Dr Guoqiang Qian, College of Traditional Chinese Medicine, Guangdong Pharmaceutical University, 280 Waihuan East Road, Guangzhou, Guangdong 510006, P.R. China
Late-stage carotid atherosclerosis has a high incidence rate and may lead to various cerebrovascular diseases. The gene expression profile GSE100927 was selected to identify differentially expressed genes (DEGs) in carotid atherosclerosis. Subsequently, protein-protein interaction, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were conducted. Furthermore, experimental verification was performed using human umbilical vein endothelial cells (HUVECs), human aortic vascular smooth muscle cells (HAVSMCs) and Tohoku Hospital Pediatrics-1 (THP-1)-induced macrophages. The groups were as follows: Control group, solvent control group and palmitic acid group. The levels of reactive oxygen species (ROS) in the three cell types were detected by flow cytometry or fluorescence microscopy. Furthermore, apoptosis of HUVECs and HAVSMCs was assessed by flow cytometry and the nuclear Hoechst 33258 staining of THP-1-induced macrophages was performed. Male late-stage carotid atherosclerosis samples, including 10 control samples and 21 atherosclerosis samples, were selected. Pathway enrichment analysis demonstrated that ‘Toll-like receptor signaling pathway’ was the top pathway associated with the DEGs. MMP7, MMP9, IL1β, C-C motif chemokine ligand 4 (CCL4), secreted phosphoprotein 1 (SPP1), CCL3 and interferon regulatory factor 5 (IRF5) were selected for experimental verification. Palmitic acid increased the ROS levels and the apoptosis rates of HUVECs and HAVSMCs. However, it did not increase the levels of ROS and did not shrink the nuclei of THP-1-induced macrophages. Furthermore, palmitic acid increased the mRNA levels of IL1β, CCL4, SPP1, CCL3, IRF5, MMP7 and MMP9 in HUVECs and THP-1-induced macrophages, and increased the mRNA levels of CCL4 and MMP9 in HAVSMCs. In conclusion, IL1β, CCL3, CCL4, SPP1, IRF5, MMP7 and MMP9 are important markers of late-stage carotid atherosclerosis.
Atherosclerosis is a progressive chronic inflammatory and metabolic disease with lipid deposition, focal intimal thickening, smooth muscle cell proliferation and plaque formation (
The mechanisms of atherosclerosis have remained to be fully elucidated. However, lipid metabolism disorders, endothelial dysfunction (
In the present study, key genes in carotid atherosclerosis were screened out via bioinformatics, including MMP7, MMP9, IL1β, C-C motif chemokine ligand 4 (CCL4), secreted phosphoprotein 1 (SPP1), CCL3 and interferon regulatory factor 5 (IRF5). Subsequently, the mRNA levels of these genes were measured in human umbilical vein endothelial cells (HUVECs), human aortic vascular smooth muscle cells (HAVSMCs) and Tohoku Hospital Pediatrics-1 (THP-1)-induced macrophages.
The GSE100927 gene expression dataset was obtained from the GEO database (
The cluster Profiler package in R is a tool to implement methods when analyzing and visualizing the functional profiles of genomic coordinates and was used to perform GO and KEGG analysis (
The Search Tool for the Retrieval of Interacting Genes and proteins (STRING) database (
Cells were cultured in 5% CO2 at 36.5±0.5˚C and under 95% relative humidity. HAVSMCs were purchased from Shenzhen Kuyuan Biotechnology Co., Ltd. HUVECs (CL-0122) and THP-1 (CL-0233) cells were purchased from Procell Life Science & Technology Co., Ltd. THP-1 cells were cultured in RPMI-1640 (Gibco; Thermo Fisher Scientific, Inc.) +10% FBS + 0.05 mM β-mercaptoethanol (PB180633) + 1% antibiotics. HAVSMCs and HUVECs were cultured in 10% FBS + 89% DMEM (Gibco; Thermo Fisher Scientific, Inc.) + 1% antibiotics. HAVSMCs, HUVECs and THP-1 cells were immortalized cell lines.
RNAiso Plus was acquired from Takara Biotechnology Co., Ltd. SYBR®-Green Premix qPCR, an Evo M-MLV RT-PCR kit and RNase-free water (cat. nos. AG11701, AG11602 and AG11012, respectively) were obtained from Accurate Biotechnology Co., Ltd. 2',7'-dichloro-dihydrofluorescein diacetate (DCFH-DA; cat. no. D6883) and a Cell Counting Kit-8 (CCK-8; cat. no. 96992) were acquired from MilliporeSigma. Hoechst 33342 (cat. no. M5112) was obtained from Guangzhou Juyan Biological Co., Ltd. Palmitic acid and solvent (SYSJ-KJ0040) were acquired from Xi'an Quantum Technology Development Co., Ltd. The Annexin V APC Apoptosis Detection Kit I (cat. no. 62700-80) was purchased from Guangzhou Squirrel Biological Co., Ltd.
