Contributed equally
Although great progress has been made in the early diagnosis and targeted therapy of lung adenocarcinoma (LUAD), the survival of patients with LUAD remains unsatisfactory. There is an urgent requirement for new biomarkers to guide the diagnosis, prognosis and treatment of LUAD. Following an initial bioinformatics screen, the present study focused on cyclin B1 (CCNB1) in LUAD. A total of 94 patients with LUAD from a single hospital were included in the study. CCNB1 protein expression was detected and scored in 94 LUAD samples and 30 normal tissue samples by immunohistochemistry. The associations between CCNB1 expression and the clinicopathological features of the patients with LUAD were analyzed. Furthermore, the relationship between prognosis and the CCNB1 expression level was analyzed using Cox regression and survival analyses. Weighted gene co-expression network analysis and RNA-sequencing were also applied to identify the potential molecular mechanisms of CCNB1 in LUAD. CCNB1 was highly expressed in patients with LUAD and was associated with poor prognosis. It may affect the expression of CPLX1, PPIF, SRPK2, KRT8, SLC20A1 and CBX2 genes and function via different pathways. CCNB1 has the potential to become a novel prognostic target for LUAD.
Lung cancer is the most common malignancy with the highest mortality rate worldwide (
Cyclins are proteins that bind to cyclin-dependent kinases (CDKs) and thereby regulate the cell division cycle (
A study revealed that in lung cancer, the CCNB1 expression level is upregulated and higher levels of CCNB1 indicate poorer survival outcomes (
However, the clinical characteristics of CCNB1 in lung cancer, particularly LUAD, remain unclear, and its potential mechanism requires further exploration. Therefore, in the present study, the expression of CCNB1 in LUAD was analyzed and its association with the clinicopathological features and prognosis of patients with LUAD was explored. Furthermore, the molecular mechanism of CCNB1 and its use in the prognosis of LUAD were preliminarily investigated.
The RNA-sequencing (RNA-seq) data and clinical data of 535 LUAD samples and 59 normal samples were downloaded from The Cancer Genome Atlas (TCGA;
Pathway enrichment analysis of differential genes (DEGs) was performed using the KEGG (
WGCNA involves the construction of a weighted gene expression network that represents the associations between different genes and can be used to identify highly coordinated gene sets. In the present study, the expression data of the DEGs were used to construct a gene co-expression network using the WGCNA R package (version 3.6.0;
LUAD tissue samples were collected from 94 patients undergoing surgical resection in the Department of Thoracic Surgery of the Affiliated Hospital of Zunyi Medical University (Zunyi, China) between January 2010 and August 2015. The patients included 54 females and 40 males. The oldest was 76 years old and the youngest was 21 years old, and the media age was 57 years. Due to the collection of normal lung tissue being challenging, and paracancerous tissue being different from normal tissue and potentially having different biological properties, an independent normal lung tissue series was used as a control for the institutional LUAD tissues (
The LUAD tumor tissues were fixed in 4% paraformaldehyde for 24 h at room temperature, dehydrated with graded ethanol and cleared with xylene. After embedding in paraffin, the tumor tissues were sectioned into 4-µm slices. The paraffin sections were dewaxed with xylene and hydrated with gradient ethanol using standard procedures. After treatment with citrate buffer (pH 6.0) for antigen retrieval at 95°C for 12 min, the slices were incubated with 3% hydrogen peroxide for 10 min at room temperature to block endogenous peroxidase activity and 5% goat serum (Beijing Solarbio Science & Technology Co., Ltd.) for 30 min at 25°C to block non-specific binding sites. The sections were then incubated with the primary antibody anti-cyclin B1 (cat. no. TA374365; OriGene Technologies, Inc.) at a dilution of 1:300 overnight at 4°C. After warming for 1 h at room temperature, the sections were washed three times in PBS and then incubated with the undiluted secondary antibody goat anti-rabbit IgG-HRP (PV-9000; OriGene Technologies, Inc.) at 37°C for 20 min. The primary antibody was replaced with PBS to serve as the negative control. Finally, the sections were stained with DAB and imaged under a light microscope (DM3000; Leica Microsystems GmbH).
