Aspirin reduces the liver fibrosis index and inflammation in patients and rats. However, the specific mechanism underlying the effects of aspirin are yet to be elucidated. The present study aimed to investigate the effects of aspirin on thioacetamide (TAA)-induced liver fibrosis in rats and hepatic stellate cells (HSCs) via the TGF-β1/Smad signaling pathway. Liver fibrosis was induced in Sprague Dawley rats by intraperitoneal injection of 200 mg/kg TAA twice weekly for 8 weeks. Aspirin (30 mg/kg) was administered to rats by gavage once every morning over a period of 8 weeks. Masson's trichrome and H&E staining were used to detect and analyze the pathological changes in liver tissues. Western blot analysis and immunohistochemistry were applied to determine the protein expression levels of α-smooth muscle actin (α-SMA), collagen I, TGF-β1, phosphorylated (p)-Smad2 and p-Smad3. In addition, reverse transcription-quantitative PCR was performed to detect the mRNA expression levels of α-SMA, collagen type I α 1 chain (COL1A1) and TGF-β1. The results demonstrated that treatment with aspirin significantly reduced the serum levels of alanine aminotransferase, aspartate aminotransferase and hydroxyproline in the TAA + aspirin compared with that in the TAA group. In the rat liver fibrosis model, pathological changes in liver tissues were improved following treatment with aspirin. Similarly, a marked decrease was observed in protein expression levels of α-SMA, collagen I, TGF-β1, p-Smad2 and p-Smad3. Furthermore, aspirin administration decreased the mRNA levels of α-SMA, COL1A1 and TGF-β1. In addition, HSCs were treated with different concentrations of aspirin (10, 20 and 40 mmol/l), and the protein expression levels of α-SMA, collagen I, TGF-β1, p-Smad2 and p-Smad3 were reduced in a dose-dependent manner. Overall, the present study showed that aspirin attenuated liver fibrosis and reduced collagen production by suppressing the TGF-β1/Smad signaling pathway, thus revealing a potential mechanism of aspirin in the treatment of liver fibrosis.
Liver fibrosis is the result of a healing response to a variety of injury factors, such as chronic hepatitis, cholestasis, alcohol and drugs. It has been reported that liver fibrosis serves a significant role in the development of liver cirrhosis and liver cancer (
TGF-β1 plays an important role in liver fibrosis (
Aspirin is a common non-steroidal anti-inflammatory drug, also known as acetylsalicylic acid; it is most commonly used to decrease fever, relieve pain and attenuate inflammatory responses (
Therefore, in the present study, a rat model of hepatic fibrosis was established by intraperitoneal injection of thioacetamide (TAA) to evaluate the antifibrotic effect of aspirin. In addition, the study further explored whether aspirin could attenuate liver fibrosis through the TGF-β1/Smad signaling pathway and the effects of aspirin on HSC collagen production, thus uncovering the molecular mechanism underlying the protective effect of aspirin against liver fibrosis. The results of the present study may provide further knowledge for the use of aspirin in the treatment of hepatic fibrosis.
TAA was obtained from MilliporeSigma, while aspirin was purchased from Bayer AG.
A total of 30 healthy male Sprague-Dawley (SD) rats (age, 6 weeks), weighing 200–220 g, were obtained from the Experimental Animal Center of the Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China). The animals were maintained under a 12 h light/dark cycle at room temperature (20–25°C) and a humidity of 50–60%. All animals had free access to food and water. The animal experiments were approved by the Ethics Committee of Animal Experiments of the Tongji Medical College (Wuhan, China; approval no. TJ-A20150803).
The rat HSC line, HSC-T6 (cat. no. CL-0116), was purchased from the Shanghai Institute of Biochemistry and Cell Biology, and was cultured in high-glucose DMEM supplemented with 10% FBS (both from Gibco; Thermo Fisher Scientific, Inc.), 100 µg/ml penicillin and 100 µg/ml streptomycin (Beyotime Institute of Biotechnology) at 37°C in a 5% CO2 incubator. HSCs were treated with different concentrations of aspirin (10, 20 and 40 mmol/l) at 37°C for 72 h, as previously described (
Serum was isolated from rat blood samples at 1,200 × g for 5 min at 4°C and the serum levels of aspartate transaminase (AST) and alanine transaminase (ALT) were measured using the corresponding AST (cat. no. C010-2-1; Nanjing Jiancheng Bioengineering Institute) and ALT (cat. no. C009-2-1; Nanjing Jiancheng Bioengineering Institute) commercial kits, according to the manufacturer's instructions. The levels of hepatic hydroxyproline were measured using a hydroxyproline test kit (cat. no. A030-2-1; Nanjing Jiancheng Bioengineering Institute), according to the manufacturer's protocol.
