Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2022.12836 MMR-26-04-12836 Articles Palmitoyl-RGD promotes the expression of dermal-epidermal junction components in HaCaT cells LimJoo Hyuck 1 BaeJung Soo 1 LeeSeung Ki 1 LeeDong Hun 2 3 4 Biotechnology Research Institute, Research and Development Division, Celltrion Inc., Incheon 22014, Republic of Korea Department of Dermatology, Seoul National University Hospital, Seoul National University College of Medicine, Seoul 03080, Republic of Korea Laboratory of Cutaneous Aging Research, Seoul National University Hospital, Seoul 03080, Republic of Korea Institute of Human-Environment Interface Biology, Seoul National University, Seoul 03080, Republic of Korea Correspondence to: Professor Dong Hun Lee, Department of Dermatology, Seoul National University Hospital, Seoul National University College of Medicine, 101 Daehak-ro, Jongno, Seoul 03080, Republic of Korea, E-mail: ivymed27@snu.ac.kr 10 2022 29 08 2022 26 4 320 18032022 14072022 Copyright © 2022, Spandidos Publications 2022

With age, the dermal-epidermal junction (DEJ) becomes thinner and production of its protein components decreases; this may be associated with increased fragility and wrinkling of skin. Topical treatment with palmitoyl-Arg-Gly-Asp (PAL-RGD) improves facial wrinkles, skin elasticity and dermal density in humans. In the present study, the effect of PAL-RGD on expression of DEJ components, such as laminin and collagen, was assessed. Human HaCaT keratinocytes were treated with PAL-RGD. The protein expression levels of laminin-332, collagen IV and collagen XVII were examined by western blotting. Reverse transcription-quantitative PCR was used to analyze laminin subunit (LAM)A3, LAMB3, LAMC2, collagen type IV α 1 chain (COL4A1) and COL17A1 mRNA expression levels. Western blot analysis showed that the expression levels of proteins comprising the DEJ, including laminin α3, β3 and γ2 and collagen IV and XVII demonstrated a significant dose-dependent increase following PAL-RGD treatment. Furthermore, PAL-RGD treatment significantly enhanced LAMA3, LAMB3, LAMC2, COL4A1 and COL17A1 mRNA expression levels. PAL-RGD may enhance the DEJ by inducing the expression of laminin-332, collagen IV and collagen XVII.

 collagen IV collagen XVII dermal-epidermal junction laminin-332 palmitoyl-Arg-Gly-Asp Funding: No funding was received. Introduction

The dermal-epidermal junction (DEJ), located between the epidermis and dermis, provides a specific niche that mediates numerous signals such as MAPK in addition to providing structural support to keratinocytes (1,2). The DEJ serves an important role in skin cohesion, resistance to mechanical stress and exchange of the signals between the dermis and epidermis (3). As skin ages, the wavelike structure of the DEJ becomes thinner and appears flattened with a loss of rete ridges (4–6). Furthermore, previous studies have reported that production of protein components of the DEJ, including collagen IV, VII and XVII, nidogen, integrin β4 and laminin-332, decreases with age (6–9). Laminins are the most abundant glycoproteins of the basement membrane (BM) extracellular matrix (ECM) and are key for supporting tissue architecture and stability (10). Laminins are involved in skin reepithelization and wound healing via regulation of adhesion, proliferation, migration, apoptosis and differentiation (11). Collagen IV is a primary component of anchoring fibrils, which provide mechanical support for keratinocytes (12). Collagen XVII, another structural component of anchoring fibrils, serves important roles in assembly and function of the cell-matrix adhesion structure, signal transduction and keratinocyte differentiation (13). Based on the key roles of the DEJ in skin homeostasis, modulation of DEJ components has been suggested as a potential strategy to mitigate skin aging (14–16).

