The ectopic expression of insulin-like growth factor 2 mRNA-binding protein 2 (IGF2BP2) has been demonstrated to facilitate tumorigenesis and induce proliferation in a various types of cancer. However, the role of IGF2BP2 in esophageal squamous cell carcinoma (ESCC) has yet been fully elucidated. In this regard, the current study assessed the expression patterns and clinical significance of IGF2BP2 in 94 Chinese patients diagnosed with ESCC. Immunohistochemistry and reverse transcription-quantitative PCR assays were employed to assess IGF2BP2 expression in ESCC tissues compared with adjacent healthy tissues. The results revealed that the protein expression of IGF2BP2 was substantially upregulated in ESCC tissues compared with adjacent ESCC tissues. More specifically, higher IGF2BP2 expression strongly associated with tumor node metastasis stage, lymphatic infiltration and lymph node metastasis. Using two ESCC cell lines (TE-1 and TE-10), the inhibition of IGF2BP2 expression by small interfering RNA was proven to induce apoptosis and suppress proliferation, migration and cell cycle progression
Esophageal cancer (EC) has been described as the seventh most frequently diagnosed tumor (
A previous study reported that insulin-like growth factor-2 mRNA-binding protein 2 (IGF2BP2) is a crucial oncogenic protein, functioning as a tumor promoter via post-transcriptional regulation of gene expression. IGF2BP2 is implicated in the stabilization, localization and trafficking of target mRNAs involved in carcinogenesis and cancer cell proliferation (
In the present study, the association between IGF2BP2 expression at the protein level and the clinicopathological features of patients with ESCC was studied. The effects of IGF2BP2 knockdown on proliferation, migration and apoptosis were examined
A total of 94 Chinese patients with ESCC (females, 28; males, 66), aged 33-78 years with an average age of 56 years old, gave their written consent to participate in the present study at the Second People's Hospital of Changshu. The inclusion criteria for participation included: i) A diagnosis of esophageal squamous carcinoma via gastroscopy and pathological examination; and ii) no evidence of serious organ dysfunction in the heart, brain, liver, lung and kidney. Patients were excluded for the current study if they: i) Could not tolerate surgery due to severe heart disease; ii) had other serious systemic diseases, such as later stage uremic syndrome; and iii) exhibited esophageal perforation or bleeding. Specimens of human ESCC tissues (n=36) with adjacent tissues of ESCC (n=36) and accompanying normal tissues of esophagus (n=15) were collected from the same patients. Adjacent ESCC tissues were obtained ~20 mm from the primary ESCC tumor, and normal esophagus tissues were obtained ≥50 mm from the ESCC tumor site. The three types of tissues were further identified by an experienced pathologist (JQ) based on their cell morphology and tissue characteristics. The clinicopathological tumor stage was evaluated according to the World Health Organization (WHO) and the Union for International Cancer-Control staging guidelines using tumor, nodes and metastasis (TNM) systems of classification (
Based on a protocol of epitome retrieval (
Considering the percentage of positive cells and the intensity of staining, which were determined using Image J software (Java 1.8.0.172; National Institutes of Health), the IHC score was divided into values as follows: 0 (negative), indicating that the whole tissue mass was <10% stained; +1 (weakly positive), indicating that the tissue mass was 10-25% stained; +2 (moderately positive), indicating that the tissue mass exhibited 25-50% positive staining; and +3 (strongly positive), indicating that the tissue mass exhibited >75% positive staining (
Human esophageal cancer cell lines (TE-1 and TE-10) were obtained from Cloud-Clone Corp. TE-1 and TE-10 culture medium consisted of DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.), streptomycin sulfate (100 units/ml) and penicillin G (100 units/ml; Gibco; Thermo Fisher Scientific, Inc.). The cells were incubated at 37˚C in humidified conditions and 5% CO2.
For transfection, TE-1 and TE-10 cells were grown in six-well culture plates until confluence (70-80%). Transfection of siRNA1 (sense, CCGUUGUCAACGUCACCUAUA; antisense, UAUAGGUGACGUUGACAACGG) and siRNA2 (sense, CCUUGCAGGAUUUGAGCAUUU; antisense, AAAUGCUCAAAUCCUGCAAGG) (Wuhan GeneCreate Biological Engineering Co., Ltd.) was performed with Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37˚C for 4 h, with 20 nM small interfering RNA negative control (siRNA-NC, sense, UUCUCCGAACGUGUCACGUTT; antisense, ACGUGACACGUUCGGAGAATT; Wuhan GeneCreate Biological Engineering Co., Ltd.). After transfection for 48 h, subsequent experiments were performed.
