Human umbilical vein endothelial cells (HUVECs) were purchased from ScienCell Research Laboratories, Inc. and cultured in EC medium containing EC growth supplement (ScienCell Research Laboratories, Inc.), 5% fetal bovine serum (FBS; ScienCell Research Laboratories, Inc.), 100 U/ml penicillin and 100 U/ml streptomycin in 37°C. HUVECs at passages 3–5 were used for all experiments. Tan 2A was purchased from Selleck Chemicals (Cat. no. S2365, Lot no. S2767130005001). DMSO (sigma-Aldrich; Merck KGaA) was used as vehicle control. Lipofectamine™ RNAiMAX Transfection Reagent and Lipofectamine^® 3000 Transfection Reagent were purchased from Invitrogen (Thermo Fisher Scientific, Inc.). Antibody against GLUT-1 (ab115730, 1:2,000) was purchased from Abcam. Antibodies against HIF-1α (#36169, 1:1,000), RBPJκ (#5313, 1:1,000) and GAPDH (#5174, 1:2,000) and horseradish peroxidase-conjugated goat anti-rabbit (#7074, 1:2,000) or anti-mouse secondary antibodies (#7076, 1:2,000) were purchased from Cell Signaling Technology, Inc.

Small interfering (si)RNAs targeting human GLUT-1, HIF-1α and recombination signal-binding protein for immunoglobulin κ J region (RBPJκ) were synthesized by Shanghai GenePharma Co., Ltd. siRNA (100 nM) were transfected into cells using Lipofectamine RNAiMAX Transfection Reagent in room temperature for 10 min. About 48 h later, the cells were extracted for RNA or protein detection. Scrambled siRNA was used as a negative control (Shanghai GenePharma Co., Ltd.). siRNA sequences are presented in Table SI.

Total cellular RNA was extracted using RNAiso Plus (Code No.: 9109, Takara Biotechnology Co., Ltd.). Complementary (c)DNA was synthesized from total RNA using PrimeScript RT reagent Kit with gDNA Eraser (Takara Biotechnology Co., Ltd. TKR-RR047) as follows: 42°C for 2 min, 37°C for 15 min and then 85°C for 5 sec. Primer sequences are presented in Table SI. qPCR was performed using SYBR-Green Master Mix (Takara Biotechnology Co., Ltd.). The thermocycling conditions were as follows: Pre-denaturation at 94°C for 5 sec; followed by 40 cycles of denaturation, 95°C for 5 sec, annealing at 60°C and extension for 34 sec. The 18s rRNA was used as an internal control (Sangon Biotech Co., Ltd.). The mRNA expression level of each target gene was determined using the 2^−ΔΔCq method (22).

The DNA fragment containing the hypoxia-responsive element (HRE) sequence (TGTCACGTCCTGCACGACTCTAGT) was subcloned into the pGL3 basic reporter vector (Promega Corporation). The plasmid luciferase reporters were electroporated into HUVECs using an ECM 839 Electroporation System (Harvard Apparatus) as previously reported (23). Briefly, HUVECs were resuspended in EC medium (without serum; ScienCell Research Laboratories, Inc.), 20 µg plasmid was added and mixed in MicroPulse Cuvettes (0.4 cm, Bio-Rad). The cuvettes are one-piece injection molded chambers with embedded aluminum electrodes and square sealing caps. An electrical pulse (160 mA, 1 ms, 1 pulse) was applied. Cells (2×10⁴) were then seeded in 24 wells plates immediately using EC medium at room temperature for 24 h. The transactivation activity was analyzed using the Dual-Luciferase Reporter Assay System (Promega Corporation) according to the manufacturer's instructions. Briefly, 1X Passive Lysis Buffer was dispensed into each culture vessel for 15 min at room temperature. Then the cell lysis was mixed with Luciferase Assay Substrate and measured firefly luciferase activity in GloMax 20/20 Luminometer (Promega).