The viability of cells was determined using a CCK-8 assay. First, all cells were seeded into 96-well plates at a density of 6x103 cells/well and incubated for 24 h. To assess the effect of palmitic acid, the cells were then incubated with palmitic acid at various concentrations (0, 25, 50, 75, 100, 125, 150, 175 or 200 µM) for 6, 12, 24 or 36 h, and then subjected to the CCK-8 assay at 37˚C for 1 h. The absorbance at 450 nm was measured using a microplate reader (BioTek Instruments, Inc.).
The groups were as follows: Control group, solvent control group (equal volume of solvent) and palmitic acid group (200 µM palmitic acid). Following co-cultivation with palmitic acid for 24 h, cells were used in a series of experiments.
Cells (1x106) in a 6-well plate or collected in an Eppendorf tube were incubated at 37˚C for 20 min in PBS containing 20 µM DCFH-DA. After the DCFH-DA was removed, cells were washed three times with PBS. Subsequently, intracellular ROS production was measured using an inverted fluorescence microscope (Axio Vert.A1; Carl Zeiss, Inc.) or a flow cytometer (CytExpert 2.3; Beckman Coulter, Inc.).
Annexin V allophycocyanin (APC) and PI were used to evaluate the apoptotic rates of cells in different groups. Cells were collected with trypsin (Gibco; Thermo Fisher Scientific, Inc.) and washed with PBS. Subsequently, 1x106 cells were placed in binding buffer and double-stained with Annexin V-allophycocyanin and propidium iodide in the dark for 15 min at 4˚C. The proportion of apoptotic cells was then analyzed on a flow cytometer (CytExpert 2.3; Beckman Coulter, Inc.) to determine the apoptotic rate.
Cells were incubated for 20 min with 5 µl Hoechst 33258 in 0.995 ml PBS at 37˚C. After washing twice with PBS, the fluorescence images were captured using an inverted fluorescence microscope (Axio Vert.A1; Carl Zeiss, Inc.), and Image-Pro Plus 6.0 (Media Cybernetics, Inc.) was used for analysis to measure the fluorescence intensity.
According to the manufacturer's protocol, total RNA from cells was isolated using RNAiso Plus. Subsequently, cDNA was synthesized based on the instructions of the RT-PCR kit (catalog no. AG11602). Subsequently, a Bio-Rad CFX96 Real-Time PCR System (Bio-Rad Laboratories, Inc.) was used to perform qPCR. The amplification parameters were as follows: 95˚C for 30 sec, followed by 40 cycles of 95˚C for 5 sec and 60˚C for 34 sec, 95˚C for 15 sec, 60˚C for 60 sec and 95˚C for 15 sec. Relative mRNA expression was calculated using the 2-ΔΔCq method after normalization to β-actin (
Values are expressed as the mean ± standard deviation. The experiments were repeated three times. GraphPad Prism 8 (GraphPad Software, Inc.) was used to perform statistical analysis. The data were analyzed by one-way ANOVA. Bonferroni's test was used as the post-hoc test after ANOVA. P<0.05 was considered to indicate a statistically significant difference.
DEG analysis was performed on the GSE100927 dataset (
The top 10 significant terms in the GO annotation (
To examine the cytotoxicity of palmitic acid, HUVECs, HAVSMCs and THP-1-induced macrophages were incubated with different doses of palmitic acid in the culture medium containing 10% FBS for 6, 12, 24 or 36 h. Cytotoxicity/growth inhibition was determined by a CCK-8 assay. Palmitic acid (50, 75, 100, 125, 150, 175 or 200 µM) significantly lowered the viability of HUVECs and HAVSMCs at different time-points (P<0.05;
To determine whether palmitic acid has an effect on intracellular oxidative stress, it was investigated whether palmitic acid had effects on the production of ROS in cells. Intracellular ROS levels in the different groups of cells were examined after incubation with palmitic acid for 24 h via fluorescence microscopy and flow cytometry. As indicated in
Certain studies have reported the use of palmitic acid to represent atherosclerosis (
The mRNA expression levels of IL1β, CCL4, SPP1, CCL3, IRF5, MMP7 and MMP9 were detected in HAVSMCs, HUVECs and THP-1-induced macrophages (
Atherosclerosis may occur throughout the arterial vascular system and lead to various diseases. The present study provided evidence that inflammation markers serve a vital role in male late-stage carotid atherosclerosis. The major findings were as follows: i) Carotid atherosclerosis is closely related to arterial inflammation, including pathways such as ‘Toll-like receptor signaling pathway’, ‘Cytokine-cytokine receptor interaction’ and ‘Chemokine signaling pathway’; ii) macrophages and vascular endothelial cells are involved in vascular inflammation; iii) palmitic acid causes apoptosis of HUVECs and HAVSMCs, indicating that hyperlipidemia may cause blood vessel damage, while it does not affect THP-induced macrophages; and iv) palmitic acid increased the levels of oxidative stress in HUVECs and HAVSMCs, while it did not increase the levels of oxidative stress in THP-induced macrophages.
