The aim of the present study was to investigate the effects of microRNA (miR)-374a-5p on sepsis-induced acute lung injury (ALI) and the associated mechanism. Lipopolysaccharide (LPS)-induced human pulmonary microvascular endothelial cells (HPMVECs) were used to construct the cellular model of sepsis. A luciferase reporter assay was performed to confirm the association between miR-374a-5p and zinc finger E-box binding homeobox 1 (ZEB1). Reverse transcription-quantitative polymerase chain reaction and western blot analysis were performed to assess the relative expression of miR-374a-5p, ZEB1 and apoptosis-related proteins. Cell viability and apoptosis were determined by Cell Counting Kit-8 assay and flow cytometry, respectively. Enzyme-linked immunosorbent assays were used to evaluate inflammatory cytokines. The results revealed that miR-374a-5p was downregulated in sepsis patients and LPS-treated HPMVECs. Upregulation of miR-374a-5p alleviated LPS-triggered cell injury in HPMVECs, as evidenced by restoration of cell viability, and inhibition of apoptosis and the production of proinflammatory cytokines. In addition, ZEB1 was revealed to be a downstream target of miR-374a-5p, and overexpression of ZEB1 could reverse the anti-apoptotic and anti-inflammatory effects of miR-374a-5p on an LPS-induced sepsis cell model. Moreover, miR-374a-5p-induced protective effects involved the p38 MAPK signaling pathway. Collectively, miR-374a-5p exerted a protective role in sepsis-induced ALI by regulating the ZEB1-mediated p38 MAPK signaling pathway, providing a potential target for the diagnosis and treatment of sepsis.
Sepsis is a systemic inflammatory response syndrome (SIRS) caused by infection, which could develop into septic shock and multiple organ dysfunction syndrome (MODS), and has become one of the leading causes of death in critically ill patients, with a mortality rate of 25 to 40% (
MicroRNAs (miRNAs or miRs) are a class of small non-coding RNAs that have been discovered in recent years, which can specifically recognize the 3'-UTR sites of target mRNAs to inhibit protein translation or induce mRNA degradation, and thus regulate gene expression at the post-transcriptional levels (
Zinc finger E-box binding homeobox 1 (ZEB1) is a transcription factor which has critical roles in epithelial-mesenchymal transition (EMT), senescence, and angiogenesis (
In the present study, human pulmonary microvascular endothelial cells (HPMVECs) induced by LPS were used to investigate whether miR-374a-5p exerted a protective role in sepsis-induced ALI through the p38 MAPK signaling pathway by targeting ZEB1.
In total, 25 patients with sepsis (49.5±10.3 years old; 16 males and 9 females) following intensive care unit (ICU) admission at General Hospital of Ningxia Medical University (Yinchuan, China) from May 2017 to August 2018 were recruited in the present study, according to diagnostic criteria proposed by The Third International Consensus Definitions for Sepsis and Septic Shock (Sepsis-3) (
Following admission, blood samples (5 ml) were obtained on an empty stomach, and centrifuged at 3,000 x g for 10 min at 4˚C to completely remove cell debris. The collected serum was transferred to RNase/DNase-free sterile tubes and stored at -80˚C until further processing.
HPMVECs, purchased from American Type Culture Collection (ATCC no. PCS-100-022) were cultured in Dulbecco's modified Eagle's medium (DMEM; Life Technologies; Thermo Fisher Scientific, Inc.) plus 10% fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc.) and 100 µg/ml penicillin/streptomycin (Life Technologies; Thermo Fisher Scientific, Inc.) at 37˚C with 5% CO2. For the cellular model of sepsis, HPMVECs were incubated with 1 µg/ml LPS (Sigma-Aldrich; Merck KGaA) for 24 h at 37˚C. The ethics approval for the use of primary cell lines was received.