HUVECs were lysed with RIPA buffer (Thermo Fisher Scientific, Inc.) with protease inhibitors (Cell Signaling Technology, Inc.). The protein concentration was determined using the bicinchoninic acid protein assay (Thermo Fisher Scientific, Inc.). A total of 20 µg/lane protein sample was resolved on 10% SDS-PAGE and electrotransferred to polyvinylidene fluoride membranes. The immunoblots were blocked with 5% BSA (Sangon Biotech Co., Ltd) for 1 h at room temperature, and probed with the aforementioned antibodies overnight at 4°C, followed by incubation with the corresponding secondary antibodies for 1 h at room temperature. Subsequently, the membranes were washed with TBS-Tween (0.1%) three times, 10 min each. The blots were visualized using Clarity Western ECL Substrate (Bio-Rad Laboratories, Inc.). GAPDH was used as an internal reference. Densitometry analysis was performed using ImageJ (V1.8.0.112; National Institutes of Health).

Glucose uptake assay was performed using the Colorimetric Glucose Uptake Assay kit (Abcam) according to the manufacturer's protocol. Briefly, 2-deoxyglucose (2-DG) was added to HUVECs and incubated for 20 min at 37°C. After 2-DG was taken up by glucose transporters and metabolized to 2-DG-6-phosphate, the cells were washed with phosphate-buffered saline (PBS) to remove exogenous 2-DG. Cells were lysed using repeated pipetting, freeze/thaw and heating at 85°C for 40 min. The level of 2-DG-6-phosphate in each sample was determined by enzymatic recycling amplification reaction and analyzed using a microplate reader (optical density, 412 nm) in kinetic mode at 37°C.

HUVEC protein was collected using Pierce™ IP lysis buffer (Thermo Fisher Scientific, Inc.) and centrifugation at 12,000 g, 4°C for 10 min, supernatant including protein were collected. Protein lysate (400 µg) was immunoprecipitated with the RBPJκ antibody (2 µg/well; CST, Inc.; cat. no. #5313) or control Rabbit IgG control Polyclonal antibody (2 µg/well; ProteinTech Group, Inc.; cat. no. 30,000-0-AP) bound to Dynabeads Protein G (50 µl/tube) by using Immunoprecipitation Kit-Dynabeads Protein G (Thermo Fisher Scientific, Inc.) according to manufacturer's instructions. Completes were isolated by addition of 20 µl IP lysis buffer (Thermo Fisher Scientific, Inc.) and 5 µl SDS-PAGE SDS Sample Loading Buffer (5X, Beyotime, cat. no. P0015L) and heat for 5 min at 100°C, then place the tube on the DynaMag-Spin (Thermo Fisher, cat. 12320D) and load the supernatant/sample onto a gel and assessed using western blotting as per the aforementioned method.

ChIP assay was performed according to the manufacturer's instructions using Magna ChIP G-Chromatin Immunoprecipitation kit; cat. no. 17-611; Millipore). Briefly, HUVECs were treated with Tan 2A (20 µM) for 16 h in 37°C. 275 µl 37% formaldehyde (Sangon Biotech Co., Ltd.) was added to 10 ml of growth media to cross-link protein to chromatin for 10 min at room temperature, then quenched with glycine at a final concentration of 125 mM immediately at room temperature for 5 min. Cells were harvested in cold PBS. The cellular nuclear pellets were resuspended with sonication buffer. The resulting cell suspension was sheared by sonication (MiSonix Sonicator 3000) on ice using 30/30-sec on/off for 10 min (Output Power: 4). ChIP assay was performed using 1.5 µg Rabbit IgG (1.15 mg/ml, ProteinTech Group, 30000-0-AP) or anti-HIF-1α antibodies (CST, #14179) bounded to the Magnetic Protein G beads. Each IP requires the addition of 500 µl Dilution Buffer. Wash the Protein G bead-antibody/chromatin complex by resuspending beads in 0.5 ml each of the cold buffers in the order listed below [Low Salt Immune Complex Wash Buffer (cat.# 20-1 54), High Salt Immune Complex Wash Buffer (cat.# 20-1 55), High Salt Immune Complex Wash Buffer (cat.# 20-1 55), High Salt Immune Complex Wash Buffer (cat.# 20-1 55)]. The DNA fragment containing the HRE site was amplified by qPCR (SYBR-Green Master Mix, Takara Biotechnology Co., Ltd.) using the following primers: forward: 5′-TGGGAAAAGGCATAGACTGG-3′, reverse: 5′-ATGCACGAATGAGTGAGCAG-3′) specific for the HRE site were synthesized for this purpose. Reference gene primer sequences are as follows: forward: 5′-GTAACCCGTTGAACCCCATT-3′, reverse: 5′-CCATCCAATCGGTAGTAGCG-3′. PCR conditions were Pre-denaturation, 94°C for 5 sec; followed by 40 cycles of denaturation, 95°C for 5 sec, annealing at 60°C and extension for 34 sec. The DNA expression level of each target gene was determined using the 2-ΔΔCq method (22).

