The purpose of the present study was to evaluate cimigenol (Cim) treatment effects to cell proliferation by breaking bone marrow stromal cells (BMSCs) through C-X-C chemokine receptor type 4 (CXCR4)/stromal cell-derived factor-1α (SDF-1α) pathway. MV-4-11 and U937 cell lines were used. The present study was divided into two parts. First, the cell lines were divided into normal control (NC), BMSC (cells co-cultured with BMSCs), BMSC + DMSO, BMSC + Low (treated with 5 mg/ml Cim), BMSC + Middle (treated with 10 mg/ml Cim), BMSC + High (treated with 20 mg/ml Cim). In the second step, the cell lines were divided into NC, BMSC, BMSC + BL8040 (treated with BL8040 which inhibits CXCR4), BMSC + Cim and BMSC + Cim + BL8040. EdU positive cell numbers were measured by EdU assay and apoptosis rate by flow cytometry and TUNEL assay. Relative gene and protein expression was measured by reverse transcription-quantitative PCR and western blotting assay. BMSCs were able to protect proliferation of cancer cells and decreased cell apoptosis compared with the NC group (P<0.001, respectively). With Cim supplement, the cell proliferation was decreased with cell apoptosis increasing compared with NC group (P<0.001 respectively). However, the anti-tumor effects of Cim were not significantly different from the BL8040 treated groups (P<0.001, respectively). In conclusion Cim decreased acute myeloid leukemia cells protected by BMSCs through the CXCR4/SDF-1α pathway.
Acute myeloid leukemia (AML), characterized by blocked differentiation and clonal proliferation of hematopoietic stem/progenitor cells, is the commonest hematological malignancy and seriously endangers human health. So far, multiple methods including combined chemotherapy, targeted therapy and hematopoietic stem cell transplantation have not been effective in the treatment of AML (
Natural drug extracts play an important role in the prevention and treatment of tumors in various systems, and have their own distinctiveness in the clinical treatment of leukemia. The regulation of the tumor microenvironment through multi-target effect on tumor cells is one of the important characteristics of anti-tumor therapy of traditional Chinese medicine. Cimigenol (Cim) is one of the main effective components of natural
Cim was purchased from MilliporeSigma, and RPMI 1640 culture medium and fetal bovine serum from Gibco; Thermo Fisher Scientific, Inc. EdU kit, TUNEL kit and Annexin V-APC/7-AAD apoptosis kit were purchased from Jiangsu KeyGEN Biotech Co., Ltd. RNA extraction kit, reverse transcription kit, One Step TB Green PrimeScript RT-PCR kit II (SYBR Green) were purchased from Takara Bio, Inc. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Rabbit anti-human GAPDH was purchased from Jiangsu KeyGEN Biotech Co., Ltd., and rabbit anti-human C-X-C chemokine receptor type 4 (CXCR4), stromal cell-derived factor-1α (SDF-1α), vascular cell adhesion molecule 1 (VCAM1), leukocyte function-associated antigen-1 (LFA-1), Fms like tyrosine kinase receptor 3 (FLT3), nucleophosmin 1 (NPM-1), CCAAT/enhancer-binding protein alpha (C/EBPA), AKT, phosphorylated (p-)AKT, mTOR and p-mTOR were purchased from Abcam; very-late-antigen-4 (VLA-4) was purchased from ProteinTech Group, Inc. Flow cytometer FC500 was from Beckman Coulter, Inc., ND2000 ultra-microspectrophotometer was from Thermo Fisher Scientific, Inc., and gel image analysis system was produced by GeneGenius. BL8040 (CXCR4 antagonist) was from Roche Diagnostics.
Human AML cell lines MV-4-11 and U937 were purchased from ATCC and primary BMSCs cell were purchased from Procell Life Science & Technology Co., Ltd. (cat. no. CP-H166) and cultured in RPMI 1640 medium containing 10% fetal bovine serum in a 5% CO2 incubator at 37˚C. According to cell proliferation, the medium was changed from time to time for subculture. Cells in the logarithmic growth phase were collected for subsequent experiment. MV-4-11 and U937 cell lines were not contaminated and the STR profiles were positive. The present study was approved by ethics Committee of Affiliated Hospital of Nanjing University of Chinese Medicine (approval no. 2021010606).