SD rats were randomly divided into four groups (n=7/group). Rats in the TAA and TAA + aspirin groups received 200 mg/kg intraperitoneal TAA twice weekly for 8 weeks, while 1 ml physiological saline and 1 ml aspirin (30 mg/kg), respectively, were administered by gavage once every morning for 8 weeks (
Liver tissues were fixed in 4% paraformaldehyde solution at 4°C for 24 h and embedded in paraffin. Paraffin-embedded tissue samples were cut into 4-µm thick sections followed by staining with H&E (hematoxylin 5 min, eosin 3 min) and Masson's trichrome (Wuhan Servicebio Technology Co., Ltd.) for 15 min at room temperature according to the manufacturer's protocol. Subsequently, the tissue sections were deparaffinized with xylene and rehydrated in gradient ethanol at room temperature. For antigen retrieval, the tissue was boiled in a microwave for 15 min and washed with PBS. The tissue sections were blocked with 10% bovine serum albumin (Beijing Dingguo Changsheng Biotechnology Co., Ltd.) for 15 min at room temperature and were then incubated overnight at 4°C with the following primary antibodies: Rabbit anti-TGF-β1 (dilution 1:1,000; cat. no. 21898-1-AP; Wuhan Sanying Biotechnology), rabbit anti-collagen I (dilution 1:500; cat. no. ab34710; Abcam), rabbit anti-α-smooth muscle actin (α-SMA) (dilution, 1:500; cat. no. ab32575; Abcam), rabbit anti-phosphorylated (p)-Smad2 (dilution 1:500; cat. no. 3108; Cell Signaling Technology, Inc.) and rabbit anti-p-Smad3 (dilution 1:500; cat. no. 1880-1; Epitomics; Abcam). Following rinsing in PBS, the tissue sections were incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG (1:500; cat. no. PV-9001; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.) secondary antibody for 1 h at 37°C, followed by staining with 0.05% diaminobenzidine for 90 sec and counterstaining with hematoxylin for 5 min at room temperature. Finally, the tissue sections were dehydrated again in gradient ethanol and mounted with neutral rubber (
Total protein was extracted from liver tissue and HSCs using RIPA buffer supplemented with protease inhibitors (Beyotime Institute of Biotechnology). The protein concentration was measured using BCA and 40 µg protein/lane was separated by SDS-PAGE on a 8–10% gel and then transferred onto a PVDF membrane. Following blocking with 5% skimmed milk in TBS at room temperature for 1 h, the membranes were incubated overnight at 4°C with the following primary antibodies: Rabbit anti-TGF-β1 (dilution 1:500; cat. no. 21898-1-AP; Wuhan Sanying Biotechnology), rabbit anti-collagen I (dilution, 1:500; cat. no. ab34710; Abcam), rabbit anti-α-SMA (dilution 1:500; cat. no. ab32575; Abcam), rabbit anti-p-Smad2 (dilution 1:1,000; cat. no. 3108; Cell Signaling Technology, Inc.), rabbit anti-Smad2 (dilution 1:500; cat. no. 1641-1), rabbit anti-p-Smad3 (dilution, 1:1,000; cat. no. 1880-1) and rabbit anti-Smad3 (dilution, 1:500; cat. no. 1735-1) (all from Epitomics; Abcam) and rabbit anti-β-actin (dilution 1:1,000; cat. no. sc-47778; Santa Cruz Biotechnology, Inc.). Following washing with TBS containing 0.1% Tween-20, the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibodies (dilution 1:5,000; cat. no. ZB-5301; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.) for 1 h at room temperature. The immunoreactive bands were visualised using an ECL reagent (Thermo Fisher Scientific, Inc.) and detected using the ChemiDoc™ Imaging System (Bio-Rad Laboratories, Inc.).