Steenman
The pathogenesis of atherosclerosis is closely related to hyperlipidemia. Free fatty acids may cause endothelial damage and lipid deposition. The effect of palmitic acid on endothelial cells, smooth muscle cells and macrophages is able to induce the high-fat model
Oxidative stress serves a vital role in the process of atherosclerotic plaque formation (
Inflammation is one of the major proatherogenic factors, destroying the structure of blood vessels (
The circulating levels of C-C chemokine ligand (CCL) are increased in atherosclerotic patients (
IRF5 serves a central role in inflammation, mediating the production of proinflammatory cytokines, such as IL6, IL12, IL23 and TNF-α (
There are certain deficiencies in the present study. It was not possible to obtain male primary endothelial cells, VSMCs and macrophages to perform validation
In conclusion, inflammation is closely related to atherosclerosis, as demonstrated using bioinformatics and experimental verification. IL1β, CCL3, CCL4, SPP1, IRF5, MMP7 and MMP9 are markers of carotid atherosclerosis.
The authors would like to thank Miss Yixuan Li (College of Traditional Chinese Medicine, Jinan University, Guangzhou, China) for her valuable comments on English language revision.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. The gene expression datasets generated and/or analyzed during the current study are available in the GEO repository,
DZ and GZ designed the experiments and wrote this manuscript. GQ was involved in the experimental design and manuscript revision. DZ, BJ and XL completed the experiments. HS, SC, ZC, YZ and YP provided help with the English language revision and were involved in data analysis. DZ, XL, BJ, GQ and GZ confirmed the authenticity of the data. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
DEGs in carotid atherosclerosis. (A) Expression levels of each sample from the perspective of the overall dispersion of expression. (B) Volcano plot of DEGs (P≤0.05 and |log2|≥2). (C) Clustered heat map. (D) Interrelations between proteins. (E) Enrichment of signaling pathways. DEG, differentially expressed gene.
Functional enrichment analysis of differentially expressed genes. GO annotation, including (A) Molecular Function, (B) Biological Process and (C) Cellular Component. (D) Venn diagram for two genes (MMP7 and MMP9) involved in three vital GO annotations. (E-K) Expression levels of (E) IL1β, (F) CCL3, (G) CCL4, (H) SPP1, (I) IRF5, (J) MMP7 and (K) MMP9 in the control and atherosclerosis groups. ****P<0.05. CCL3, C-C motif chemokine ligand 3; CCR1, C-C motif chemokine receptor 1; GO, Gene Ontology; IRF5, interferon regulatory factor 5; SPP1, secreted phosphoprotein 1.
Palmitic acid affects cell viability. Effects of palmitic acid on the viability of (A) HUVECs, (B) HAVSMCs and (C) Tohoku Hospital Pediatrics-1-induced macrophages. *, #, ● and Δ indicate P<0.05 compared with the 0 µM group at 6, 12, 24 and 36 h at the same time-point. HUVEC, human umbilical vein endothelial cell; HAVSMC, human aortic vascular smooth muscle cell.
Palmitic acid promotes ROS production in cells. (A) Palmitic acid increased intracellular ROS levels in HUVECs. (Aa) ROS fluorescence (magnification, x200; scale bar, 50 µm) and (Ab) quantified results. (Ac) Flow cytometry histograms and (Ad) results of statistical analysis. (B) Palmitic acid stimulation for 24 h increased ROS levels of human aortic smooth muscle cells. (Ba) ROS fluorescence (magnification, x200; scale bar, 50 µm) and (Bb) quantified results. (Bc) Flow cytometry histograms and (Bd) results of statistical analysis. (C) Palmitic acid and solvent incubation did not affect the ROS levels of Tohoku Hospital Pediatrics-1-induced macrophages. (Ca) Fluorescence (magnification, x200; scale bar, 50 µm) and (Cb) results of statistical analysis. *P<0.05 compared with the control group. ROS, reactive oxygen species.
