Although reperfusion of the ischemic myocardium has been used as a vital treatment of various patients with cardiovascular disease, the accompanying myocardial ischemia-reperfusion injury (MIRI) can cause further damage, resulting in a poor prognosis. The present study aimed to explore the roles and regulatory mechanisms of interleukin (IL)-32, a pro-inflammatory cytokine, in MIRI. Cardiomyocytes were subjected to hypoxia and reoxygenation (H/R) to mimic MIRI. The effects of IL-32 on oxidative stress, inflammation and apoptosis of H/R-treated cells were assessed. Given that the nucleotide-binding oligomerization domain 2 (NOD2) and NADPH oxidase 2 (NOX2) play roles in the inflammatory response and myocardial ischemia, the role of this regulatory axis in the function of IL-32 was evaluated. The results indicated that IL-32 levels were elevated following H/R treatment. Downregulation of IL-32 expression attenuated H/R-induced reduction in cell viability, LDH release, oxidative stress, inflammation and apoptosis. Moreover, downregulation of IL-32 expression reversed the activation of the NOD2/NOX2/MAPK signaling pathway caused by H/R treatment. NOD2 overexpression altered the effects of the downregulation of IL-32 expression on the cells, indicating that this regulatory axis mediated the function of IL-32. Collectively, the data indicated that IL-32 participated in the induction of oxidative stress, inflammation, and apoptosis in cardiomyocytes during H/R treatment via the NOD2/NOX2/MAPK signaling pathway.
Coronary heart disease (CHD) is a significant disease that threatens human health worldwide, causing ~7.4 million deaths annually (
Inflammation is an important part of MIRI. Ischemia-reperfusion injury activates the innate immune response, resulting in an excessive inflammatory response (
Human cardiomyocytes were used to establish an
Human cardiomyoblasts (Immortalized; BFN60808678, BLUEFBIO,
The cells (5x105 cells/well) in the six-well plate were transfected with small interfering RNA (siRNA) to knockdown IL-32 expression and the non-targeted siRNA was used as the negative control (NC). The cells were transfected with pcDNA3.1 vector to overexpress nucleotide-binding oligomerization domain 2 (NOD2) for 48 h at 37˚C and the empty vector (GenePharm, Inc.) was used as the NC. The method was performed according to the instructions provided by the manufacturer (FuGENE HD transfection reagent; Roche Diagnostics). The cells were collected for subsequent experiments 48 h after transfection. The expression levels of IL-32 or NOD2 were assessed following 36 h of cell culture. IL-32 siRNA-1 target (5'-3'): GAGCTGGAGGACGACTTCAAA; IL-32 siRNA-2 target: GAAGGTCCTCTCTGATGACAT; siRNA-NC: GGCGTGCAGCAGGAAATACTA.
The cells (5x103/well) in the 96-well plates were treated as aforementioned. The cell viability was evaluated following 2 h of culture with the addition of the CCK-8 solution (10 µl; Beyotime Institute of Biotechnology) at 37˚C. The optical density (OD) was measured using a microplate reader (450 nm; Hiwell-Diatek).