MV-4-11 or U937 cells were inoculated onto 96-well plate (2x105/well), and subsequent experiments were performed when confluence reached >80%. The cells in the NC group were routinely cultured. In the BMSC group, MV-4-11 or U937 cells were co-cultured with BMSCs. In the BMSC + DMSO group, MV-4-11 or U937 cells were co-cultured with BMSCs, to which was added 250 µl DMSO. In the BMSC + Low group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 5 mg/l Cim (final concentration). In the BMSC + Middle group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 10 mg/l Cim (final concentration). In the BMSC + High group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 20 mg/l Cim (final concentration). In the BMSC + BL8040 group, MV-4-11 or U937 cells were co-cultured with BMSCs, to which was added 10 nM BL8040. In the BMSC + Cim group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 20 mg/l Cim (final concentration). In the BMSC + Cim + BL8040 group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 20 mg/l Cim (final concentration) and 10 nM BL8040. After the cells in each group were treated for 48 h at room temperature, the subsequent experiment was conducted.
The co-culture method for the BMSCs cells was to inoculate on a treated glass slide and when the cells adhered, place the slide into the dish of AML cells and co-culture them.
After corresponding treatment in each group for 48 h, 50 µmol/l EdU staining solution was added to each well for incubation for 2 h at room temperature, followed by washing with PBS for 3 times. Then, 4% paraformaldehyde was added for fixation for 30 min, and 50 µl 2 mg/ml glycine was added for incubation on a shaking table for 5 min. Additionally, 100 µl 0.5% TritonX-100 was added for penetration enhancement at room temperature, followed by PBS washing for 3 times. Afterwards, each well had 100 µl Hoechst33342 staining solution added for reaction at room temperature in the dark for 30 min, followed by washing with PBS for 3 times. Finally, observation and capturing of images were conducted under a fluorescence microscope, with three duplicated wells in each group.
After corresponding treatment for 48 h, MV-4-11 or U937 cells were collected from each group, fixed with 4% paraformaldehyde for 30 min at room temperature, and then washed twice with PBS. After adding 100 µl TUNEL balanced buffer and incubation at room temperature for 5 min, 50 µl reaction buffer was finally added for incubation in the dark for 60 min at room temperature. Following centrifugation (8,000 x g, 4˚C, 2 min), the supernatant was discarded, followed by washing with 5x10-3 mg/l BSA. The morphological changes of cells were observation and capturing of images were conducted under a fluorescence microscope.
After corresponding treatment for 48 h, MV-4-11 or U937 cells were collected from each group. In 1 h after Annexin V/PI staining at room temperature, 10,000 cells were collected and fixed in each group, and the apoptotic rate of hepatoma cells was detected by flow cytometry. Samples were repeated three times in each group. The quantification was analyzed by FlowJo 7.6.5 software (FlowJo LLC). The apoptosis rate=early + late apoptotic cells/all cells x100%
After corresponding treatment for 48 h, MV-4-11 or U937 cells (10,000 cells) were collected from each group. Total RNA was extracted from cells using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Then, 0.5 µg RNA was converted into cDNA at 37˚C for 1 h using PrimeScript RT MasterMix (Takara Bio, Inc.). qPCR was performed using ChamQ SYBR® qPCR MasterMix (Vazyme Biotech, Co., Ltd.). Primer sequences are listed in
After corresponding treatment for 48 h, MV-4-11 or U937 cells were collected from each group. Total protein was extracted from cells using RIPA buffer (Changsha Auragene Biological Technology Co., Ltd.) and quantified using a BCA Protein Assay kit (Beijing Dingguo Changsheng Biotechnology, Co., Ltd.). The lysates were incubated at 95˚C for 5 min, an equal amount of total protein (30 µg/lane), separated using 10% SDS-PAGE (Bio-Rad Laboratories) and transferred onto PVDF membranes (MilliporeSigma).