Our previous study demonstrated that palmitoyl-Arg-Gly-Asp (PAL-RGD) decreases the appearance of human facial wrinkles, skin elasticity and dermal density via stimulation of procollagen synthesis and inhibition of matrix metalloproteinase (MMP)-1 expression in human dermal fibroblasts (17). Although collagen degradation within the dermis is considered the primary cause of wrinkles, biological changes in the epidermis and DEJ, such as decreased collagen IV, collagen VII, collagen XVII, integrin β4, and laminin-332, are also reported to affect wrinkle formation (6). In the present study, the effects of PAL-RGD on expression of DEJ components, including laminin-332, collagen IV and collagen XVII in HaCaT keratinocytes was investigated.

 Materials and methods <sec> <title>Reagents

PAL-RGD was purchased from Celltrion Chemical Research Institute. MTT was purchased from Sigma-Aldrich (Merck KGaA). Dulbecco's Modified Eagle's Medium (DMEM), penicillin, streptomycin, PBS, fetal bovine serum (FBS) and trypsin/EDTA were purchased from Gibco (Thermo Fisher Scientific, Inc.).

 Cell culture

The human keratinocyte HaCaT cell line, kindly gifted by Dr Norbert Fusenig of the German Cancer Research Center (Heidelberg, Germany), was cultured in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin at 37°C in a humidified atmosphere with 5% CO2.

 Cell viability assay

Cell viability was determined using MTT assay. Briefly, HaCaT keratinocytes were seeded into a 24-well plate at 5×104 cells/well and incubated at 37°C for 24 h. Following serum starvation at 37°C for 24 h, cells were treated with PAL-RGD (0, 1, 5, 10, 15 and 20 µg/ml) for 48 h in fresh serum-free DMEM at 37°C. MTT was added and cells were incubated at 37°C for 4 h to allow reduction of the MTT reagent to formazan dissolved with DMSO. The absorbance was measured at 570 nm using a VersaMax microplate reader (Molecular Devices, LLC).

 Western blotting

HaCaT cells were seeded into a 6-well plate at 1×106 cells/well and incubated at 37°C for 24 h. Following serum starvation at 37°C for 24 h, the cells were treated with PAL-RGD (0.0, 5.0, 7.5, 10.0, 12.5 and 15.0 µg/ml) at 37°C for 48 h in fresh serum-free DMEM. Cell lysates were prepared using PRO-PREP™ Protein Extraction Solution (Intron Biotechnology, Inc.) and conditioned medium was collected. Protein concentration was determined with the BCA method (Pierce Biotechnology). The 20 µg protein from cell lysate and conditioned media were separated on 4–15% Mini-PROTEAN® TGX™ Precast Gels (Bio-Rad Laboratories, Inc.) and transferred to a nitrocellulose membrane. The membranes were blocked with 5% skimmed milk in Tris-buffered saline for 1 h at room temperature and incubated with primary antibodies overnight at 4°C against laminin α3 (1:500; cat. no. ab151715; Abcam), laminin β3 (1:500; cat. no. sc-133178; Santa Cruz Biotechnology, Inc.), laminin γ2 (1:500; cat. no. MAB19562; MilliporeSigma), collagen type IV (COL4; 1:500; cat. no. AB769; MilliporeSigma), COL17 (1:500; cat. no. ab184996; Abcam) and β-tubulin (1:1,000; cat. no. SC-9104; Santa Cruz Biotechnology, Inc.). After rinsing with TBS + 0.05% Tween-20, the membranes were incubated at room temperature for 2 h with horseradish peroxidase-conjugated anti-goat (cat. no. #605-4302), anti-mouse (cat. no. #610-4302) and anti-rabbit antibodies (all 1:5,000, #611-1302, all Rockland Immunochemicals, Inc.). Membranes were developed with ECL solution (SuperSignal™ West Femto Maximum Sensitivity Substrate, Thermo Fisher Scientific, Inc.). Signals were visualized using the ChemiDoc XRS system (Bio-Rad Laboratories, Inc.) and analyzed with Image Lab 5.0 (Bio-Rad Laboratories, Inc.).

