Human chronic myeloid leukemia cell line K562 was purchased from Shanghai Cell Bank, Chinese Academy of Sciences. PMA was purchased from American Sigma Company (cat. no. P1585-1MG). Fetal bovine serum (FBS), BCA protein assay kit and SDS-PAGE gel rapid preparation kit were purchased from Shanghai Biyuntian Biotechnology Co., Ltd. RPMI 1640 medium was purchased from HyClone (Cytiva). Swiss-Giemsa staining solution, double antibody, RIPA protein lysis solution and 5X protein loading buffer were purchased from Beijing Solarbio Science & Technology Co., Ltd. Standard protein marker and Lipofectamine^® 2000 transfection kit were purchased from Thermo Fisher Scientific, Inc. The ECL luminescence kit was purchased from Shandong Sparkjade Scientific Instruments Co., Ltd. Egr-1 (cat. no. 22008-1-AP), GAPDH (cat. no. 10494-1-AP) and β-actin (cat. no. 20536-1-AP) primary antibodies were purchased from ProteinTech Group, Inc. HRP-labeled rabbit secondary antibody (cat. no. ZB-2301) was purchased from OriGene Technologies, Inc. Primer design was provided by Sangon Biotech Co., Ltd. Reverse transcription kit PrimeScript RT reagent kit with gDNA Eraser (Perfect Real Time), chimeric fluorescence detection kit and TB Green Premix Ex Taq^™ (Tli RNaseH Plus) kit was purchased from Takara Biotechnology Co., Ltd. The cycle kit was purchased from Jiangsu KGI Biotechnology Co., Ltd. PE-CD11b (cat. no. 301306) and FITC-CD14 (cat. no. 301804) fluorescent conjugated antibodies were purchased from BioLegend, Inc. TRIzol^® reagent was purchased from Thermo Fisher Scientific. Inc.

K562 cells were grown in culture flasks containing 10% FBS in RPMI-1640 complete medium, cultured at 37°C, 5% CO₂. In the logarithmic growth phase, an appropriate amount of K562 cell suspension and PMA solution were added to 96-well plates, so that the cell concentration in each well was 1×10⁵/ml and the corresponding dose of PMA solution was added. A total of three duplicate wells were set up in each group and one zero-adjusting well was set up in each plate with only an equal volume of RPMI1640 culture medium (100 µl) added and then cultured at 37°C, 5% CO₂ with saturated humidity. At 24, 48 and 72 h of culture 10 µl of CCK8 solution was added to each well, except the blank well and incubated at 37°C for 2 h and detected at 450 nm. According to the IC₅₀ experimental results of 48 h of culture, the control group (PMA 0 ng/ml) and the experimental group (the final concentration of PMA 100 ng/ml) were selected.

The control group with 0 ng/ml PMA and the experiment group with 100 ng/ml PMA of K562 cells induced for 48 h without staining were observed directly under an inverted optical microscope. Cells of the above-mentioned control and experiment group were collected at 48 h, washed twice with cold PBS, resuspended with 100 µl PBS and mixed by gently pipetting to make a cell suspension. After centrifugation at 200 × g for 3 min at 4°C, the centrifuged smears were dried and stained with Wright-Giemsa Stain Solution for 5 min at room temperature. The changes of cell morphology were observed under different magnifications of the optical microscope and the resulting images were captured.

K562 cells were collected into flow tubes, resuspended in PBS, washed twice by centrifugation at 200 × g for 3 min at 4°C, and adjusted to a cell concentration of 1×10⁶ cells/ml. PBS (100 µl) was added to each tube, followed by 5 µl PE-labeled mouse anti-human CD11b fluorescent antibody and FITC-labeled mouse anti-human CD14 fluorescent antibody respectively and incubated at 4°C for 30 min in the dark. The cells were centrifuged at 200 × g for 4 min at 4°C and washed twice with PBS to remove excess monoclonal antibody. The cells were resuspended in 200 µl PBS and then fixed in 1% paraformaldehyde. The expressions of CD11b and CD14 in different treatment groups were analyzed on FACSVerse (BD Biosciences Pharmingen) Flow cytometer. Isotypic rat IgG was also used to check for nonspecific binding. The experiment was repeated three times.