Total RNA from TE-1 and TE-10 cells, was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) in accordance with the manufacturer's instructions, respectively. Reverse Transcription kit (cat. no. 4366596; TaqMan™; Jiangsu Hongyao Biological Technology Co., Ltd.) was used to synthesize complementary DNA prior to qPCR. The primer sequences are listed in
WB was used to visualize IGF2BP2 protein expression after TE-1 and TE-10 transfection with siRNA-NC and siRNA-IGF2BP2. To lyse cells, samples were treated with 1 ml RIPA buffer (Thermo Fisher Scientific, Inc.) and 100 µl PMSF (10 mM) at 4˚C for 30 min. Cell lysates were then collected and centrifuged at 10,000 x g for 5 min at 4˚C to obtain total protein. The concentration of protein was subsequently detected using a BCA kit (cat. no. P0011; Beyotime Institute of Biotechnology) and diluted to 10 µg/l. Diluted protein (4 µl) was added with 1 µl 5X loading buffer, mixed and boiled for 4 min at 100˚C. Protein samples (50 ng) of each group, including TE-1 and TE-10 cells transfected with siRNA-NC and siRNA-IGF2BP2, were then separated using 8% SDS-PAGE. Subsequently, proteins were transferred to PVDF membranes. Ponceau S staining was applied to confirm protein transfer to PVDF membrane at room temperature, after which 10% BSA and 0.05% Tween-20 in TBS was used to block the membranes at room temperature for 1 h. Subsequently, the membranes were incubated overnight at 4˚C with the following rabbit-derived primary antibodies: Anti-IGF2BP2 (1:2,000; cat. no. ab124930; Abcam) and anti-GAPDH (1:2,500; cat. no. ab9485; Abcam). After washing the membrane with TBST three times every 5 min, the membranes were incubated with HRP-conjugated goat-derived rabbit IgG antibody (1:2,000; cat. no. ab6721; Abcam) for 1 h at room temperature. Finally, after washing the membrane with TBST three times, the membranes were visualized using an Ultra High Sensitivity ECL kit (cat. no. GK10008; Gibco) and imaged with ChemiScope 3600 mini (Clinx; magnification, x10) in a dark room. GAPDH was used as an internal control and densitometry was performed using Image J (Java 1.8.0.172).
TE-1 and TE-10 cells were seeded at a density of 1,000 cells per well in the six-well-plate and transfected with siRNAs, then incubated for 10 days at 37˚C with 5% CO2. The cells were then fixed with 4% paraformaldehyde at room temperature for 30 min and stained with 1% crystal violet at room temperature for 20 min. Next, colonies with a diameter >20 µm cells were recorded and imaged with a light microscope (Nikon Corporation; Ti-U; magnification, x200).
A total of ~1x106 TE-1 and TE-10 cells were harvested, washed with PBS and suspended in 0.5 ml PBS. Monodispersed cell suspensions were then obtained via a gentle vortex step with minimum clumping of cells. After overnight fixation of the cells in cold ethanol (70%) at 4˚C, centrifugation of the cells suspended in ethanol was performed for 5 min at 300 x g and 4˚C before careful discarding the supernatant. PBS was subsequently used to wash the samples twice before resuspension in RNase (20 µg/ml) and PI (50 µg/ml) in PBS for 30 min at room temperature, to ensure that only DNA and not RNA was stained. Subsequently, the analysis of stained cells was performed via flow cytometric analysis (BD LSRFortessa™; Beckman Coulter, Inc.) and analyzed by Flow Jo V10 (FlowJo LLC).
TE-1 and TE-10 cell lines transfected with siRNA in addition to blank control groups were seeded in six-well plates at a density of 2x105 cells/well with DMEM supplemented with 10% FBS and 1% penicillin-streptomycin. A scratch was introduced when the cell confluence reached ~80%. After washing the cells twice with PBS, samples were incubated in DMEM supplemented with 1% PS only. Wound healing assay images were recorded automatically every 4 h. An inverted fluorescence microscope (Nikon Corporation; Ti-U; magnification, x200) was used to monitor cell migration at 0, 12, 24 and 48 h after introducing the scratch. Images were analyzed using Image J (Java 1.8.0.172; National Institutes of Health).