Total RNA was isolated from cells using TRIzol® reagent (Thermo Fisher Scientific, Inc.) and cDNA was reverse transcribed using a Reverse Transcriptase kit (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The reverse transcription product was diluted and RT-qPCR was performed using a QuantiTect® SYBR-Green PCR kit (Qiagen, Inc.). The thermocycling conditions were as follows: 95˚C for 30 sec, 40 cycles of 95˚C for 30 sec, 60˚C for 30 sec, and 72˚C for 30 sec. The 2-ΔΔCq method (
Protein extraction was performed and a Nano 300 spectrophotometer (YPH-Bio) was used for protein quantification. SDS-PAGE using 10% gels was performed to separate the protein samples (25 µg/lane) and the separated proteins were subsequently transferred to a polyvinylidene membrane, followed by blocking in non-fat milk for 1 h at room temperature. Following incubation of the blots with primary antibodies [IL-32 (cat. no. 11079-1-AP; 1:1,000; ProteinTech Group, Inc.), phosphorylated (p-)p65 (cat. no. GTX133899; 1:1,000; GeneTex, Inc.), cyclooxygenase-2 (COX-2; cat. no. 12375-1-AP; 1:2,000; ProteinTech Group, Inc.), p65 (cat. no. GTX102090; 1:2,000; GeneTex, Inc.), Bax (cat. no. 50599-2-lg; 1:5,000; ProteinTech Group, Inc.), cleaved caspase 3 (cat. no. GTX03281; 1:1,000; GeneTex, Inc.), caspase 3 (cat. no. GTX110543; 1:1,000; GeneTex, Inc.), Bcl2 (cat. no. 26593-1-AP; 1:2,000; ProteinTech Group, Inc.), NOD2 (cat. no. GTX30694; 1:1,000; GeneTex, Inc.), NADPH oxidase 2 (NOX2; cat. no. 19013-1-AP; 1:1,000; ProTeintech Group, Inc.), p-ERK (cat. no. 28733-1-AP; 1:5,000; ProteinTech Group, Inc.), ERK (cat. no. 11257-1-AP; 1:2,000; ProteinTech Group, Inc.), β-actin (cat. no. 20536-1-AP; 1:5,000; ProteinTech Group, Inc.)] at 4˚C overnight, the strips were incubated at room temperature with an HRP-conjugated secondary antibody (cat. no. SA00001-2; 1:5,000; ProteinTech Group, Inc.) for 2 h. An ECL kit (GK10008; GlpBio) was used for visualization. β-actin was used for normalization and ImageJ software (v1.8.0; National Institutes of Health) was used for densitometry.
LDH (ab102526; Abcam), malondialdehyde (MDA; cat. no. A003-4-1; Nanjing Jiancheng Bioengineering Institute), and superoxide dismutase (SOD; cat. no. A001-1; Nanjing Jiancheng Bioengineering Institute) assay kits were used to assess the activity of the corresponding biochemical function indices. Briefly, the cells were collected and lysed and the samples were obtained according to the different requirements of the kits. The OD values were measured using a microplate reader. The determination of ROS was performed using a 2'-7'dichlorofluorescin diacetate (DCFH-DA) assay kit (cat. no. E004-1-1; Nanjing Jiancheng Bioengineering Institute). Diluted DCFH-DA was added to the wells and the cells were incubated for 30 min at 37˚C. Subsequently, the cells were collected and washed with PBS twice. Following centrifugation at 300 x g for 5 min at 4˚C, the supernatant was removed, and the cells were suspended in PBS for detection. Images of the results were captured using a fluorescence microscope (magnification, x100; Olympus Corporation) and quantified with ImageJ software.
The cells (5x105/well) were seeded in a 24-well plate and cultured until they reached 80% confluence. Following H/R treatment, the cell smears were immersed in 4% paraformaldehyde and fixed for 30 min at room temperature, followed by washing with PBS. The working solution in the TUNEL assay kit (E-CK-A334; Elabscience Biotechnology, Inc.) was added for 1 h at 37˚C in the dark according to the manufacturer's protocols. The nuclei were counterstained with 1 mg/ml DAPI for 5 min at room temperature in the dark and the slides were then mounted with anti-fade mounting medium. The coverslip was removed, sealed and the apoptotic cells in six randomly selected fields were observed under a fluorescence microscope (magnification, x200).
GraphPad Prism 8.0 (GraphPad Software, Inc.) was used for statistical analysis. All experiments were performed 3 times and the data are presented as the mean ± SD. Difference between multiple groups were compared using a one-way ANOVA with Tukey's post-hoc test. P<0.05 was considered to indicate a statistically significant difference.