The IHC results were independently assessed by two experienced pathologists from Zunyi Medical University who were blinded to the clinical data of the patients. Five random fields from each section were observed under an optical microscope at ×200 magnification. The expression of CCNB1 was scored according to the percentage of positive tumor cells and the staining intensity. The percentage of positive cells was scored according to the following criteria: 0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%) and 4 (76–100%). The staining intensity was scored as follows: 0 (no staining), 1 (light yellow), 2 (brownish) and 3 (tan). The staining intensity score and the percentage of positive staining were summed to obtain the final score, with a total score >2 defined as positive expression and ≤2 defined as negative expression.
The PC9, A549, H1299 and H827 LUAD cell lines were purchased from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences, and stored in the Cancer Research Laboratory of the Affiliated Hospital of Zunyi Medical University. The cells were cultured in RPMI-1640 (HyClone; Cytiva) supplemented with 10% fetal bovine serum (Shanghai XP Biomed Ltd.) and 100X Penicillin-Streptomycin Solution (Sangon Biotech Co., Ltd.) at 37°C with 5% CO2. Small interfering RNAs (siRNAs) purchased from Sangon Biotech Co., Ltd. were used to knock down CCNB1. The sequences were as follows: CCNB1-PLVT7 forward, CTTGAGTTGGAGTACTATATT and reverse, AATATAGTACTCCAACTCAAG; CCNB1-PLVT8 forward, GGTTGTTGCAGGAGACCATGT and reverse, ACATGGTCTCCTGCAACAACC; CCNB1-PLVT9 forward, GATCGGTTCATGCAGAATAAT and reverse, ATTATTCTGCATGAACCGATC; negative-PLVT forward, TTCTCCGAACGTGTCACGT and reverse, ACGTGACACGTTCGGAGAA. Cells were transfected with siRNAs targeting CCNB1 or non-sense control siRNA using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Briefly, the LUAD cells were seeded at a density of 1.5×105 in a 6-well plate. Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) was used to transfect the siRNAs into H1299 cell lines to select the most efficient one for subsequent use (CCNB1-PLVT7, CCNB1-PLVT8, CCNB1-PLVT9). Following the standard protocol, siR-NC or siR-CCNB1 (100 pmol/well; Shanghai GeneChem Co., Ltd.) was transfected into H1299 cell lines. After 6 h of culture at 37°C, the medium was replaced with DMEM containing 10% FBS. After cultivation for 72 h at 37°C, the cells were collected for further assays.