Cell proliferation was assayed after the inhibition of IGF2BP2 expression in TE-1 and TE-10 cells using a CCK-8 Cell Proliferation and Cytotoxicity Assay kit (cat. no. CA1210; Beijing Solarbio Science & Technology Co., Ltd.). A total of 5x103 cells per ml were inoculated into a 96-well plate (100 µl per well) and divided into ‘control’ and ‘IGF2BP2 siRNA’ groups. At different time points, including 0, 24 and 48 h, CCK-8 (10 ml) was added to each well carefully to avoid the introduction of bubbles, after which plates were stored in an incubator for 2 h at 37˚C. Subsequently, a microplate reader was employed to measure the absorbance value at 450 nm in triplicate.
Harvested TE-1 and TE-10 cells were washed in PBS, after which 1x106 cells were resuspended and stained using Dead Cell Apoptosis Kit with Annexin V FITC and PI (V13242, Thermo Fisher) according to the standard protocol. Cell apoptosis was analyzed through flow cytometry (BD FACSCelesta™; BD Biosicences). The intensity of FITC/Annexin V fluorescence was analyzed using FlowJo V10 software (FlowJo LLC) and presented on the x-axis, while PI (screened using phycoerythrin) was plotted on the y-axis. FITC/PI denoted living cells, FITC+/PI indicated early apoptotic cells, FITC+/PI+ represented late apoptotic cells and FITC/PI+ depicted necrotic cells.
Senescence in siRNA transfected and blank control cell cultures was detected using the Cellular Senescence Detection kit (Beiyi Bioequip Information Co., Ltd.) in accordance with the supplier's instructions. A total of 2x104 cells per ml were seeded in six-well plates at 2 ml per well and cultured for 2 days at 37˚C. The cells were washed with PBS and fixed with 4% paraformaldehyde for 30 min at room temperature. The cells were subsequently washed with PBS twice, after which 1 ml SA-β-gal staining solution was added prior to incubation at 37˚C for 15 min. After blue coloring was fully developed, cells were washed twice with PBS. A single drop of mounting medium was added before cover glasses were placed atop the six-well plate. SA-β-gal-blue positive cells were counted using an inverted fluorescence microscope (Nikon Corporation; Ti-U; magnification, x200).
Analysis of proliferating TE-1 and TE-10 cells after treatment with siRNA-IGF2BP2 or siRNA-NC was carried out using the BeyoClick™ EdU cell proliferation kit with Alexa Fluro 488 (Beyotime Institute of Biotechnology) based on the manufacturer's protocol. Subsequently, EdU (10 mM) was added to cells after transfection, after which samples were incubated at 37˚C for 2 h. Cells were then fixed for 30 min at room temperature with standard formaldehyde (4%) and permeabilized with Triton X-100 (0.5%) prior to staining at room temperature for 0.5 h with a Ultra High Sensitivity ECL kit. DAPI (5 mg/ml) was applied for 15 min to stain cell nuclei at room temperature before observation using a fluorescent microscope (Nikon Corporation; Ti-U; magnification, x200).
All data are presented as the mean ± SD, and at least three independent experiments were performed. The construction of graphs and the statistical analysis of data was performed using χ2 test and one-way ANOVA followed by Dunnett's post hoc test, with GraphPad Prism 6.0 (GraphPad Inc.) and SPSS 17.0 (SPSS, Inc.) software, respectively. P<0.05 was considered to indicate a statistically significant difference.