Total RNA was extracted from liver tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). A SMA2000 spectrophotometer (Thermo Fisher Scientific, Inc.) was used to measure RNA absorbance at 260 nm. Next, the PrimeScript® RT reagent kit (Takara Biotechnology Co., Ltd.) was used for reverse transcription. The transcriptional conditions were 37°C for 15 min and 98°C for 5 min, followed by maintenance at 4°C. qPCR was performed using the SYBR Green PCR Master Mix-PLUS kit (Toyobo Life Science) on the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Laboratories, Inc.). Each 20-µl reaction contained 10 µl SYBR Green Mix, 6 µl nuclease-free H2O, 2 µl cDNA, 1 µl upstream primer and 1 µl downstream primer. The thermocycling conditions for qPCR were as follows: Initial denaturation at 95°C for 60 sec, followed by 40 cycles of 95°C for 15 sec, 60°C for 15 sec and extension at 72°C for 45 sec. The primer sequences were synthesized by Sangon Biotech Co., Ltd. The relative mRNA expression levels were calculated with the 2−ΔΔCq method (
All experimental data are expressed as the mean ± SEM of three independent experiments. Comparisons among multiple groups were performed with one-way ANOVA followed by Tukey's post hoc test. All graphs were constructed by GraphPad Prism 5.0 software (GraphPad Software, Inc.). All statistical analyses were performed using SPSS 22.0 software (IBM Corp.). P<0.05 was considered to indicate a statistically significant difference.
The livers in the sham and aspirin groups of the
To explore the mechanisms underlying the effect of aspirin on inhibiting liver fibrosis, the protein expression levels of TGF-β1, p-Smad2, p-Smad3, Smad2 and Smad3 were determined by western blotting and IHC staining (
To further investigate whether the antifibrotic effect of aspirin was triggered by regulating the TGF-β1/Smad signaling pathway in HSCs, HSCs were treated with different concentrations of aspirin. As shown in
Liver fibrosis, characterized by increased deposition of ECM, is the repair and healing process during liver injury caused by various factors (
Within the present study, a rat model of liver fibrosis was established using TAA. A previous study demonstrated that the liver morphology and function in TAA-induced liver fibrosis rats is similar to that in humans (
Emerging evidence has suggested that the activation of HSCs plays an important role in liver fibrosis. Once the liver is injured, quiescent HSCs are activated and differentiate into myofibroblasts, which express high levels of α-SMA, collagen I and collagen III, thus resulting in an increased deposition of ECM and the development of liver fibrosis (
A recent study showed that aspirin downregulated TGF-β1 in a carbon tetrachloride-induced chronic liver injury model (
Aspirin alleviated TAA-induced liver fibrosis in rats. Therefore, treatment with aspirin reduced the secretion of TGF-β1 by activated HSCs and Kupffer cells, thus resulting in p-Smad2, p-Smad3, α-SMA and collagen I downregulation by the TGF-β1/Smad signaling pathway. Additionally, reduction of TGF-β1 reduced the activation of HSCs and myofibroblasts and attenuated ECM production (
The present study contains some limitations. First, the results showed that aspirin alleviated TAA-induced liver fibrosis in rats. However, there are also other liver fibrosis models with different underlying mechanisms, such as the bile duct ligation-induced liver fibrosis model. Therefore, the mechanism underlying the antifibrotic effect of aspirin should be also investigated in such models. Second, a previous study indicated that aspirin activates AMP-activated protein kinase and upregulates Smad 6 in FOP fibroblast cells (
In summary, the present study suggested that aspirin could exert a potential protective role against liver fibrosis. The present study was the first to demonstrate that aspirin could ameliorate TAA-induced liver fibrosis by inhibiting the TGF-β1/Smad signaling pathways. These results indicated that aspirin could provide novel insights into the development of new drugs for the prevention and treatment of liver fibrosis. Furthermore, the safety of aspirin in clinical practice and other mechanisms remain to be studied.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
YS and BL designed and performed the experiments, designed the figures and drafted the manuscript. JXie, XJ, BX and XH performed the experiments. JXia designed the experiments, analyzed the data, and critically revised the manuscript for important intellectual content. All authors read and approved the final manuscript. YS and JXia confirm the authenticity of all the raw data.