Total RNA was extracted from LUAD cells using RNAiso Plus reagent (Takara Bio, Inc.) according to the manufacturer's protocol, and cDNAs were reverse transcribed using a PrimeScript™ RT reagent Kit (Perfect Real Time) (Takara Bio, Inc.) at 37°C for 15 min. qPCR was performed with an ABI Prism 7500 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and a ChamQ™ Universal SYBR qPCR Master Mix Kit (Vazyme Biotech Co., Ltd.) was used to quantify the expression of CCNB1 and GAPDH. qPCR was initiated at 95°C for 3 min, followed by 40 cycles at 95°C for 20 sec and 60°C for 30 sec. GAPDH expression was used as the internal control, and the relative quantification of gene expression was calculated using the 2−ΔΔCq method (
Total RNA was extracted from the LUAD cells using RNAiso Plus reagent (Takara Bio, Inc.) according to the manufacturer's protocol. Samples with RNA an optical density ratio 260 and 280 nm of >1.8 were subjected to subsequent analyses. Libraries were constructed using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina®; cat. no. RS-122-2101.) according to the manufacturer's instructions. The loading concentration of 30 ng/µl was measured by library quantification using Thermo Fisher Qubit Flex (Thermo Fisher Scientific, Inc.), and then the library was sequenced with a NovaSeq 6000 S4 Rgt Kit (20028312) on an Illumina sequencing platform (NovaSeq 6000; Illumina, Inc.), and 150 bp paired-end reads were generated. Base calling was performed with RTA v2.7.6 (Illumina, Inc.), and the fastq files were generated by bcl2fastq v2.15.0 (Illumina, Inc.). Removal of low-quality bases and adapters from paired-end reads was processed by fastp v0.22.0 (
The datasets were mainly analyzed using R package software (version 3.6.0;
To investigate the expression of CCNB1 in LUAD, data from the TCGA and GEO databases were analyzed. The mRNA expression of CCNB1 was significantly increased in LUAD tissues compared with normal lung tissues in both datasets (P<0.05;
The prognostic value of CCNB1 was assessed using TCGA-LUAD data. Kaplan-Meier survival curves were plotted to evaluate the relationship between CCNB1 and the prognosis of patients with LUAD. As shown in
The relationship between CCNB1 expression levels and the clinicopathological parameters of 334 patients in the TCGA-LUAD dataset were investigated. As shown in
To detect the expression level of CCNB1
CCNB1 has been shown to interact with other genes to promote the occurrence and development of tumors (
In the present study, clinical samples and bioinformatics methods were used to show that CCNB1 is highly expressed in LUAD tissues. Kaplan-Meier survival curves and multivariate Cox regression analysis confirmed that CCNB1 is an independent prognostic factor for patients with LUAD. Higher CCNB1 expression predicted worse overall survival, indicating that CCNB1 is an oncogene. However, CCNB1 expression was not found to be associated with any clinicopathological parameters. Integration of the results of RNA-seq and WGCNA analyses to identify intersecting genes indicated that CCNB1 may cooperate with CPLX1, PPIF, SRPK2, KRT8, SLC20A1 and CBX2 to affect the prognosis of patients with LUAD. In addition, GO and KEGG pathway analyses showed that a reduction in CCNB1 expression induces changes in different pathways.
Although the exact mechanism of CCNB1 upregulation is unclear, CCNB1 is known to be essential for the survival and proliferation of tumor cells; upregulated CCNB1 binds to its partner CDKs and promotes cancer cell growth (
Furthermore, the associations between CCNB1 expression and clinicopathological parameters were analyzed in the present study using TCGA data and the immunohistochemical results of 94 patients with LUAD. However, as there were no positive findings, CCNB1 appears to be a relatively independent expression factor. Similar findings have been reported in previous studies on breast cancer (
The mechanism of CCNB1 in LUAD was further explored in the present study by knocking down the expression of CCNB1 in H1299 cells and performing RNA-seq to detect the changes in gene expression at the transcriptional level. The GO and KEGG analysis results showed that the knockdown of CCNB1 caused changes in pathways associated with cytoskeleton-related proteins, the formation of focal adhesions, Ras GTPase binding and small GTPase binding. The increased expression of focal adhesion-associated proteins affects cell junction functions and suggests a change in the GTPase pathway. GTPase is a molecular switch for cell-signal transduction, and it serves an important role in dynamic changes of the cytoskeleton. Cell movement regulates malignant cell transformation, proliferation and tumor angiogenesis, invasion and metastasis (