IHC staining was performed to determine IGF2BP2 expression levels in 94 specimens of human ESCC tissues, which are listed in
The association between IGF2BP2 and the clinicopathological characteristics of patients with ESCC was assessed. χ2 test analysis revealed a significant association between IGF2BP2 expression, tumor differentiation (P=0.038), TNM stages (P=0.018), lymph node metastasis (P<0.001) and lymphatic infiltration (P<0.001). Non-significant differences were observed in sex (P=0.379) and age (P=0.775;
IGF2BP2 mRNA levels in TE-1 and TE-10 cell lines were quantified by performing RT-qPCR. As presented in
To study the effect of IGF2BP2 in ESCC cell proliferation, a CCK-8 assay was performed to investigate the viability of siRNA-transfected TE-1 and TE-10 cells. As indicated in
Since IGF2BP2 was highly expressed in lymphatic infiltration metastasis of ESCC tissues (
Flow cytometry assays were performed to determine whether IGF2BP2 could regulate cell cycle progression in TE-1 and TE-10 cells after transfection with two siRNA-IGF2BP2s or siRNA-NC. The percentage of cells at distinct phases is indicated in
ESCC is a commonly diagnosed cancer of the digestive system, and concerns have been growing worldwide owing to its high incidence and mortality rate, in developing nations such as China or India (
As an RNA-binding protein, IGF2BP2 has been revealed to post-transcriptionally drive the progression of cancer cells through its ability to regulate the trafficking, localization, stabilization and translation of mRNAs involved in important aspects of cellular functions (
Autoantibodies against tumor-associated antigen (IGF2BP2/p62) have been revealed to increase as ESCC progresses (
A previous study demonstrated that miR-141 silencing induced the upregulation of IGF2BP2, which promoted pancreatic cancer cell proliferation and survival through the PI3K/AKT signaling pathway (
The present work aimed to determine the expression profile of IGF2BP2 in ESCC and its association with the clinicopathological features of patients with ESCC. RT-qPCR analysis revealed that IGF2BP2 expression levels were elevated in ESCC tissues, while loss of function demonstrated that IGF2BP2 downregulation promoted ESCC cell apoptosis and suppressed cell proliferation and migration. The results of the present study may provide a valuable insight into the expression of IGF2BP2 in ESCC cell progression and may help to develop novel therapeutic approaches for ESCC diagnosis and therapy.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
FL conceived the manuscript. FL, WC and TJ conceptualized and designed the experiments. BW, ZL, GH and JQ performed the experiments. JQ, WW, MY and XH analyzed the data. FL, WC, TJ and BW contributed reagents, materials and analysis tools. FL, TJ, CC and BW drafted the manuscript. CC collected and verified patient raw data. WC and TJ confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.
Review and approval for the current study was obtained by the Ethical committee of Changshu Second People's Hospital at Jiangsu Province. Patients provided their written informed consent to participate in the present study.
Not applicable.
The authors declare that they have no competing interests.
Analysis of IGF2BP2 expression using IHC. Images of (A) Normal esophageal, (B) adjacent ESCC and (C) ESCC tissue are presented (magnification, x400). (D) IHC staining comparing the intensity of IGF2BP2 staining in 36 ESCC tissues, 36 adjacent ESCC tissues and 15 normal esophageal tissues. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; IHC, immunohistochemistry; ESCC, esophageal-squamous cell carcinoma.
Analysis of IGF2BP2 expression using RT-qPCR and western blotting. (A) The relative mRNA expression of IGF2BP2 was detected via RT-qPCR in ESCC cell lines (TE-1 and TE-10). The transfection efficiency of each siRNA targeting IGF2BP2 was assessed in (B) TE-1 and (C) TE-10 cell lines by western blotting. One-way ANOVA followed by Dunnett's post hoc test were performed to analyze data. **P<0.01 vs. control group. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; RT-qPCR, reverse transcription-quantitative PCR; ESCC, esophageal-squamous cell carcinoma; siRNA, small interfering RNA.
IGF2BP2 expression knockdown decreases esophageal-squamous cell carcinoma cell viability, as determined by using a Cell Counting Kit-8 assay. Quantitative analysis of optical density values was performed in (A) TE-1 and (B) TE-10 cell lines treated with siRNA-IGF2BP2 or siRNA-control. Cell viability was determined at 24 and 48 h. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; siRNA, small interfering RNA.
IGF2BP2 modulates esophageal-squamous cell carcinoma colony formation. Quantitative analysis of (A) TE-1 and (B) TE-10 colony numbers after transfection with siRNAs targeting IGF2BP2 or siRNA-control. IGF2BP2 knockdown in (C) TE-1 and (D) TE-10 cells significantly decreased colony formation. One-way ANOVA followed by Dunnett's post hoc test was performed to analyze data. **P<0.01 vs. control group. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; ESCC, esophageal-squamous cell carcinoma; siRNA, small interfering RNA.
