Human NPCs were purchased from Procell Life Science and Technology Co., Ltd. Recombinant human IL-1β was purchased from Beijing T&L Biotechnology Co., Ltd. and NPCs were stimulated with a concentration of IL-1β of 10 ng/ml, as previously described (18). Monophosphoryl lipid A (MPLA), a synthetic Toll-like receptor (TLR-4) agonist, was purchased from Carbosynth China Ltd. and NPCs were treated with MPLA at a concentration at 1 µg/ml (19). Tunicamycin, an endoplasmic reticulum stress (ERS) agonist, was purchased from Glpbio Technology, Inc. and NPCs were treated with tunicamycin at a concentration at 5 µg/ml (20). The primary and secondary antibodies that were used in the present study are listed in Table I.

Search Tool for the Retrieval of Interacting Genes/Proteins (STRING; cn.string-db.org) is a database that provides online searching for known protein interactions (21). The STRING version 11.0 database contains over 20 million proteins, and this was used to search for proteins that interact with TREM1. ‘TREM1’ was entered as the protein name, ‘Homo sapiens’ was selected as the organism on the webpage, and the results were displayed in the form of a network.

NPCs were cultured in NPC medium supplemented with 2% fetal bovine serum (FBS), 1% NPC growth supplement and 1% penicillin/streptomycin solution (All from ScienCell Research Laboratories, Inc.). NPCs were maintained at 37˚C in an atmosphere comprising 5% CO₂, and subcultured at a 1:3 ratio until the NPCs reached ~80% confluence.

NPCs (10⁶ cells/well) were planted into 6-well plates until they reached 70-80% confluence. A total of 5 µg small interfering (si)RNA-TREM1 and scrambled siRNA [as a negative control (NC); Shanghai GenePharma Co., Ltd.] were transfected into NPCs with Lipofectamine^® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. Following transfection at 37˚C for 48 h, these cells were used for analysis. Target sequence (5'-3') for siRNA-TREM1-1: GACCCTGGATGTGAAATGTGA, siRNA-TREM1-2: GCACAGAGAGGCCTTCAAAGA, siRNA-NC: GTGCGGCTTGCGATAGAAATA.

Total RNA from NPCs (10⁶ cells/well) in a 6-well plate was isolated using TRIzol^® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols. Complementary DNA was primed using a Sensiscript RT kit (Takara Biotechnology Co., Ltd.), and subsequently a QuantiTect SYBR Green PCR kit (Qiagen Sciences, Inc.) was used for RT-qPCR according to the manufacturer's protocols. The qPCR cycling conditions were as follows: 95˚C for 30 sec, 40 cycles of 95˚C for 5 sec, 60˚C for 30 sec, and 72˚C for 10 sec. The 2^-ΔΔCq method (22) was used to analyze the relative gene expression levels, and those of the genes of interest were normalized against those of β-actin. This experiment was repeated three times. The sequences of the primers were: For TREM1, forward, 5'-CAACTGCCGATGTCTCCACT-3' and reverse, 5'-AAGGGCTCAGTGTCCAAACC-3'; and for β-actin, forward, 5'-CTTCGCGGGCGACGAT-3', and reverse, 5'-CCACATAGGAATCCTTCTGACC-3'.

Total protein was extracted from NPCs and homogenized in RIPA lysis buffer (Beijing Solarbio Science & Technology Co., Ltd.). Total protein was quantified using the BCA method (cat. no. P0012; Beyotime Institute of Biotechnology). Protein samples (30 µg) were then separated using 10% SDS-PAGE and transferred onto PVDF membranes (Beijing Solarbio Science & Technology Co., Ltd.). The membranes were first blocked with 5% non-fat milk at room temperature for 1 h and then washed with TBS-0.01% Tween-20. The blots were subsequently incubated with the respective antibodies (see Table I) at 4˚C overnight. They were then cut into strips, which were subsequently incubated with an HRP-conjugated secondary antibody at room temperature for 1 h. To visualize the proteins, a BeyoECL Plus kit (Beyotime Institute of Biotechnology) was used, following the manufacturer's instructions. Finally, ImageJ v.1.52 software (National Institutes of Health) was used for semi-quantitative analysis of the blots, and to measure the gray values.

NPCs (5x10³ cells/well) were seeded into 96-well plates and cultured in an incubator with 5% CO₂ at 37˚C. Cells were treated with IL-1β at 37˚C for 24 h. MTT solution (200 µl) was then added to each well, and the incubation was allowed to continue at 37˚C for 4 h, after which the medium was removed and DMSO was added. The optical density was measured at a wavelength of 490 nm using a microplate reader (Thermo Fisher Scientific, Inc.).

NPCs (1x10⁶ cells/well) were seeded in 6-well plates and incubated until they reached ~90% confluence. Subsequently, the cells were subjected to treatment with 4% formaldehyde at room temperature for 30 min to immobilize them. Triton X-100 (0.1%) was then added to the wells, and the NPCs were permeabilized for 15 min. The NPCs were blocked with 5% BSA (Merck KGaA) at room temperature for 30 min, and collagen II antibody (Table I) was added for overnight incubation at 4˚C, followed by incubation with FITC-labeled anti-rabbit antibody (Table I) for 1 h. Counterstaining with DAPI was continued for 5 min to visualize the nuclei, and images were obtained under a fluorescence microscope (Nikon Corporation).