Total RNA was extracted using mirVana miRNA Isolation Kit (Ambion) following the manufacturer's protocol. RNA purity and quantification were evaluated using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). RNA integrity was assessed using an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc.). Libraries were constructed. The transcriptome sequencing and analysis were performed by OE Biotech Co. Ltd. The libraries were constructed using TruSeq Stranded mRNA LTSample Prep Kit (RS-122-2101/RS-122-2102/RS-122-2103, Illumina, Inc.) according to the manufacturer's instructions. A total of 10 pM loading concentration was used. Sequencing kits were as follows: NovaSeq 6000 S4 Reagent Kit V1.5 (300 cycles; Illumina, Inc., Catalog no. 20028312) and NovaSeq Xp 4-Lane kit v1.5 (Illumina, Inc., cat. no. 20043131). The libraries were sequenced on the Illumina sequencing platform (Illumina HiSeq X Ten) and 125 or 150 bp paired-end reads were generated. Fragments Per Kilobase of transcript per million fragments mapped value of each gene was calculated using cufflinks and read counts of each gene were obtained by HTSeqcount. Differential expression analysis was performed using the DESeq2 (1.20.0) R package. P<0.05 and fold-change >2 or <0.5 was set as the threshold for significantly different expression.

Hierarchical cluster analysis of differentially expressed genes was performed to explore genes expression pattern. Gene Ontology (GO, http://geneontology.org/) enrichment and Kyoto encyclopedia of genes and genome (KEGG, http://www.genome.jp/kegg/) pathway enrichment analysis of differentially expressed genes were performed using R (R-v3.4.2, r-project.org) based on the hypergeometric distribution. GO datasets used in this research were as follows: response to hypoxia (GO:0001666), regulation of GPCR signaling (GO:0008277), protein homooligomerization (GO:0051260), brain development (GO:0007420), angiogenesis (GO:0001525), negative regulation of cell proliferation (GO:0008285), positive regulation of cell proliferation (GO:0008284), GPCR signaling (GO:0007186), transcription from RNA pol 2 promoter (GO:0045944), transcription, DNA-templated (GO:0006351).

The data are presented as the mean ± SEM. Each experiment was independently repeated three times. Statistical significance was calculated using one-way ANOVA and Tukey's multiple comparison test for ≥3 groups. Unpaired Student's t-test was used for comparison between two groups. P<0.05 was considered to indicate a statistically significant difference.

To assess the effect of Tan 2A on GLUT-1 expression, HUVECs, a commonly used model for ECs (24), were treated with Tan 2A at 0, 15 and 30 µM for 24 h and 15 µM for 24 and 36 h. RT-qPCR results demonstrated that mRNA expression levels of GLUT-1 in HUVECs exposed to 15 µM Tan 2A increased significantly at 24 and 36 h compared with 0 h control (Fig. 1A). The relative mRNA expression levels of GLUT-1 increased significantly to 3.18±0.32 and 3.65±0.51 following 15 and 30 µM treatment for 24 h, respectively, compared with the 0 h control. And (Fig. 1B). Furthermore, GLUT-1 protein expression levels were assessed using western blotting. The protein expression levels were consistent with the mRNA expression levels of GLUT-1, also exhibiting upregulation by Tan 2A (Fig. 1C and D). Moreover, endothelial glucose uptake was assessed using glucose analog 2-DG. Glucose uptake in HUVECs was significantly enhanced by Tan 2A compared with DMSO control (Fig. 1E). siRNA mediated knockdown of GLUT-1 was evaluated using RT-qPCR and western blotting (Fig. 1F, G), there was a significant decrease compared with the scrambled siRNA. GLUT-1 knockdown significantly decreased the promotive effect of Tan 2A on glucose uptake compared to the scrambled siRNA control (Fig. 1H). These result demonstrated that Tan 2A induced expression of GLUT-1 and thus promoted glucose uptake in HUVECs.