Following induction of reoxygenation in the cells for 4, 8, and 16 h, the viability in each group was determined using the CCK-8 assay. The viability in the treated cells was significantly reduced compared with that of the control group, notably in the H/R 16 h group (
The expression levels of TNF-α, IL-1β and IL-6 were all increased in the H/R group and decreased to a certain degree due to downregulation of IL-32 expression, according to the results of RT-qPCR (
To determine the regulatory axis of IL-32, the expression levels of the proteins related to the NOD2/NOX2/MAPK signaling pathway were determined using western blotting. The expression levels of NOD2, NOX2 and p-ERK were elevated in the H/R treatment group, and partly declined following downregulation of IL-32 expression (
NOD2 overexpression reduced cell viability (
Despite the decrease noted globally in the burden of cardiovascular disease, this condition is rapidly increasing in developing countries (
Furthermore, the present study demonstrated that IL-32 may disrupt normal cardiomyocyte functions by activating the NOD2/NOX2 signaling pathway. NOD2 is one of the earliest discovered members of the Nod-like receptor family, which induces self-oligomerization by recognizing pathogen-associated molecular patterns (
The MAPK signaling pathway is present in the majority of cells and can transfer extracellular signals to cells and their nuclei, which is intimately relevant to cell proliferation and apoptosis (
In summary, the present study indicated that IL-32 participated in cardiomyocyte oxidative stress, inflammation, and apoptosis during H/R treatment via the NOD2/NOX2/MAPK signaling pathway. The current study demonstrated the potential role of IL-32 in MIRI and provides a theoretical basis for the development of relevant therapeutic methods for this disease.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
YL and ZW contributed to design, experiments and analysis. YL contributed to the draft and ZW revised the manuscript for important intellectual content. YL and ZW have read and approved the final manuscript, and also confirm the authenticity of the raw data.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
IL-32 expression is upregulated in H/R-treated cells. (A) Following reoxygenation of the cells for 4, 8, and 16 h, the cell viability in each group was determined using the Cell Counting Kit-8 assay. (B) The expression levels of IL-32 in these groups of cells were subsequently assessed by reverse transcription-quantitative PCR and (C) western blot assays. **P<0.01 and ***P<0.001 vs. control. IL, interleukin; H/R, hypoxia and reoxygenation.
Downregulation of IL-32 expression attenuates H/R-induced viability reduction, LDH release and oxidative stress. (A) IL-32 siRNA was constructed and the cells were transfected with siRNA to downregulate IL-32 levels. The expression levels of IL-32 in the cells were verified with RT-qPCR and (B) western blot assays. (C) The expression levels of IL-32 in the H/R-treated cells were verified with RT-qPCR and (D) western blot assays. (E) The effects of the downregulation of IL-32 expression on cell viability were evaluated using the Cell Counting Kit-8 assay. (F) The effects of the downregulation of IL-32 expression on LDH levels were evaluated using the LDH assay kit. The levels of (G) MDA, (H) SOD and (I) ROS in each group were assessed using specific assay kits. **P<0.01 and ***P<0.001 vs. control, siRNA-NC or H/R + siRNA-NC; #P<0.05, ##P<0.01 and ###P<0.001 vs. H/R + siRNA-NC. IL, interleukin; H/R, hypoxia and reoxygenation; LDH, lactate dehydrogenase; siRNA, small interfering RNA; RT-qPCR, reverse transcription-quantitative PCR; MDA, malondialdehyde; SOD, superoxide dismutase; ROS, reactive oxygen species.
Downregulation of IL-32 expression attenuates H/R-induced inflammation and apoptosis. (A) The expression levels of TNF-α, IL-1β and IL-6 were assessed using the reverse transcription-quantitative PCR assay. (B) The expression levels of p-p65, p65 and COX-2 were assessed with western blot analysis. (C) The induction of apoptosis in each group was determined with the TUNEL assay. (D) The expression levels of the apoptosis-related proteins were determined using western blot analysis. ***P<0.001 vs. control; ###P<0.001 vs. H/R + siRNA-NC. IL, interleukin; H/R, hypoxia and reoxygenation; p-, phosphorylated; COX-2, cyclooxygenase 2; siRNA, small interfering RNA.