 Reverse transcription-quantitative (RT-q)PCR

Cells were incubated with PAL-RGD (0.0, 5.0, 7.5, 10.0, 12.5 and 15.0 µg/ml) for 2, 4, 8 and 24 h. Total RNA was isolated from cells using RNeasy Mini Kit (Qiagen GmbH) according to the manufacturer's protocol. First-strand complementary DNA (cDNA) synthesis using 1 µg total RNA was performed using SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific, Inc.). qPCR was performed using SYBR Green and StepOnePlus™ Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The final reaction mixture contained 10 ng cDNA, 100 nmol each primer, 10 µl Power SYBR Green PCR Master Mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) and RNase-free water to a final volume of 20 µl. PCR was performed an initial denaturation step at 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and 60°C for 1 min. Dissociation curve was generated to verify the specificity of each reaction. Data were analyzed using the 2−ΔΔCq method and expressed as percent change in gene expression relative to 36B4 (18). The primer sequences are presented in Table I.

 Statistical analysis

Data are presented as the mean ± SD of ≥3 independent experiments. Statistical analysis was performed using SAS 9.4 (SAS Institute, Inc.) software. Statistical significance was calculated using one-way ANOVA followed by two-tailed post hoc Dunnett's multiple comparisons test. P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Effect of PAL-RGD on viability in HaCaT cells

MTT assay was performed to determine optimal PAL-RGD concentration for treatment of cells. PAL-RGD did not induce a significant effect on cell viability at concentrations <15 µg/ml. The cell viability significantly decreased to 67% only at 20 µg/ml Pal-RGD (Fig. 1). For subsequent experiments, the maximum concentration used was 15 µg/ml.

 Effect of PAL-RGD on DEJ protein expression in HaCaT cells

HaCaT cells were treated with PAL-RGD for 48 h. Total protein extracted from cell lysate and conditioned media was analyzed using western blotting. PAL-RGD dose-dependently increased the expression of DEJ proteins (Fig. 2). Treatment with 15 µg/ml PAL-RGD significantly increased protein expression of laminin α3 (167%), laminin β3 (160%), laminin γ2 (209%), collagen IV (141%) and collagen XVII (156%) compared with the control.

 Effect of PAL-RGD on laminin subunit (LAM)A3, LAMB3 and LAMC2 mRNA expression in HaCaT cells

Treatment with PAL-RGD enhanced mRNA expression levels of LAMA3, LAMB3 and LAMC2 in HaCaT cells (Fig. 3). LAMA3 mRNA expression increased in a dose-dependent manner at 2, 4 and 8 h, then decreased to the basal level at 24 h. LAMA3 mRNA expression levels significantly increased at 4 h for all concentrations of PAL-RGD compared with the control. LAMB3 mRNA expression was increased in a dose-dependent manner at 2 h prior to dropping to the basal level at 8 h. The 2 h increase of LAMB3 mRNA expression was significant from 7.5 to 15 µg/ml of PAL-RGD used compared with the control. Furthermore, mRNA expression of LAMC2 significantly increased 2 h after PAL-RGD treatment. At 2 h increase of LAMC3 mRNA expression was significantly for all concentrations of PAL-RGD used compared with the control. The maximum increases in LAMA3, LAMB3 and LAMC2 in response to 15 µg/ml PAL-RGD treatment were significant by 201% (4 h, P<0.0001), 146% (2 h, P=0.0003) and 460% (4 h, P<0.0001) respectively, compared with the control.

 Effect of PAL-RGD on COL4 α 1 chain (COL4A1) and COL17A1 mRNA expression in HaCaT cells

The mRNA expression of COL4A1 and COL17A1 was increased by PAL-RGD treatment in HaCaT cells (Fig. 4). Although unchanged following exposure to PAL-RGD for 2 and 8 h, mRNA expression levels increased in a dose-dependent manner at 24 h. Treatment with 12.5 µg/ml PAL-RGD significantly induced COL4A1 and COL17A1 mRNA levels by 146 and 136%, respectively. The mRNA expression of COL4A1 and COL17A1 in HaCaT cells treated with 15 µg/ml PAL-RGD significantly increased by 153 and 136%, respectively, compared with the control.