Senescence and proliferation assays. SA-β-gal-positive cells were counted inTE-1 (A) and TE-10 (B) cell lines. Senescence was decreased inTE-1 (C) and TE-10 (D) cells treated with siRNA1 and siRNA2 targeting IGF2BP2 that were labeled with EdU or DAPI, when compared with the control group. One-way ANOVA followed by Dunnett's post hoc test was performed to statistically analyze data. **P<0.01 vs. control group. SA-β-gal, senescence-associated β-galactosidase; EdU, 5-ethynyl-2'-deoxyuridine; IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; siRNA, small interfering RNA.
Esophageal-squamous cell carcinoma cell migration following treatment with siRNA-IGF2BP2 or siRNA-control, as analyzed using wound healing assays. Respective images of wound healing in (A) TE-1 and (B) TE-10 cells treated with siRNA-IGF2BP2 or siRNA-control are presented. Light microscope images were obtained at 12, 24 and 48 h after the scratch was introduced. Corresponding wound width data of (C) TE-1 and (D) TE-10 cells is presented. Scale bar, 100 µm. One-way ANOVA followed by Dunnett's post hoc test was performed to statistically analyze the data. *P<0.05 vs. control group. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; siRNA, small interfering RNA.
IGF2BP2 is required for cell cycle progression. Cell cycle distribution of esophageal-squamous cell carcinoma cells transfected with siRNA-control or siRNA-IGF2BP2 was assessed by performing flow cytometry in (top) TE-1 and (bottom) TE-10 cells. Transfection with siRNA-IGF2BP2 significantly reduced cell growth compared with the siRNA-control. One-way ANOVA followed by Dunnett's post hoc test was performed to statistically analyze data. *P<0.05 and **P<0.01 vs. control group. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; siRNA, small interfering RNA.
Detection of apoptosis by Annexin V/PI staining in esophageal-squamous cell carcinoma cells transfected with siRNA-control or siRNA-IGF2BP2. (A) Flow cytometry plots were produced and (B) the percentage of apoptotic cells was determined in the TE-1 cell line. Flow cytometry plots were produced and the percentage of apoptotic cells was assessed in the TE-10 cell line. IGF2BP2 knockdown induced the apoptosis of TE-1 and TE-10 cells. One-way ANOVA followed by Dunnett's post hoc test was performed to statistically analyze data. **P<0.01 vs. control group. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; siRNA, small interfering RNA.
Primer sequences of reverse transcription-quantitative PCR.
Gene | Forward primer sequence (5'-3') | Reverse primer sequence (5'-3') |
---|---|---|
GAPDH | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
IGF2BP2 | GGCTCCCTGATCTGGTTAAGGA | CCACTTCCATTCTGATGACCAGC |
IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2.
Association between insulin-like growth factor 2 mRNA-binding protein 2 protein expression and clinicopathological features of esophageal squamous cell carcinoma.
Insulin-like growth factor 2 mRNA-binding protein 2 protein expression | |||||
---|---|---|---|---|---|
Variable | Number of cases | Median (P25, P75) | Low (score; 0 or 1), n | High (score; 2 or 3), n | P-value |
Sex | 0.379 | ||||
Male, n | 66 | 3 (1, 3) | 20 | 46 | |
Female, n | 28 | 3 (2, 3) | 6 | 22 | |
Age | 0.775 | ||||
<64 | 52 | 3 (1, 3) | 15 | 37 | |
≥64 | 42 | 3 (1, 3) | 11 | 31 | |
Degree of tumor differentiation | 0.038 | ||||
High | 20 | 1.5 (1, 3) | 10 | 10 | |
Middle | 47 | 3 (2, 3) | 11 | 36 | |
Low | 27 | 3 (2, 3) | 5 | 22 | |
Tumor, node and metastasis staging | 0.018 | ||||
I-II | 62 | 2 (1, 3) | 22 | 40 | |
III-IV | 32 | 3 (2, 3) | 4 | 28 | |
Lymph node metastasis | <0.001 | ||||
Positive | 38 | 3 (3, 3) | 3 | 35 | |
Negative | 56 | 2 (1, 3) | 23 | 33 | |
Lymphatic infiltration | <0.001 | ||||
Positive | 43 | 3 (2, 3) | 4 | 39 | |
Negative | 51 | 2 (1, 3) | 22 | 29 |