Palmitic acid affects cell apoptosis and has no effect on nuclear changes. (A-D) Incubation with palmitic acid led to apoptosis of HAVSMCs and HUVECs. (A) Flow cytometry dot plot for HAVSMCs and (B) quantified apoptosis rates. (C) Flow cytometry dot plot for HUVECs and (D) quantified apoptosis rates. (E and F) Palmitic acid did not affect the nuclear morphology of Tohoku Hospital Pediatrics-1-induced macrophages. (E) Fluorescence microscopy images for Hoechst 33258 staining and (F) quantified fluorescence intensity (magnification, x200; scale bar, 50 µm). *P<0.05 compared with the control group. APC, allophycocyanin; PI, propidium iodide; Q, quadrant; HUVEC, human umbilical vein endothelial cell; HAVSMC, human aortic vascular smooth muscle cell.
mRNA expression levels of IL1β, CCL4, SPP1, CCL3, IRF5, MMP7 and MMP9. (A) Palmitic acid increased the levels of CCL4 and MMP9, while the levels of IRF5 were not significantly altered. Palmitic acid increased the levels of IL1β, CCL4, SPP1, CCL3, IRF5, MMP7 and MMP9 both in (B) HUVECs and (C) Tohoku Hospital Pediatrics-1-induced macrophages. *P<0.05 compared with the control group. CCL3, C-C motif chemokine ligand 3; HAVSMC, human aortic vascular smooth muscle cell; HUVEC, human umbilical vein endothelial cell; IRF5, interferon regulatory factor 5; SPP1, secreted phosphoprotein 1.
Primer sequences used for PCR.
Gene | Forward primer (5'-3') | Reverse primer (5'-3') |
---|---|---|
IL1β | ATGATGGCTTATTACAGTGGCAA | GTCGGAGATTCGTAGCTGGA |
CCL3 | AGTTCTCTGCATCACTTGCTG | CGGCTTCGCTTGGTTAGGAA |
CCL4 | TCGCAACTTTGTGGTAGA | TTCAGTTCCAGGTCATACAC |
IRF5 | GGGCTTCAATGGGTCAACG | GCCTTCGGTGTATTTCCCTG |
MMP7 | GAGTGAGCTACAGTGGGAACA | CTATGACGCGGGAGTTTAACAT |
MMP9 | GGGACGCAGACATCGTCATC | TCGTCATCGTCGAAATGGGC |
SPP1 | GAAGTTTCGCAGACCTGACAT | GTATGCACCATTCAACTCCTCG |
β-actin | GGGAAATCGTGCGTGACATTAAGG | CAGGAAGGAAGGCTGGAAGAGTG |
CCL3, C-C motif chemokine ligand 3; IRF5, interferon regulatory factor 5; SPP1, secreted phosphoprotein 1.
Kyoto Encyclopedia of Genes and Genomes pathway enrichment.
Term | Pathway | P-value | Genes |
---|---|---|---|
hsa04620 | Toll-like receptor signaling pathway | 0.0004 | IL1B, CCL4, SPP1, CCL3, IRF5 |
hsa04060 | Cytokine-cytokine receptor interaction | 0.0013 | CX3CR1, IL1B, CCL4, CCL3, CCL18, CXCL14 |
hsa05323 | Rheumatoid arthritis | 0.0034 | MMP1, IL1B, CCL3, ACP5 |
hsa04062 | Chemokine signaling pathway | 0.0036 | CX3CR1, CCL4, CCL3, CCL18, CXCL14 |
hsa04380 | Osteoclast differentiation | 0.0102 | FCGR3A, IL1B, ACP5, TREM2 |
hsa05132 | Salmonella infection | 0.0334 | IL1B, CCL4, CCL3 |
GO annotation (biological process, top 10).
