc1 overexpression before CLP surgery was assessed by western blot analysis, which revealed the success of Foxc1 overexpression in the hippocampus of mice (Fig. 6A and B). After CLP surgery, H&E staining demonstrated that the hippocampal structure appeared to be more ordered with cell volume smaller, where the extent of cytosolic edema was decreased in tissues from the Foxc1 overexpression group compared with those in the CLP group (Fig. 6C). To investigate the role of the NF-κB pathway in the hippocampal inflammatory response, microglial migration and neuronal apoptosis in mice with SAE, Foxc1-overexpressing mice were used. After CLP surgery, the expression of Foxc1 and IκBα in the hippocampus of mice were examined using western blot analysis. Results showed that the expression levels of Foxc1 and IκBα were significantly higher in the CLP + Foxc1 OE group compared with that in the CLP group (Fig. 6D and E). The effect of Foxc1 overexpression on the expression of p65, Iba-1, IL-1β and TNF-α in the hippocampus tissues of mice were next detected by western blot analysis, which showed that Foxc1 overexpression significantly inhibited the expression of p65, Iba-1, IL-1β and TNF-α in the compared with that in the CLP group (Fig. 6F-I). Subsequently, microglial migration and neuronal apoptosis in the hippocampus of mice were measured using immunofluorescence and TUNEL staining. The number of Iba-1-positive and TUNEL-positive cells were both marked increased in the CLP group compared with those in the Sham group, but the number of Iba-1-positive and TUNEL-positive cells in the CLP + Foxc1 OE group were both markedly decreased compared with those in the CLP group (Fig. 6J-L). These results suggest that Foxc1 overexpression can inhibit microglial migration, inflammation and neuronal apoptosis in the hippocampus of mice with SAE through the NF-κB pathway.