 Discussion

In the present study, PAL-RGD treatment increased both mRNA and protein expression levels of DEJ components, such as laminin-332, collagen IV and collagen XVII, in HaCaT keratinocytes. The mRNA expression levels of laminin-332 components increased before 8 h and returned to normal at 24 h; however, protein expression levels in media were significantly increased at 48 h. Laminin-332 is a secreted protein that matures via specific proteolytic processing, which may contribute to the time lag between mRNA expression in cells and protein accumulation in media (19) Previous studies have reported that transforming growth factor-β (TGF-β) upregulates expression of LAMA3, LAMB3, LAMC2, COL4A1 and COL17A1 (20–22). PAL-RGD may induce TGF-β signaling; further studies are required to investigate the signaling pathway underlying the PAL-RGD-mediated upregulation of laminin-332, collagen IV and collagen XVII.

Laminins are glycoproteins composed of three chains (α, β and γ). At least 15 different isoforms exist with a combination of five distinct α, three β and three γ subunits (23,24). The functional domains of LAMs serve distinct roles, such as assembly into trimeric molecules, binding to other ECM molecules and interaction with cell surface receptors. Laminins are involved in various cellular functions, such as cell adhesion, migration, proliferation and differentiation (25). In particular, laminin-332 activates the signaling through integrin α3β1 and α6β4 (26). The binding of laminin-332 and integrin α3β1 activates the mitogen-activated protein kinase signaling pathway, which regulates keratinocyte proliferation (27). Moreover, the interaction between laminin-332 and integrin α3β1 regulates Src kinase signaling through focal adhesion kinase, promoting polarized lamellipodium extension, which regulates keratinocyte migration (28). The interaction between laminin-332 and integrin α6β4 mediates assembly of the hemidesmosome cytoskeleton and recruitment of adaptor proteins Shc/growth factor receptor-bound protein 2 (29). Therefore, PAL-RGD may promote proliferation and migration of keratinocytes by increasing laminin-332 expression.

Collagen IV is a non-fibrillar collagen that constitutes ~50% of the BM, forming a structural scaffold for interactions between BM components, such as laminin networks, perlecan and proteoglycans, during BM assembly (30,31). Other extracellular molecules, including growth factors, laminins, proteoglycans and nidogens, are attached to the scaffolds, where they serve various biological roles, such as cell adhesion, migration, tissue regeneration, wound healing, immobilization of growth factors and enzymes and molecular sieving (32,33). Given these features of collagen and related molecules, PAL-RGD may strengthen BM scaffolds by promoting synthesis of collagen IV.

Collagen XVII is a hemidesmosomal transmembrane protein involved in epidermal-dermal attachment (34). Congenital collagen XVII deficiency results in junctional epidermolysis bullosa and acquired autoimmunity to collagen XVII leads to bullous pemphigoid (35). Furthermore, collagen XVII binds to laminin-332 in hemidesmosomes and collagen IV in the ECM, linking cytoplasmic structural components with ECM (36). Based on these functions of collagen XVII, PAL-RGD may enhance BM assembly by inducing collagen XVII synthesis.

In summary, the present study suggested that PAL-RGD may serve a role in strengthening the DEJ by promoting expression of laminin-332, collagen IV and collagen XVII in keratinocytes. Together with previous studies demonstrating that PAL-RGD decreases facial wrinkles by increasing collagen I and decreasing MMP-1, this compound could improve skin aging by increasing production of components of the DEJ and BM. A limitation of the present study was lack of data on the biological effect of PAL-RGD on the function of the DEJ. Further studies are needed to determine the biological effect of PAL-RGD on the function of the DEJ.

 Acknowledgements

Not applicable.

 Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

 Authors' contributions

JHL conceived and designed the study, performed experiments, collected the data and wrote the manuscript. JSB designed the study, performed experiments and revised the manuscript. JHL and JSB confirm the authenticity of all the raw data. SKL conceived the study and revised the manuscript. DHL interpreted the data and revised the manuscript. All authors discussed the results. All authors have read and approved the final manuscript.

 Ethics approval and consent to participate

Not applicable.

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References BurgesonREChristianoAMThe dermal-epidermal junctionCurr Opin Cell Biol9651658199710.1016/S0955-0674(97)80118-49330868 Roig-RoselloERoussellePThe human epidermal basement membrane: A shaped and cell instructive platform that aging slowly altersBiomolecules101607202010.3390/biom1012160733260936 MarionnetCVioux-ChagnoleauCPierrardCSokJAsselineauDBernerdFMorphogenesis of dermal-epidermal junction in a model of reconstructed skin: Beneficial effects of vitamin CExp Dermatol15625633200610.1111/j.1600-0625.2006.00454.x16842601 LavkerRMZhengPDongGAged skin: A study by light, transmission electron, and scanning electron microscopyJ Invest Dermatol88(3 Suppl)44s51s198710.1111/1523-1747.ep124689343546515 VázquezFPalaciosSAlemañNGuerreroFChanges of the basement membrane and type IV collagen in human skin during agingMaturitas25209215199610.1016/S0378-5122(96)01066-38981338 LangtonAKHalaiPGriffithsCESherrattMJWatsonREThe impact of intrinsic ageing on the protein composition of the dermal-epidermal junctionMech Ageing Dev1561416201610.1016/j.mad.2016.03.00627013376 MondonPHillionMPeschardOAndreNMarchandTDoridotEFeuilloleyMGPionneauCChardonnetSEvaluation of dermal extracellular matrix and epidermal-dermal junction modifications using matrix-assisted laser desorption/ionization mass spectrometric imaging, in vivo reflectance confocal microscopy, echography, and histology: Effect of age and peptide applicationsJ Cosmet Dermatol14152160201510.1111/jocd.1213525817264 Contet-AudonneauJLJeanmaireCPaulyGA histological study of human wrinkle structures: Comparison between sun-exposed areas of the face, with or without wrinkles, and sun-protected areasBr J Dermatol14010381047199910.1046/j.1365-2133.1999.02901.x10354068 VarletBLChaudagneCBarréPSauvageCBerthoulouxBMeybeckADumasMSaunoisABontéFAge-related functional and structural changes in human dermo-epidermal junction componentsJournal of Investigative Dermatology Symposium ProceedingsVol. 3Elsevier172179199810.1038/jidsymp.1998.349734834 IshiharaJIshiharaAFukunagaKSasakiKWhiteMJVBriquezPSHubbellJALaminin heparin-binding peptides bind to several growth factors and enhance diabetic wound healingNat Commun92163201810.1038/s41467-018-04525-w29867149 IorioVTroughtonLDHamillKJLaminins: Roles and utility in wound repairAdv Wound Care (New Rochelle)4250263201510.1089/wound.2014.053325945287 ChungHJUittoJType VII collagen: The anchoring fibril protein at fault in dystrophic epidermolysis bullosaDermatol Clin2893105201010.1016/j.det.2009.10.01119945621 WatanabeMNatsugaKNishieWKobayashiYDonatiGSuzukiSFujimuraYTsukiyamaTUjiieHShinkumaSType XVII collagen coordinates proliferation in the interfollicular epidermisElife6e26635201710.7554/eLife.2663528693719 JeongSYoonSKimSJungJKorMShinKLimCHanHSLeeHParkKYAnti-wrinkle benefits of peptides complex stimulating skin basement membrane proteins expressionInt J Mol Sci2173201910.3390/ijms2101007331861912 AmanoSPossible involvement of basement membrane damage in skin photoagingJournal of Investigative Dermatology Symposium ProceedingsVol. 