The cells of the control group and the experimental group were collected, washed twice with pre-cooled PBS, cells were lysed with Protein Extraction reagent (Beijing Solarbio Science & Technology Co., Ltd.), the total cell protein was extracted, the protein concentration was determined by BCA method and 5× protein loading buffer was added and boiled for denaturation at 95°C for 10 min. Protein (20 µg) was loaded for SDS-PAGE (10%) electrophoresis, the separated protein was transferred to PVDF membrane, blocked with 5% skimmed milk for 90 min at room temperature and then incubated with the corresponding primary antibody; Egr-1 (1:800), GAPDH (1:8,000) and β-actin (1:2,000) at 4°C overnight, then washed with 1X TBST for 30 min, then incubated with goat anti-rabbit IgG secondary antibody (1:20,000) at room temperature for 90 min and finally washed for 30 min, and proteins were detected using an ECL kit (Sparkjade ECL super, ED0015-B, Shandong Sparkjade Scientific Instruments Co., Ltd.). ImageJ v1.51j8 was used for densitometry (National Institutes of Health). The experiment was repeated three times.

TargetScan, PITA and microRNAorg databases were used to predict target genes of possible upstream miRNAs of Egr-1 and intersected the predicted target miRNAs by crosstalk of the three databases. The common target miRNAs in the three databases were obtained, and the top 10 miRNAs were selected according to the P-value and literature research. In addition, GeneChip miRNA 4.0 (Affymetrix Co., Ltd.) was used to detect the different miRNA profiles between control and PMA-induced K562 cells, and 10 miRNAs that were reduced after induced-differentiation were screened according to the P-value.

When the K562 cells were cultured to the logarithmic growth phase, the cells (1×10⁶) were collected and the total RNA was extracted by TRIzol^® (Thermo Fisher Scientific, Inc.) method and the total RNA concentration was measured by an ultra-trace nucleic acid and protein analyzer. cDNA was synthesized according to the instructions of the PrimeScript RT reagent kit with gDNA Eraser (Perfect Real Time) reverse transcription kit. For reverse transcription, samples were incubated in an Eppendorf PCR system at 42°C for 30 min, then at 90°C for 5 min and at 5°C for 5 min. cDNA was used as a template for PCR amplification. The sense primer of miR-let-7c-3p was 5′-GCGCGCTGTACAACCTTCTAG-3′, the antisense primer was 5′-AGTGCAGGGTCCGAGGTATT-3′; the U6 sense primer was 5′-AGAGAAGATTAGCATGGCCCCTG-3′, Antisense is 5′-AGTGCAGGGTCCGAGGTATT-3′; Egr-1 sense primer was 5′-AGCAGCAGCAGCACCTTCAAC-3′, antisense was 5′-CCACCAGCACCTTCTCGTTGTTC-3′; GAPDH sense primer is 5′-CAACTTTGGTATCGTGGAAGG-3′, antisense was 5′-GCCATCACGCCAGAGTTTC-3′. The real-time fluorescence quantitative amplification reaction was performed according to the instructions of the TB Green^® Premix Ex Taq (Tli RNaseH Plus) kit, PCR was conducted with the following conditions: 10 sec at 95°C; 40 cycles of 5 sec at 60°C and 10 sec at 72°C; 34 sec at 60°C, and the relative quantitative analysis was performed using the 2-^ΔΔCq method (33). The experiment was repeated three times.