All animal experiments were approved by the Ethics Committee of Animal Experiments of the Tongji Medical College (approval no. TJ-A20150803).
Not applicable.
The authors declare that they have no competing interests.
Aspirin ameliorates TAA-induced liver fibrosis. (A) Representative images of liver fibrosis in the rat model. (B) Liver fibrosis was detected by H&E and Masson's trichrome staining. The red arrow indicates a damaged hepatic lobule structure, the blue arrow indicates a fat vacuole and the black arrow indicates a fiber cord (magnification, ×200; scale bar, 50 µm). (C) The serum levels of aspartate transaminase and alanine transaminase were detected to evaluate liver function. (D) Aspirin decreased the content of liver hydroxyproline (n=7). *P<0.05 vs. sham group; #P<0.05 vs. TAA group. TAA, thioacetamide; AST, aspartate transaminase; ALT, alanine transaminase; MT, Masson's trichrome.
Aspirin downregulates collagen I and α-SMA in TAA-induced liver fibrosis. (A) The protein expression levels of collagen I and α-SMA were detected in liver tissue by western blot analysis. The relative protein expression of (B) collagen I and (C) α-SMA. The mRNA expression levels of (D) COL1A1 and (E) α-SMA were measured by quantitative PCR. (F) Immunohistochemical staining of collagen I and α-SMA (magnification, ×400; scale bar, 200 µm). The positive staining area was analyzed using Image-Pro Plus 6.0 (n=7). *P<0.05 vs. sham group; #P<0.05 vs. TAA group. COL1A1, collagen type I α 1 chain; α-SMA, α-smooth muscle actin; TAA, thioacetamide.
Aspirin regulates the TGF-β1/Smad2/Smad3 signaling pathway. (A) The protein expression levels of TGF-β1, p-Smad2, p-Smad3, Smad2 and Smad3 in the liver tissues were determined by western blot analysis. The relative protein expression of (B) TGF-β1, (C) p-Smad2 and (D) p-Smad3. (E) The mRNA expression levels of TGF-β1 were detected by quantitative PCR. (F) Immunohistochemical staining of TGF-β1, p-Smad2 and p-Smad3 (magnification, ×400; scale bar, 200 µm). The positive staining area was analyzed by Image-Pro Plus 6.0 (n=7). *P<0.05 vs. sham group; #P<0.05 vs. TAA group. p-, phosphorylated; TAA, thioacetamide.
Effect of different concentrations of aspirin on the protein expression levels of α-SMA, collagen I, TGF-β1, p-Smad2 and p-Smad3 in HSCs derived from rats. (A) The protein expression levels of TGF-β1, collagen I, α-SMA, p-Smad2, p-Smad3, Smad2 and Smad3 in HSCs were determined by western blot analysis. (B-F) The relative protein expression of (B) TGF-β1, (C) collagen I, (D) α-SMA, (E) p-Smad2 and (F) p-Smad3. *P<0.05 vs. control. p-Smad2, phosphorylated Smad2; HSC, hepatic stellate cell; p-, phosphorylated; α-SMA, α-smooth muscle actin.
Schematic diagram illustrating the mechanism underlying the protective effect of aspirin against liver fibrosis through suppression of the TGF-β1/Smad2/Smad3 signaling pathway. HSC, hepatic stellate cell; TAA, thioacetamide; α-SMA, α-smooth muscle actin; RI, TGF-β receptor I; RII, TGF-β receptor II; ECM, extracellular matrix.
Primer sequences for quantitative PCR.
Gene | Sequence (5′-3′) | Product size, bp |
---|---|---|
COL1A1 | 251 | |
Forward | GAGAGAGCATGACCGATGGA | |
Reverse | CGTGCTGTAGGTGAATCGAC | |
α-SMA | 148 | |
Forward | TGTGCTGGACTCTGGAGATG | |
Reverse | GAAGGAATAGCCACGCTCAG | |
TGF-β1 | 72 | |
Forward | CGGACTACTACGCCAAAGAAGT | |
Reverse | TGGTTTTGTCATAGATTGCGTT | |
GAPDH | 124 | |
Forward | GACATCAAGAAGGTGGTG | |
Reverse | CAGCATCAAAGGTGGAAG |
α-SMA, α-smooth muscle actin; COL1A1, collagen type I α 1 chain.