Term | Pathway | P-value | Genes |
---|---|---|---|
GO:0022617 | Extracellular matrix disassembly | 3.24073x10-8 | MMP12, MMP7, MMP1, SPP1, ADAM8, CAPG, MMP9 |
GO:0070374 | Positive regulation of ERK1 and ERK2 cascade | 4.51858x10-6 | HAND2, PLA2G2A, CCL4, CCL3, CHI3L1, TREM2, CCL18 |
GO:0071356 | Cellular response to tumor necrosis factor | 7.71998x10-6 | SFRP1, CCL4, CCL3, CHI3L1, CCL18, HAMP |
GO:0006955 | Immune response | 8.16275x10-6 | IL1RN, FCGR3A, IL1B, AQP9, CCL4, CCL3, CCL18, HAMP, CXCL14 |
GO:0071347 | Cellular response to interleukin-1 | 2.90881x10-5 | SFRP1, CCL4, CCL3, CHI3L1, CCL18 |
GO:2000503 | Positive regulation of natural killer cell chemotaxis | 1.2724x10-4 | CCL4, CCL3, CXCL14 |
GO:0001649 | Osteoblast differentiation | 1.29681x10-4 | SFRP1, IBSP, MYOC, SPP1, CCL3 |
GO:0006954 | Inflammatory response | 3.3532x10-4 | IL1B, CCL4, SPP1, CCL3, CHI3L1, ADAM8, CCL18 |
GO:0007267 | Cell-cell signaling | 4.09983x10-4 | IL1B, CCL4, CCL3, ADRA2C, CCL18, CXCL14 |
GO:0045780 | Positive regulation of bone resorption | 4.68124x10-4 | CA2, SPP1, ADAM8 |
GO, Gene Ontology.
GO annotation (cellular component, top 10).
Term | Pathway | P-value | Genes |
---|---|---|---|
GO:0005615 | Extracellular space | 1.0927x10-11 | IL1RN, SPON1, MMP7, MYOC, PLA2G2A, HP, CXCL14, MMP9, SFRP1, IBSP, CA2, IL1B, CCL4, SPP1, CCL3, HMOX1, CHI3L1, APOD, CCL18, SCRG1, HAMP |
GO:0005576 | Extracellular region | 1.64812x10-8 | MMP7, MMP1, PLA2G2A, HP, HBA2, TREM2, CXCL14, MMP9, MMP12, IL4I1, SFRP1, IBSP, IL1B, CCL4, APOC1, SPP1, CCL3, APOD, HAMP |
GO:0005578 | Proteinaceous extracellular matrix | 2.65218x10-7 | MMP12, SPON1, SFRP1, MMP7, MYOC, MMP1, TFPI2, CHI3L1, MMP9 |
GO:0070062 | Extracellular exosome | 1.48988x10-5 | IL1RN, MMP7, MYOC, PLA2G2A, HP, HBA2, CAPG, MMP9, FCGR3A, SFRP1, DES, CA2, IL1B, APOC1, SPP1, ACP5, CHI3L1, APOD, PI16, FBP1 |
GO:0031012 | Extracellular matrix | 8.34484x10-5 | SPON1, SFRP1, MMP7, IBSP, MYOC, MMP1, TFPI2 |
GO:0031838 | Haptoglobin-hemoglobin complex | 9.841369x10-3 | HP, HBA2 |
GO:0048471 | Perinuclear region of cytoplasm | 1.7958995x10-2 | CX3CR1, PLA2G2A, SPP1, HMOX1, CHI3L1, APOD |
GO:0031988 | Membrane-bounded vesicle | 3.4032333x10-2 | IBSP, SPP1 |
GO:0071682 | Endocytic vesicle lumen | 3.8800705x10-2 | HP, HBA2 |
GO:0005783 | Endoplasmic reticulum | 5.2251773x10-2 | MYOC, APOC1, PLA2G2A, HMOX1, CHI3L1, APOD |
GO, Gene Ontology.
GO annotation (molecular function, top 10).
Term | Pathway | P-value | Genes |
---|---|---|---|
GO:0004222 | Metalloendopeptidase activity | 0.000159247 | MMP12, MMP7, MMP1, ADAM8, MMP9 |
GO:0008009 | Chemokine activity | 0.000226706 | CCL4, CCL3, CCL18, CXCL14 |
GO:0004252 | Serine-type endopeptidase activity | 0.000363433 | MMP12, MMP7, MMP1, HP, ADAM8, MMP9 |
GO:0004175 | Endopeptidase activity | 0.007603833 | MMP12, MMP1, MMP9 |
GO:0005125 | Cytokine activity | 0.008882175 | IL1RN, IL1B, CCL4, SPP1 |
GO:0031726 | CCR1 chemokine receptor binding | 0.016880964 | CCL4, CCL3 |
GO:0031730 | CCR5 chemokine receptor binding | 0.019269721 | CCL4, CCL3 |
GO:0005149 | Interleukin-1 receptor binding | 0.031128822 | IL1RN, IL1B |
GO:0042802 | Identical protein binding | 0.033983341 | SFRP1, DES, CCL4, CCL3, FBP1, MMP9 |
GO:0005109 | Frizzled binding | 0.083902905 | SFRP1, MYOC |
GO, Gene Ontology; CCR1, C-C motif chemokine receptor 1.