Using the bioinformatics prediction website (http://www.targetscan.org) to predict the binding fragments of Egr-1 and miR-let-7c-3p, pmirGLO-Egr-1-wt wild plasmid vector and pmirGLO-Egr-1-mut plasmid vector were constructed (Jinan Boshng Biotechnology Co., Ltd.) respectively, and cells co-transfected by transfection reagent kit (jetPRIME; Polyplus-transfection SA) with the above Egr-1 wild plasmid, Egr-1 mutant plasmid and miR-let-7c-3p mimics (sequence: CUGUACAACCUUCUAGCUUUCC) or mimics NC (sequence: UUCUCCGAACGUGUCACGUTT). The luciferase activity was measured by Dual-Luciferase Reporter Assay System (Envision; PerkinElmer, Inc.) 48 h following culture and Renilla luciferase was used as an internal control

An appropriate amount of short interfering RNA (siRNA) and its corresponding negative control were mixed with the transfection reagent to form a transfection complex, which was added to the 6-well plate that had been seeded with cells and cultured at 37°C for 48 h for subsequent experiments. Egr-1 siRNA-1: 5′-CCAUGGACAACUACCCUAATT-3′, Egr-1 siRNA-2: 5′-GCCUAGUGAGCAUGACCAATT-3′ and Egr-1 siRNA-3: 5′-GCUGUCACCAACUCCUUCATT-3′ synthesized by Shanghai BioSune Co., Ltd. were selected. According to the preliminary experimental results, the Egr-1 siRNA-1 with the most obvious interference effect (5′-CCAUGGACAACUACCCUAATT-3′) was selected as the target siRNA (hereinafter referred to as siEgr-1). As to the si-RNA interference experiment, there were four groups. In addition to the above 100 µg/l PMA experimental group and 0 µg/l PMA control group, the 100 µg/l PMA experimental group was transfected with si-ctrl at the same time as the PMA + si-Ctrl group. The 100 µg/l PMA experimental group was transfected with siEgr-1 at the same time as PMA + si-Egr-1 group.

miR-let-7c-3p mimic and inhibitor were synthesized by Shanghai GenePharma Co., Ltd. and their sequences were 5′-CUGUACAACCUUCUAGCUUUCC-3′, 5′-GGAAAGCUAGAAGGUUGUACAG-3′, corresponding NCs were: 5′-UUCUCCGAACGUGUCACGUTT-3′ and 5′-GGAAAGCUAGAAGGUUGUACAG-3′, respectively. The conventional transfection method of Lipofectamine^® 2000 (Thermo Fisher Scientific, Inc.) was used. Following transfection, RT-qPCR and western blotting were used to detect the expression changes of miR-let-7c-3p and downstream Egr-1 protein expression, respectively. iii) The effect of miR-let-7c-3p on the expression of differentiation antigens in K562 cells: In the above experiments of transfection of miR-let-7c-3p inhibitor, the expression changes of K562 cell differentiation antigens CD11b and CD14 were detected at the same time and let-7c-3p inhibitor NC was used as a control. The expression levels of differentiation antigens in the 100 µg/l PMA experimental group and the 0 µg/l PMA control group were also observed.

GraphPad Prism 8 software (GraphPad Software, Inc.) was used for data processing and Shapiro-Wilk (S-W) normal distribution was used for quantitative data. Each experiment was repeated three times and the measurement data were expressed as mean ± standard deviation. Comparisons between two groups were performed using independent samples t-test and ANOVA was used for multiple-group comparisons. The Bonferroni test was used as the post-hoc test for the one-way ANOVA test. Pearson analysis was used for the correlation between miR-let-7c-3p and Egr-1. All data were analyzed by two-tailed test. P<0.05 was considered to indicate a statistically significant difference.

The in vitro growth characteristics of the K562 cell line were directly observed under an inverted microscope. The results showed that, compared with the control group, after exposure to 100 ng/ml of PMA for 48 h, the K562 cells density was significantly reduced and the cells grew from a suspension state to an adherent state gradually (Fig. 1A and B). The CCK8 experiment confirmed that there was no significant difference between the PMA group and the control group before differentiation induction. After 48 h of differentiation induction, the proliferation ability of the PMA-induced differentiation group was significantly decreased compared with the control group (0.85±0.03 vs. 0.46±0.03; t=16.05; P<0.0001; Fig. 1C). Swiss-Giemsa staining showed that the cell volume after PMA-induced differentiation for 48 h increased significantly compared with the control group and the cytoplasmic volume increased, the nuclear-cytoplasmic ratio decreased and the nuclei became smaller. There was a trend towards monocyte-macrophage differentiation (Fig. 1D and E) and the number of more matured monocyte-macrophages increased (5.34±2.12 vs. 45.21±3.18; t=18.07; P<0.0001; Fig. 1F). The results indicated that the model of leukemia cell line differentiation into monocytes/macrophages was successfully established.