The WGCNA results obtained in the present study showed that 850 genes, including CCNB1, were co-expressed in LUAD. After identifying the intersecting RNA-seq and WGCNA results, it was found that the expression of CPLX1, PPIF, SRPK2, KRT8, SLC20A1 and CBX2 was closely associated with that of CCNB1. Notably, Kaplan-Meier analyses revealed that high expression of KRT8 and PPIF was associated with poor prognosis. Previous studies have shown the significant upregulation of KRT8 expression in various types of human cancer (
Interestingly, consistent results were obtained using TCGA data and clinical samples, both of which indicate that the increased expression of CCNB1 is a marker of poor prognosis for LUAD. Moreover, the findings suggest that CCNB1 may affect the expression of CPLX1, PPIF, SRPK2, KRT8, SLC20A1 and CBX2 genes, leading to a poor prognosis in patients with LUAD. This study provides a comprehensive and reliable theoretical basis and data source for subsequent studies of CCNB1 in LUAD. However, the study has certain limitations. Firstly, the sample size was small and a larger sample size should be analyzed to further confirm the expression and prognostic value of CCNB1. Secondly, the mechanism merits further study, but no cell experiments were conducted to verify the potential mechanism. Further intensive
In conclusion, the present study identified that CCNB1 was highly expressed in patients with LUAD and associated with a poor prognosis. Patients whose IHC results were positive for CCNB1 expression had a significantly shorter OS than patients with whose results were negative. CCNB1 may affect the expression of the CPLX1, PPIF, SRPK2, KRT8, SLC20A1 and CBX2 genes and be functionally regulated by different pathways. CCNB1 has the potential to become a novel prognostic target for LUAD and may assist physicians in finding new diagnostic and therapeutic methods for patients with LUAD.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. The raw sequencing datasets generated during the current study are available in the GEO repository (
YL, YXL, QL and CC conceived the project and participated in study design and interpretation of the results. YL wrote the manuscript. YXS, FC and YDD participated in study design and helped to revise the manuscript. YL and QYW contributed to sample collection and acquisition of patients' clinical and survival data. YXL, NJ and HD conducted experiments. YL and QL confirm the authenticity of all the raw data. All authors have read and approved the final manuscript.
All experiments using human tissue were approved by the Ethics Committee of Zunyi Medical University [no. (2021)1-098]. Written informed consent was obtained from all patients for the use of their tissues in the study.
Not applicable.
The authors declare that they have no competing interests.
CCNB1 expression is significantly increased in LUAD tissues compared with normal lung tissues. (A) CCNB1 expression in 334 LUAD samples and 59 normal lung tissues from The Cancer Genome Atlas database. (B) CCNB1 expression in 57 LUAD samples and 11 normal lung tissues from GSE116959 of the Gene Expression Omnibus database. (C) Representative image of CCNB1 expression in the LUAD tissues of a patient at the Affiliated Hospital of Zunyi Medical University and normal lung tissues (upper image magnification, ×200; lower image magnification, ×400) detected using immunohistochemistry. CCNB1, cyclin B1; LUAD, lung adenocarcinoma.
Association between CCNB1 expression and the prognosis of patients with lung adenocarcinoma. (A) Patients with high CCNB1 expression had a significantly shorter OS than patients with low CCNB1 expression according to data from The Cancer Genome Atlas database. (B) Patients with positive CCNB1 expression had a worse prognosis than patients with negative CCNB1 expression according to data from the Affiliated Hospital of Zunyi Medical University. Patients with positive CCNB1 expression had a significantly shorter OS than patients with negative CCNB1 expression when (C) T3 + T4 and (D) N0 + N1 cases were considered. CCNB1, cyclin B1; OS, overall survival.
Univariate and multivariate Cox analysis of OS in 94 patients with lung adenocarcinoma from the Affiliated Hospital of Zunyi Medical University. (A) Univariate analysis suggested that patient survival was influenced by T, N, pathological stage and CCNB1. (B) Multivariate analysis showed that CCNB1 expression is an independent prognostic factor. CCNB1, cyclin B1.
Comparison of CCNB1 expression in different clinicopathological groups from The Cancer Genome Atlas. Groups were analyzed according to (A) stage, (B) T stage, (C) N stage and (D) M stage. One-way ANOVA followed by Tukey's post hoc test was used to analyse the data in (A-C) and unpaired Student's t-test was used to analyse the data in (D). No significant differences were identified in stage or TNM stage. CCNB1, cyclin B1.