IL-32 regulates the NOD2/NOX2/MAPK signaling pathway. (A) The expression levels of the proteins related to the NOD2/NOX2/MAPK signaling were determined using western blotting. (B) The efficacy of NOD2 overexpressing plasmids was verified reverse transcription-quantitative PCR and (C) western blot assays. (D) The effects of NOD2 overexpression on the expression levels of the NOD2/NOX2/MAPK signaling pathway-proteins were assessed using western blotting. ***P<0.001 vs. control or Ov-NC, ###P<0.001 vs. H/R and &&&P<0.001 vs. H/R + siRNA-IL-32 + Ov-NC. IL, interleukin; NOD, nucleotide-binding oligomerization domain; NOX, NADPH oxidase; NC, negative control; H/R, hypoxia and reoxygenation; siRNA, small interfering RNA.
IL-32 induces oxidative stress via the NOD2/NOX2/MAPK signaling pathway. (A) The effects of NOD2 overexpression on cell viability were evaluated using the Cell Counting Kit-8 assay. (B) The effects of NOD2 overexpression on LDH levels were evaluated using the LDH assay kit. The effects of NOD2 overexpression on the levels of (C) MDA, (D) SOD and (E) ROS were assessed using specific assay kits. **P<0.01 and ***P<0.001 vs. control; ##P<0.01 and ###P<0.001 vs. H/R; &P<0.05, &&P<0.01 and &&&P<0.001 vs. H/R + siRNA-IL-32 + Ov-NC. IL, interleukin; NOD, nucleotide-binding oligomerization domain; NOX, NADPH oxidase; LDH, lactate dehydrogenase; MDA, malondialdehyde; SOD, superoxide dismutase; ROS, reactive oxygen species; H/R, hypoxia and reoxygenation; siRNA, small interfering RNA; NC, negative control.
IL-32 regulates inflammation and apoptosis via the NOD2/NOX2/MAPK signaling pathway. (A) The effects of NOD2 overexpression on the expression levels of TNF-α, IL-1β and IL-6 were assessed using reverse transcription-quantitative PCR analysis. (B) The effects of NOD2 overexpression on the expression levels of p-p65, p65 and COX-2 were assessed using western blot analysis. (C) The effects of NOD2 overexpression on the induction of apoptosis were determined with the TUNEL assay. (D) The effects of NOD2 overexpression on the expression levels of the apoptosis-related proteins were determined using western blot analysis. ***P<0.001 vs. control; ###P<0.001 vs. H/R; &P<0.05 and &&&P<0.001 vs. H/R + siRNA-IL-32 + Ov-NC. IL, interleukin; NOD, nucleotide-binding oligomerization domain; NOX, NADPH oxidase; COX-2, cyclooxygenase 2; H/R, hypoxia and reoxygenation; siRNA, small interfering RNA; NC, negative control.
Primer sequences used for reverse transcription-quantitative PCR.
Primer name | Primer sequence (5'-3') |
---|---|
IL-32 | F: CTCTCTCGGCTGAGTATTTGTG |
R: GCTCGACATCACCTGTCCAC | |
TNF-α | F: TGGGATCATTGCCCTGTGAG |
R: GGTGTCTGAAGGAGGGGGTA | |
IL-6 | F: GTCCAGTTGCCTTCTCCCTGG |
R: CCCATGCTACATTTGCCGAAG | |
IL-1β | F: TGAGCTCGCCAGTGAAATGAT |
R: TCCATGGCCACAACAACTGA | |
NOD2 | F: CTTCTGGAGAAGTCCCGCAC |
R: TCTGTGCCTGAAAAGCCTCC | |
β-actin | F: CTTCGCGGGCGACGAT |
R: CCACATAGGAATCCTTCTGACC |
F, forward; R, reverse; IL, interleukin; TNF, tumor necrosis factor; NOD2, nucleotide-binding oligomerization domain 2.