To further validate the committed differentiation of leukemia cells into monocytes/macrophages, the present study examined the expression of monocyte/macrophage-specific surface markers CD11b and CD14 in K562 cells treated with PMA for 48 h. The results of flow cytometry showed that the expression of CD11b in the PMA-induced group was significantly higher compared with that in the control group (49.47±3.48 vs. 3.54±0.54; t=24.070; P=0.002) and CD14 in the PMA-induced group was significantly higher compared with that in the control group (59.84±5.26 vs. 6.79±0.66; t=16.670; P=0.004; Fig. 2). The results showed that PMA could induce K562 cells to differentiate into monocytes/macrophages.

The expression level of Egr-1 in normal human peripheral blood mononuclear cells and K562 cells was detected by western blotting and the results showed that the expression of Egr-1 protein in K562 cells was significantly lower compared with that in normal controls (Fig. 3A and B). The gene expression of Egr-1 gene was detected at the indicated different time points (Fig. 3C) and it was also found that PMA induced an increase in the expression of Egr-1 gene in K562 cells and the protein expression of Egr-1 was also significantly increased (Fig. 3D and E), which contributed to the induced differentiation from leukemia cells into monocytes/macrophages in vitro.

The expression changes of Egr-1 in K562 cells before and after PMA-induced differentiation were detected. The results confirmed that compared with the control group, the expression of Egr-1 was significantly increased after PMA induction (0.19±0.02 vs. 0.85±0.03; t=24.800; P<0.001; Fig. 4A and B). It was found that this elevated expression of Egr-1 protein was accompanied by an elevated expression level of K562 cell differentiation antigen CD14 (4.30±1.01 vs. 36.67±4.31; t=12.66; P=0.0002; Fig. 4C and D). Compared with the PMA alone group, the Egr-1 protein expression in the PMA + siEgr-1 co-action group was decreased (0.22±0.03 vs. 0.48±0.03; t=11.380; P<0.001; Fig. 4E and F) and the expression of the differentiation antigen CD14 was significantly decreased (7.03±1.45 vs. 24.40±4.70; t=6.113; P=0.004; Fig. 4G and H).

In the preliminary experiments, TargetScan, PITA and microRNAorg databases were used to predict target genes of possible upstream miRNAs of Egr-1 and intersected the predicted target miRNAs by crosstalk of the three databases. According to the results of target gene prediction, the common target miRNAs in the three databases were obtained. After sorting according to the P-value and literature research, the top 10 miRNAs were selected (Fig. 5A). In addition, following Agilent miRNA Chip detection, 10 miRNAs that were reduced after induced-differentiation were screened according to the P-value (Fig. 5B). Then the cross-analysis of the database analysis and the actual detection results of the chip was performed and it was found that miR-let-7c-3p was the only candidate miRNA. RT-qPCR results showed that the expression level of miR-let-7c-3p in the PMA-induced group was significantly lower than that in the control group (1.00±0.04 vs. 0.39±0.03; t=20.040; P=0.003; Fig. 5C). This indicated that in the process of PMA-induced differentiation of K562 cells, the expression level of miR-let-7c-3p was decreased. The three different time points at which K562 cells were induced to differentiate were randomly selected and three replicate samples were observed. Following Pearson correlation analysis, it was found that the changes of miR-let-7c-3p and Egr-1 were negatively correlated (Fig. 5D).