14Elsevier27200910.1038/jidsymp.2009.519675545 KusumaningrumNOhJHLeeDHShinCYJangJHKimYKChungJHTopical treatment with a cathepsin G inhibitor, β-keto-phosphonic acid, blocks ultraviolet irradiation-induced basement membrane damage in hairless mouse skinPhotodermatol Photoimmunol Photomed35148156201910.1111/phpp.1243830414203 BaeJSKimJMKimJYChoiCHKimJYMoonWKLeeMSMoonSHLimJHParkSJTopical application of palmitoyl-RGD reduces human facial wrinkle formation in Korean womenArch Dermatol Res309665671201710.1007/s00403-017-1763-y28752204 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.126211846609 PetersBPHartleRJKrzesickiRFKrollTGPeriniFBalunJEGoldsteinIJRuddonRWThe biosynthesis, processing, and secretion of laminin by human choriocarcinoma cellsJ Biol Chem260147321442198510.1016/S0021-9258(17)38634-93840485 KorangKChristianoAMUittoJMauvielADifferential cytokine modulation of the genes LAMA3, LAMB3, and LAMC2, encoding the constitutive polypeptides, alpha 3, beta 3, and gamma 2, of human laminin 5 in epidermal keratinocytesFEBS Lett368556558199510.1016/0014-5793(95)00740-Z7635220 FeruJDelobbeERamontLBrassartBTerrynCDupont-DeshorgueAGarbarCMonboisseJCMaquartFXBrassart-PascoSAging decreases collagen IV expression in vivo in the dermo-epidermal junction and in vitro in dermal fibroblasts: Possible involvement of TGF-β1Eur J Dermatol26350360201610.1684/ejd.2016.278227124123 HuilajaLHurskainenTAutio-HarmainenHHofmannSCSormunenRRäsänenJIlvesMFranzkeCWBruckner-TudermanLTasanenKPemphigoid gestationis autoantigen, transmembrane collagen XVII, promotes the migration of cytotrophoblastic cells of placenta and is a structural component of fetal membranesMatrix Biol27190200200810.1016/j.matbio.2007.10.00718055190 SugawaraKTsurutaDIshiiMJonesJCKobayashiHLaminin-332 and −511 in skinExp Dermatol17473480200810.1111/j.1600-0625.2008.00721.x18474082 MinerJHYurchencoPDLaminin functions in tissue morphogenesisAnnu Rev Cell Dev Biol20255284200410.1146/annurev.cellbio.20.010403.09455515473841 TsurutaDKobayashiHImanishiHSugawaraKIshiiMJonesJCLaminin-332-integrin interaction: A target for cancer therapy?Curr Med Chem1519681975200810.2174/09298670878513283418691052 KariyaYGuJRoles of laminin-332 and alpha6beta4 integrin in tumor progressionMini Rev Med Chem912841291200910.2174/13895570978987811419929806 GonzalesMHaanKBakerSEFitchmunMTodorovIWeitzmanSJonesJCA cell signal pathway involving laminin-5, alpha3beta1 integrin, and mitogen-activated protein kinase can regulate epithelial cell proliferationMol Biol Cell10259270199910.1091/mbc.10.2.2599950675 ChomaDPMilanoVPumigliaKMDiPersioCMIntegrin alpha3beta1-dependent activation of FAK/Src regulates Rac1-mediated keratinocyte polarization on laminin-5J Invest Dermatol1273140200710.1038/sj.jid.570050516917494 MainieroFPepeAWaryKKSpinardiLMohammadiMSchlessingerJGiancottiFSignal transduction by the alpha 6 beta 4 integrin: Distinct beta 4 subunit sites mediate recruitment of Shc/Grb2 and association with the cytoskeleton of hemidesmosomesEMBO J1444704481199510.1002/j.1460-2075.1995.tb00126.x7556090 PöschlESchlötzer-SchrehardtUBrachvogelBSaitoKNinomiyaYMayerUCollagen IV is essential for basement membrane stability but dispensable for initiation of its assembly during early developmentDevelopment13116191628200410.1242/dev.0103714998921 BrownKLCummingsCFVanacoreRMHudsonBGBuilding collagen IV smart scaffolds on the outside of cellsProtein Sci2621512161201710.1002/pro.328328845540 GoodMCZalatanJGLimWAScaffold proteins: Hubs for controlling the flow of cellular informationScience332680686201110.1126/science.119870121551057 TrappmannBGautrotJEConnellyJTStrangeDGLiYOyenMLCohen StuartMABoehmHLiBVogelVExtracellular-matrix tethering regulates stem-cell fateNat Mater11642649201210.1038/nmat333922635042 NishimuraMNishieWShirafujiYShinkumaSNatsugaKNakamuraHSawamuraDIwatsukiKShimizuHExtracellular cleavage of collagen XVII is essential for correct cutaneous basement membrane formationHum Mol Genet25328339201610.1093/hmg/ddv47826604146 NatsugaKWatanabeMNishieWShimizuHLife before and beyond blistering: The role of collagen XVII in epidermal physiologyExp Dermatol2811351141201910.1111/exd.1355029604146 KamaguchiMIwataHNishieWToyonagaEUjiieHNatsugaKKitagawaYShimizuHThe direct binding of collagen XVII and collagen IV is disrupted by pemphigoid autoantibodiesLab Invest994857201910.1038/s41374-018-0113-930089857