The supernatant of the NPCs was centrifuged at 500 x g at 4˚C for 5 min, and then collected. The expression levels of TNF-α and IL-6 were measured using the corresponding ELISA kits (cat. no. H052-1 for TNF-α and cat. no. H007-1 for IL-6; Nanjing Jiancheng Bioengineering Institute), according to the manufacturer's recommendations. Finally, the absorbance was determined at 450 nm using a microplate reader (BioTek Instruments, Inc.).

NPCs (2x10⁴ cells/well) were seeded into a 24-well plate, and TUNEL assays were performed using a TUNEL kit (cat. no. C1086; Beyotime Institute of Biotechnology), according to the manufacturer's instructions. Briefly, cells were fixed with 4% paraformaldehyde for 30 min at room temperature, and subsequently incubated with PBS containing 0.3% Triton X-100 for 5 min at room temperature. Following the addition of TUNEL working solution, cells were incubated for a further 1 h at 37˚C in the dark. The nuclei were subsequently counterstained with DAPI for 10 min at room temperature. The images were captured at five random fields of view using a fluorescence microscope (magnification, x200; Olympus Corporation).

Experimental data were analyzed using GraphPad 7.0 software (GraphPad Software, Inc.), and the data are shown as the mean ± SD of three replicates. Student's t-test (for comparisons between two groups) or one-way ANOVA followed by Tukey's post-hoc test (for comparisons among multiple groups) were used to evaluate statistical differences. P<0.05 was considered to indicate a statistically significant difference.

After confirming that TREM1 was knocked down in the transfected NPCs (Fig. 1A), the effect of IL-1β stimulation on TREM1 expression levels was assessed using RT-qPCR and western blot analyses (Fig. 1B and C). The level of TREM1 was significantly increased in the IL-1β group compared with the control group. Furthermore, the levels of TREM1 in the NPCs transfected with si-TREM1 were also determined. The expression level of TREM1 was lower in the si-TREM1-1 group compared with the si-TREM1-2 group, and therefore the si-TREM1-1 group of NPCs was used for the subsequent assays. Next, the viability of each group of NPCs was evaluated using an MTT assay (Fig. 1D). The cell viability of the IL-1β group was found to sharply decline, whereas TREM1 knockdown partially increased the viability. The expression level of collagen II in each group was subsequently determined using an immunofluorescence assay (Fig. 2A). The results obtained indicated that the fluorescence of the IL-1β group was clearly weaker compared with that of the control group, whereas the fluorescence of the si-TREM1 group was strengthened. In addition, the protein expression levels of aggrecan, MMP3, MMP9, MMP13, ADAM metallopeptidase with thrombospondin type 1 motif (ADAMTS)-4 and ADAMTS-5 were determined by western blot analysis (Fig. 2B and C). The level of aggrecan was found to be reduced in the IL-1β group, whereas TREM1 knockdown caused a marked elevation in the level of aggrecan; furthermore, the trends of changes in the levels of the other proteins were found to be the opposite of those of aggrecan.

The levels of the inflammatory factors TNF-α and IL-6 were measured with ELISA kits (Fig. 3A). The results revealed that the levels of TNF-α and IL-6 were both significantly increased in the IL-1β group, whereas TREM1 knockdown led to a partial downregulation of their levels. Subsequently, the influence of IL-1β and TREM1 knockdown on the level of apoptosis of the NPCs was assessed using TUNEL assay (Fig. 3B and C) and western blotting (Fig. 3D). The apoptotic cells in the IL-1β group were found to emit stronger fluorescence signals compared with the control group. In addition, the fluorescence in the si-TREM1 group was weaker compared with that in the si-NC group, indicating that the downregulation of TREM1 suppressed the apoptosis of NPCs. At the same time, the protein expression level of Bcl-2 was decreased in the IL-1β group, whereas the levels of Bax, cleaved caspase 3 and cleaved poly(ADP-ribose) polymerase were all increased. Following TREM1 knockdown, however, the aforementioned apoptosis-associated protein expression level changes were all reversed.

According to the STRING database, TREM1 was predicted to be associated with TLR4. As a consequence, the expression levels of proteins associated with TLR4/NF-κB were detected using western blotting (Fig. 4A). The levels of TLR4, MyD88, phosphorylated (p)-IKK and p-p65 were increased as the result of IL-1β stimulation. TREM1 knockdown led to a partial reduction in the elevated levels, indicating that TREM1 knockdown had the effect of blocking TLR4/NF-κB signaling. Subsequently, MPLA (the TLR-4 agonist) was applied to the NPCs, and the levels of ERS-associated proteins were then detected using western blotting (Fig. 4B). The expression levels of C/EBP homologous protein, activating transcription factor 6 and glucose-regulated protein 78 were increased as a consequence of IL-1β induction, although they were decreased due to TREM1 knockdown, and partly increased as a result of TLR4 activation.

Subsequently, the effects of tunicamycin (an ERS agonist) on NPCs were investigated. The effect of tunicamycin on the expression of collagen II was assessed first (Fig. 5A). It was found that MPLA and tunicamycin similarly caused a partial reversal of the increases in the collagen II level elicited by TREM1 knockdown. Additionally, the expression levels of aggrecan were reduced upon treatment with MPLA or tunicamycin, whereas those of MMP3, MMP9, MMP13, ADAMTS-4 and ADAMTS-5 were concomitantly increased (Fig. 5B). Moreover, treatment with either MPLA or tunicamycin also boosted the levels of TNF-α and IL-6, even though TREM1 expression was knocked down (Fig. 6A). Taken together, the results of the TUNEL assay and western blotting experiments indicated that MPLA or tunicamycin treatment could promote the apoptosis of NPCs (Fig. 6B-D).