RNAseq was used to evaluate the potential mechanisms of the aforementioned effect of Tan 2A in HUVECs. Gene Ontology analysis demonstrated that ‘response to hypoxia’ was markedly induced by Tan 2A (Fig. 2A). Kyoto Encyclopedia of Genes and Genomes enrichment analysis demonstrated that genes were markedly enriched in ‘HIF-1α signaling pathway’ (Fig. 2B). Furthermore, RNA-seq analysis demonstrated that seven genes were differentially expressed (>1.5 fold) in ‘HIF-1 signaling pathway’, including GLUT-1, vascular endothelial growth factor A (VEGFA), BCL2 interacting protein 3 (BNIP3) and enolase 2 (ENO2) in HUVECs (Fig. 2C). The results of the RNAseq were evaluated using RT-qPCR. There were significant increases in mRNA expression levels of VEGF, BNIP3 and ENO2 following treatment with Tan 2A compared with the control (Fig. 2D-F). Knockdown of HIF-1α significantly inhibited Tan 2A-induced mRNA expression of GLUT-1, VEGFA, BNIP3 and ENO2 in HUVECs (Fig. 2G-K). Western blotting demonstrated that Tan 2A-induced protein expression of GLUT-1 was also significantly reversed by HIF-1α knockdown (Fig. 2L). These results suggested that Tan 2A regulated GLUT-1 expression in HUVECs via the HIF-1α signaling pathway.

To assess regulation of HIF-1α by Tan 2A in HUVECs, luciferase reporter assay was performed using constructs with the regulatory region of the HRE. The HRE displayed significantly increased luciferase activity in response to Tan 2A compared with the control (Fig. 3A). ChIP assay was performed to assess the regulatory effect of Tan 2A on the binding ability of HIF-1α to the potential HRE within the promoter region of the GLUT-1 gene and demonstrated that binding of HIF-1α to the promoter region of GLUT-1 gene was significantly enhanced by Tan 2A in HUVECs (Fig. 3B). HIF-1α is hydroxylated by prolyl hydroxylases (25). RT-qPCR demonstrated that Tan 2A significantly increased expression of EGL-9 family hypoxia inducible factor 3 (EGLN3), which belongs to prolyl hydroxylase family, compared with the control, these data suggested that EGLN3 mediated Tan 2A-induced activation of HIF-1α in HUVECs (Fig. 3C). These results showed Tan 2A induced HIF-1/HRE pathway in HUVECs.

RBPJκ binds with HIF-1α to regulate expression of downstream target genes, such as VEGFA (26). Whether RBPJκ mediates Tan 2A-regulated expression of GLUT-1 was therefore examined. RT-qPCR demonstrated that knockdown of RBPJκ significantly inhibited Tan 2A-induced mRNA expression of GLUT-1, BNIP3 and ENO2 in HUVECs (Fig. 4A-D). Furthermore, Tan 2A markedly decreased protein expression levels of GLUT-1, as demonstrated by western blotting (Fig. 4E). These data suggested that RBPJκ potentiated Tan 2A-induced GLUT-1 expression in HUVECs.

It has been reported that RBPJκ physically interacts with HIF protein (27). Whether Tan 2A regulates coupling between HIF-1 and RBPJκ was assessed. Western blotting of Co-IP samples demonstrated that HIF-1α was co-immunoprecipitated with RBPJκ, which suggested a physical interaction between the proteins. Furthermore, Tan 2A treatment markedly enhanced the physically interaction of RBPJκ with HIF-1α (Fig. 5).