The regulatory effect of miR-let-7c-3p mimic and inhibitor on the expression of miR-let-7c-3p were first verified and the results confirmed that the expression level of miR-let-7c-3p in the miR-let-7c-3p inhibitor group was significantly lower compared with that in its negative control group (0.44±0.42 vs. 0.96±0.05; t=12.870; P=0.006). The expression level of miR-let-7c-3p in the miR-let-7c-3p mimic group was significantly higher compared with that in the negative control group (418.80±17.33 vs. 1.01±0.02; t=41.760; P<0.001; Fig. 6A and B). On the regulation of Egr-1 expression by miR-let-7c-3p, the results of western blotting showed that the expression of Egr-1 was significantly increased following transfection of miR-let-7c-3p inhibitor as compared with the control (0.83±0.12 vs. 0.39±0.00; t=6.315; P=0.024; Fig. 6C and D), while the expression of Egr-1 was significantly decreased following transfection of miR-let-7c-3p mimic compared with the control group (0.18±0.01 vs. 0.48±0.06; t=7.809; P=0.016; Fig. 6E and F).

Further analysis of the StarBase database revealed a binding site between miR-let-7c-3p and Egr-1, while the TargetScan database predicted a pairing site between miR-let-7c-3p and Egr-1 (Fig. 7A). The results of dual luciferase reporter gene showed that the luciferase activity in the co-transfected mimic and Egr-1 WT groups was significantly lower than that in the co-transfected mimic and Egr-1 MUT groups (0.77±0.01 vs. 1.00±0.01; t=27.582; P<0.001; Fig. 7B). The dual-luciferase reporter gene assay confirmed that there was a targeted binding activity regulatory relationship between miR-let-7c-3p and Egr-1, indicating that miR-let-7c-3p can target Egr-1.

To explore the effect of miR-let-7c-3p on PMA-induced differentiation of K562 cells, K562 cells were transfected with miR-let-7c-3p inhibitor and its negative control, treated with PMA (100 ng/ml) for 48 h to induce differentiation and the expression of cell surface markers CD11b and CD14 in each group was detected by flow cytometry. The results, as shown in Fig. 8, demonstrated that PMA clearly induced the committed differentiation of K562 cells, which was manifested as increased CD11b expression; for example, the expression levels of CD11b in the control group, PMA group, PMA + NC group and PMA + inhibitor group were 3.44±0.43%, 45.14±1.40%, 43.91±1.00% and 59.22±1.28%, respectively (Fig. 8A-E). The difference in ANOVA analysis for CD11b between groups was statistically significant (F=1460.318, P<0.001), and multiple Bonferroni test analysis showed that, except for PMA and PMA+NC with P=0.238, the remaining P-values were all <0.001, which was in line with the expected results. The difference was statistically significant in ANOVA analysis for CD14 between groups (F=5163.346, P<0.001), multiple Bonferroni test analysis found that except for PMA and PMA+NC were 0.544, the remaining P-values were all <0.001, which was in line with the expected results. Among them, the expression level of CD11b in the PMA group was significantly higher than that in the control group (t=39.570; P<0.001), the expression level of CD11b in the PMA + inhibitor group was significantly higher than that in the PMA + NC group (t=37.350; P<0.001; Fig. 8E), The expression level of CD11b in PMA + inhibitor group was significantly higher than that in PMA group (t=9.147; P=0.012).

PMA also significantly increased the expression of CD14 in K562 cells. The expression levels of CD14 in the control group, PMA group, PMA + NC group and PMA + inhibitor group were 4.91±0.42%, 70.54±1.44%, 71.91±0.74% and 85.98±0.52%, respectively (Fig. 8F-J), the difference was statistically significant following ANOVA analysis between groups (F=5163.346; P<0.001), multiple LSD analysis found that except for PMA and PMA + NC (P=0.91), the remaining P-values were all <0.001, which was in line with the expected results. The expression level of CD14 in the PMA group was significantly higher compared with the control group (t=94.720; P<0.001), the expression level of CD14 in the PMA + inhibitor group was significantly higher compared with the PMA + NC group (t=19.310; P=0.003) and the expression of CD14 in the PMA + inhibitor group was significantly higher compared with the PMA group (t=18.660; P=0.003; Fig. 8J). The results indicated that reduction of the expression of miR-let-7c-3p could promote the directed differentiation of PMA-induced leukemia.