HPMVECs (1x104 cells/ml) cultured in 96-well plates were transfected with 50 nM miR-374a-5p mimics, miRNA negative control (miR-NC), 4 µg pcDNA3.1 containing the open reading frame of ZEB1 or pcDNA3.1 empty vector (Vector), chemically synthesized by Shanghai GenePharma Co., Ltd. with Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) at 37˚C, according to manufacturer's protocol. At 24 h after transfection, HPMVECs were stimulated with 1 µg/ml LPS for 24 h. Sequences of the oligonucleotides are shown in
The binding site between ZEB1 and miR-374a-5p was predicted using StarBase v2.0 (
Total RNA was extracted from serum and cultured cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. RT was conducted using a Taqman MicroRNA Reverse Transcription Kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) for miRNA or a Prime-Script™ One Step RT-qPCR kit (Takara Bio, Inc.) for mRNA strictly according to the manufacturers' instructions. Real-time PCR was conducted using SYBR Premix ExTagTM (Takara Bio, Inc.) on a 7500 Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) with the following thermocycling conditions: 95˚C for 10 min, followed by 40 cycles at 94˚C for 45 sec, 55˚C for 30 sec and 72˚C for 1 min. Relative expression levels of miR-374a-5p and ZEB1 were calculated using the 2-ΔΔCq method using U6 snRNA or GAPDH as internal controls (
A CCK-8 Kit was purchased from Dojindo Laboratories, Inc. to detect the cell viability according to the manufacturer's instructions. In detail, LPS-treated or transfected HPMVECs were seeded in a 96-well plate containing 5x103 cells/well and cultured for 24 h at 37˚C. CCK-8 reagent was added to each well and cells were further incubated at 37˚C for 4 h. The absorbance at 450 nm using a microplate reader (Bio-Rad Laboratories, Inc.) was measured to assess the viability of cells. Each experiment was repeated in triplicate.
The apoptosis of HPMVECs were determined by flow cytometry using an Annexin V-FITC/PI detection kit (Sigma-Aldrich; Merck KGaA) in accordance with a previous study (
Following lysis in RIPA buffer (Santa Cruz Biotechnology, Inc.) and centrifugation at 12,000 x g for 20 min at 4˚C, proteins were extracted from serum or cells. Bradford method was used to detect the concentration of the proteins using a Bradford assay kit (Thermo Fisher Scientific, Inc.). Sodium dodecyl sulfate polyacrylamide gel electrophoresis on 7.5-10% gels was used to separate the proteins with equal amounts. The proteins (30 µg) were then transferred onto PVDF membranes (MilliporeSigma). Samples were blocked with 5% non-fat milk at room temperature for 1 h, and incubated with the primary antibodies against Bax (product no. 5023), Bcl-2 (product no. 3498), ZEB1 (product no. 3396), phosphorylated (p)-p38 (product no. 4511), p38 (product no. 8690), p-JNK (product no. 4668), JNK (product no. 9252), p-ERK (product no. 4370), ERK (product no. 4695) and GAPDH (product no. 5174) (all 1:1,000 dilution; Cell Signaling Technology, Inc.) overnight at 4˚C, and then the membrane was incubated with the secondary antibodies (anti-rabbit IgG, HRP-conjugated; product no. 7074; 1:2,000 dilution; Cell Signaling Technology, Inc.) at room temperature for 2 h. GAPDH was used as the internal control. A Super Signal West Pico Chemiluminescent Substrate kit (Pierce; Thermo Fisher Scientific, Inc.) was then used to scan the films according to the manufacturer's protocol. Image-Pro Plus software version 6.0 (Media Cybernetics, Inc.) was used to analyze the relative protein expression.
Enzyme-linked immunosorbent assay (ELISA) method was performed to determine the concentration of interleukin (IL)-6 (cat. no. RAB0313), IL-1β (cat. no. RAB0273), and tumor necrosis factor-α (TNF-α) (cat. no. RAB1089) in cell culture supernatant using commercial ELISA kits (Sigma-Aldrich; Merck KGaA) according to the manufacturer's instructions.