Effect of PAL-RGD on viability of HaCaT keratinocytes. Cells were incubated with PAL-RGD for 48 h. Data are presented as the mean ± SD of three independent experiments. *P<0.05 vs. 0. PAL-RGD, palmitoyl-Arg-Gly-Asp.

Effect of PAL-RGD on dermal-epidermal junction proteins in HaCaT keratinocytes. (A) Representative images of western blotting of cell lysate and conditioned media. Protein expression levels of (B) laminin α3, (C) laminin β3, (D) laminin γ2, (E) collagen IV and (F) collagen XVII following treatment with PAL-RGD. Protein expression levels were normalized β-tubulin. Data are presented as the mean ± SD of four independent experiments. *P<0.05, **P<0.01 and ***P<0.001 vs. 0.0. PAL-RGD, palmitoyl-Arg-Gly-Asp.

Effect of PAL-RGD on expression of genes encoding LAM-332 in HaCaT keratinocytes. The mRNA expression levels of (A) LAMA3, (B) LAMB3 and (C) LAMC2 following treatment with PAL-RGD. Data are presented as the mean ± SD of three independent experiments. *P<0.05, **P<0.01 and ***P<0.001 vs. 0. PAL-RGD, palmitoyl-Arg-Gly-Asp; LAM, laminin subunit.

Effect of PAL-RGD on expression of COL4A1 and COL17A1 in HaCaT keratinocytes. mRNA expression levels of (A) COL4A1 and (B) COL17A1 following PAL-RGD treatment. Data are presented as the mean ± SD of three independent experiments. **P<0.01 vs. 0. PAL-RGD, palmitoyl-Arg-Gly-Asp; COL4A1, collagen type IV α 1 chain; COL17A1, collagen type XVII α 1 chain.

Primer sequences used for reverse transcription-quantitative PCR.

Gene Sequence, 5′-3′
LAMA3 F: CAATTCTGAAGACCCCAGGA
R: TCCAAGACCCAAAGATCAGG
LAMB3 F: CAGATTGGGTTGGAATGCTT
R: CCCAGCTTCCTTGACTTGAG
LAMC2 F: GGCTGGTCTTACTGGAGCAG
R: TATGGCAGCTTCACTGTTGC
Col4A1 F: CTGGTCCAAGAGGATTTCCA
R: TCATTGCCTTGCACGTAGAG
COL17A1 F: TCTGCCTACAGCAACGTGAC
R: CTCACGGCTTGACAGCAATA
36B4 F: TCGACAATGGCAGCATCTAC
R: TGATGCAACAGTTGGGTAGC

LAM, laminin subunit; COL4A1, collagen type IV α 1 chain; COL17A1, collagen type XVII α 1 chain; F, forward; R, reverse.