RNA sequencing with CCNB1 knockdown. (A) Relative expression of CCNB1 in the four LUAD cell lines A549, H827, H1299 and PC9. Data were analyzed using one-way ANOVA followed by Dunnett's post hoc tests. **P<0.01. (B) Interference effect of CCNB1 small interfering RNAs in the H1299 cell line. **P<0.01. (C) Cluster map of DEGs associated with CCNB1 knockdown. (D) Gene Ontology enrichment analysis and (E) Kyoto Encyclopedia of Genes and Genomes pathway analysis based on DEGs in LUAD. CCNB1, cyclin B1; LUAD, lung adenocarcinoma; BP, biological processes; CC, cellular components; MF, molecular functions.
Identification of modules associate with cyclin B1. (A) Volcano plot of DEGs. (B) Analysis of the mean connectivity for soft-thresholding powers. (C) Analysis of the scale-free fit index for various soft-thresholding powers (β). (D) Dendrogram of all clusters based on a dissimilarity measure. DEGs, differentially expressed genes.
Co-expression analysis of CCNB1. (A) Venn diagram showing the co-expression of seven genes based on RNA-seq and WGCNA; KRT8, PPIF, complexin 1, serine-arginine protein kinase 2, solute carrier family member 20 member 1 and chromobox 2 were co-expressed with CCNB1. Kaplan-Meier analysis shows the association of (B) KRT8 and (C) PPIF with overall survival. CCNB1, cyclin B1; RNA-seq, RNA-sequencing; WGCNA, weighted gene co-expression network analysis; KRT8, keratin 8; PPIF, peptidylprolyl isomerase F.
Expression of cyclin B1 in primary lung adenocarcinoma and normal lung tissues.
Expression (n) | |||||
---|---|---|---|---|---|
Group | N | Negative | Positive | χ2 | P-value |
Cancer | 94 | 68 | 26 | 10.499 | 0.001 |
Normal | 30 | 30 | 0 |
Association of cyclin B1 expression with clinicopathological features in patients with lung adenocarcinoma.
CCNB1 expression (n) | ||||
---|---|---|---|---|
Feature | N | Negative | Positive | P-value |
Age | 0.521 | |||
≤55 | 42 | 29 | 13 | |
>55 | 52 | 39 | 13 | |
Sex | 0.367 | |||
Female | 54 | 41 | 13 | |
Male | 40 | 27 | 13 | |
Smoking | 0.478 | |||
Yes | 38 | 29 | 9 | |
No | 56 | 39 | 17 | |
Tumor size (cm) | 0.775 | |||
≤3.5 | 60 | 44 | 16 | |
>3.5 cm | 34 | 24 | 10 | |
Differentiation | 0.112 | |||
Low/moderate | 49 | 32 | 17 | |
High | 45 | 36 | 9 | |
T stage | 0.707 | |||
T1 + T2 | 66 | 47 | 19 | |
T3 + T4 | 28 | 21 | 7 | |
Lymph node metastasis | 0.484 | |||
Yes | 31 | 21 | 10 | |
No | 63 | 47 | 16 | |
Distant metastasis | 0.704 |
|||
Yes | 9 | 6 | 3 | |
No | 85 | 62 | 23 | |
Pathological stage | 0.912 | |||
I + II | 57 | 41 | 16 | |
III + IV | 37 | 27 | 10 | |
Visceral pleural invasion | 0.961 | |||
No | 51 | 37 | 14 | |
Yes | 43 | 31 | 12 | |
Bronchial margin | 0.732 |
|||
Positive | 12 | 8 | 4 | |
Negative | 82 | 60 | 22 | |
Tumor type | 1.000 |
|||
Central | 11 | 8 | 3 | |
Peripheral | 83 | 60 | 23 |
Fisher's exact test. Other features were analyzed using χ2. CCNB1, cyclin B1.