All analyses were performed using SPSS version 22.0 (IBM Corp.). Two-sided unpaired Student's
The serum expression levels of miR-374a-5p in patients with sepsis and healthy controls were analyzed by RT-qPCR. A low expression of serum miR-374a-5p was revealed in septic patients compared with healthy controls (
To further explore the effects of miR-374a-5p in LPS-induced HPMVECs, the expression of miR-374a-5p was upregulated in LPS-treated HPMVECs by transfection with miR-374a-5p mimic (
Subsequently, the downstream target of miR-374a-5p was searched for using bioinformatics analysis. ZEB1 was predicted as a direct target gene of miR-374a-5p with several putative binding sites using StarBase v2.0 (
To verify whether miR-374a-5p was involved in sepsis-induced ALI by targeting ZEB1, miR-374a-5p mimic was co-transfected with ZEB1 into HPMVECs, and then the cells were treated with LPS. The expression of ZEB1 in LPS-treated HPMVECs was efficiently increased by transfection of ZEB1 overexpression vector (
To investigate the underlying mechanism of miR-374a-5p in sepsis-induced ALI, the expression of the p38 MAPK pathway was determined following overexpression of miR-374a-5p and ZEB1. Western blotting confirmed that the phosphorylation levels of p38, JNK, and ERK were significantly increased in LPS-treated HPMVECs. When miR-374a-5p was overexpressed, the protein expression of p38, JNK, and ERK phosphorylation levels was reduced, whereas ectopic expression of ZEB1 antagonized the downregulation (
Reportedly, the pathogenesis of sepsis-induced ALI is associated with pulmonary endothelial dysfunction, leading to abnormal apoptosis and inflammatory response (
Increasing studies have shown that miR-374a-5p plays its protective roles in the development of neurological dysfunction (
ZEB1 may serve as a novel therapeutic target for pulmonary inflammation (
Overall, the present study highlighted miR-374a-5p as a novel target for sepsis therapy and demonstrated that miR-374a-5p attenuated LPS-induced cell injury in HPMVECs, possibly via the ZEB1-mediated p38 MAPK signaling pathway.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
JS conducted most of the experiments and wrote the manuscript. XM conducted the experiments and analyzed the data. JS designed the study and revised the manuscript. All authors have read and approved the final manuscript. JS and XM confirm the authenticity of all the raw data.
The present study was approved by the Ethics Committee of General Hospital of Ningxia Medical University of Science and Technology (Yinchuan, China; approval no. IRB2017-GHNMU-38).
Not applicable.
The authors declare that they have no competing interests.
MiR-374a-5p is downregulated in patients with sepsis and LPS-treated HPMVECs. (A) The serum expression of miR-374a-5p in patients with sepsis and healthy controls was assessed by RT-qPCR. ***P<0.001. (B) RT-qPCR was used to detect the expression of miR-374a-5p in HPMVECs after 1 µg/ml LPS treatment for 24 h. ***P<0.001 vs. control. Results represent the means ± SD of 3 independent experiments. MiR-374a-5p, microRNA-374a-5p; LPS, lipopolysaccharide; HPMVECs, human pulmonary microvascular endothelial cells; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.
Overexpression of miR-374a-5p alleviates LPS-induced apoptosis and inflammation in HPMVECs. HPMVECs were transfected with miR-NC or miR-374a-5p mimic, and then treated with 1 µg/ml LPS for 24 h. (A) RT-qPCR was used to confirm the transfection efficiency of miR-374a-5p overexpression. ***P<0.001 vs. miR-NC. (B) Cell viability was measured by CCK-8 assay. (C and D) The apoptotic ratio was determined by flow cytometry. (E) The protein expression levels of apoptosis-related genes Bax and Bcl-2 were detected by western blotting. (F) ELISA assay was employed to examine the contents of inflammatory cytokines IL-6, IL-1β and TNF-α in the medium. **P<0.01. Results represent the means ± SD of 3 independent experiments. miR-374a-5p, microRNA-374a-5p; LPS, lipopolysaccharide; HPMVECs, human pulmonary microvascular endothelial cells; miR-NC, miRNA negative control; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; CCK-8, Cell Counting Kit-8; ELISA, enzyme-linked immunosorbent assay; IL-, interleukin; TNF-α, tumor necrosis factor-α.
ZEB1 is directly targeted by miR-374a-5p in HPMVECs. (A) The binding sites between miR-374a-5p and ZEB1 are shown. (B) Following transfection with miR-NC or miR-374a-5p mimic, the luciferase activity of ZEB1-wt/mut was assessed by dual-luciferase reporter assay. (C and D) The ZEB1 mRNA and protein levels were determined to assess the effect of miR-374a-5p mimic on ZEB1 expression. ***P<0.001 vs. miR-NC. (E) The serum expression of ZEB1 mRNA in patients with sepsis and healthy controls was assessed by RT-qPCR. ***P<0.001. (F) Pearson's correlation analysis was employed to analyze the association between serum miR-374a-5p and ZEB1 mRNA levels. (G and H) The mRNA and protein expression levels of ZEB1 in HPMVECs after 1 µg/ml LPS treatment were detected by RT-qPCR and western blotting. **P<0.01 and ***P<0.001 vs. control. Results represent the means ± SD of 3 independent experiments. ZEB1, zinc finger E-box binding homeobox 1; miR-374a-5p, microRNA-374a-5p; HPMVECs, human pulmonary microvascular endothelial cells; miR-NC, miRNA negative control; ZEB1-wt, ZEB1 wild-type; ZEB1-mut, ZEB1 mutated; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; LPS, lipopolysaccharide.
MiR-374a-5p reduces LPS-induced HPMVEC injury by targeting ZEB1. (A) Western blotting confirmation of ZEB1 overexpression. ***P<0.001 vs. vector. (B) Cell viability, (C and D) the apoptotic rate, (E) the protein expression levels of Bax and Bcl-2 and (F) inflammatory cytokine secretion levels, were examined in HPMVECs transfected with miR-374a-5p mimic and ZEB1 following treatment with LPS. **P<0.01 and ***P<0.001. Results represent the means ± SD of 3 independent experiments. MiR-374a-5p, microRNA-374a-5p; LPS, lipopolysaccharide; HPMVEC, human pulmonary microvascular endothelial cell; ZEB1, zinc finger E-box binding homeobox 1.
MiR-374a-5p exerts its function in LPS-treated HPMVECs by regulating the ZEB1-mediated p38 MAPK signaling pathway. Expression levels of p-p38 MAPK, p38 MAPK, p-JNK, JNK, p-ERK, ERK were analyzed by western blotting. The representative blots and quantitated results of p-p38/p38 ratio, p-JNK/JNK ratio, and p-ERK/ERK ratio are shown in HPMVECs transfected with miR-374a-5p mimic and ZEB1 after treatment of LPS. Results represent the means ± SD of 3 independent experiments. *P<0.05, **P<0.01 and ***P<0.001. MiR-374a-5p, microRNA-374a-5p; LPS, lipopolysaccharide; HPMVECs, human pulmonary microvascular endothelial cells; ZEB1, zinc finger E-box binding homeobox 1; p-, phosphorylated.
Demographic and clinical characteristics of patients with sepsis and healthy controls.
Characteristic | Sepsis (n=25) | Healthy (n=25) | P-value |
---|---|---|---|
Sex, male/female | 16/9 | 18/7 | 0.544 |
Age, years | 49.5±10.3 | 50.6±9.3 | 0.694 |
BMI, kg/m2 | 20.5±1.9 | 20.5±1.8 | 0.999 |
APACHE II score | 15.9±3.2 | - | - |
SOFA score | 6.1±1.3 | - | - |
CRP, mg/l | 96.7±20.3 | 6.3±2.6 | <0.001 |
PCT, ng/ml | 12.2±5.9 | 0.7±0.1 | <0.001 |
Lactic acid, mmol/l | 2. 8±1.8 | 1.0±0.4 | <0.001 |
PaO2 /FiO2, mmHg | 187.7±38.1 | 378.3±43.6 | <0.001 |
Data are presented as n or the mean ± SD. BMI, body mass index; APACHE, acute physiology and chronic health evaluation; SOFA, sequential organ failure assessment; CRP, C-reactive protein; PCT, procalcitonin.
Sequences of the oligonucleotides.
Oligonucleotides | Sequences (5'-3') |
---|---|
miR-374a-5p | UUAUAAUACAACCUGAUAAGUG |
mimics | CUUAUCAGGUUGUAUUAUAAUU |
miR-NC | UUCUCCGAACGUGUCACGUTT |
ACGUGACACGUUCGGAGAATT |
miR-374a-5p, microRNA-374a-5p; miR-NC, miRNA negative control.