After being blocked with 5% skimmed milk at room temperature for 2 h, the membrane was incubated with primary antibodies CXCR4 (1:1,000; cat. no. ab16502), SDF-1α (1:1,000; cat. no. ab25117), VLA-4 (1:1,000; ProteinTech Group, Inc., cat. no. 19676-1-AP), VCAM1 (1:1,000; cat. no. ab134047), LFA-1 (1:1,000; cat. no. ab235456), FLT3 (1:1,000; cat. no. ab52648), NPM-1 (1:1,000; cat. no. ab10530), C/EBPA (1:1,000; cat. no. ab40761), AKT (1:1,000; cat. no. ab179463), mTOR(1:1,000; cat. no. ab2732), p-AKT(1:1,000; cat. no. ab81283), p-mTOR(1:1,000; cat. no. ab109268) or GAPDH (1:500; cat. no. ab8245) at 4˚C overnight. The membrane was washed with TBST three times for 10 min. Subsequently, HRP-labeled goat anti-rabbit IgGⅡ antibody (1:5,000) was added for incubation at room temperature for 1 h, and the membrane was washed with TBST three times for 10 min. Finally, Proteins were visualized using an ECL reagent kit (Shanghai Yeasen Biotech Co., Ltd.) and were semi-quantified using ImageJ software (1.46r; National Institutes of Health).
Experiments were performed in triplicate at minimum. Data are presented as the mean ± standard deviation and were analyzed using GraphPad Prism 8.0 (GraphPad Software, Inc.). For statistical analysis, pairwise comparisons between two groups were analyzed using the unpaired Student's t-test. One-way ANOVA followed by Tukey's post hoc test was used for comparisons between >2 groups. P<0.05 was considered to indicate a statistically significant difference.
Compared with NC group, EdU positive cell rates of BMSC and BMSC + DMSO groups were significantly upregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with NC group, apoptosis rates of BMSC and BMSC + DMSO groups were significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, the number of positive apoptotic cells in BMSC and BMSC + DMSO groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα mRNA expression in BMSC and BMSC + DMSO groups was significantly upregulated and FLT3 and NPM-1 mRNA expression in BMSC and BMSC + DMSO groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, CXCR4, SDF-1α, p-mTOR, p-AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα protein expression of BMSC and BMSC + DMSO groups was significantly upregulated, and FLT3 and NPM-1 protein expression of BMSC and BMSC + DMSO groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, EdU positive cell rates in BMSC groups were significantly upregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, apoptosis rates in BMSC groups were significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, number of positive apoptotic cells in the BMSC groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα mRNA expression in BMSC groups was significantly upregulated, and FLT3 and NPM-1 mRNA expression in BMSC groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Compared with the NC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα protein expression of BMSC groups was significantly upregulated, and FLT3 and NPM-1 protein expression of BMSC groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively,
Under the physiological state, BMSCs in BMME can produce a variety of adhesion molecules and chemokines, thus mediating multiple signal cascades to ensure and maintain the normal localization and homeostasis of HSCs in BM. In the pathological state of AML, these products can be hijacked and shared by AML cells, so that AML cells can obtain environmental conditions conducive to their own survival, expansion and progression, finally leading to the weakening of apoptosis in AML cells (
SDF-1α is one of the members of the chemokine family in BMME and also the only ligand of CXCR4. In BMME, many components such as BMSCs, immature osteoblasts and bone marrow endothelial cells can secrete SDF-1α (
Cim has an inhibitory effect on the activity of tumor cells
However, there were some limitations to the present study. It only studied the effect of cimigenol on AML cell lines via CXCR4/SDF-1α pathway; the anti-tumor effects of cimigenol might be regulated by other pathways, meanwhile there were some differences between
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
BM, HD and XMS contributed to the conceptualization and the design of the present study. BM, HD and XD performed the experiments and analyzed the data. XD, SQ, XCS and XMS were responsible for the acquisition, analysis and interpretation of the data. HD and XCS contributed to the drafting of the manuscript. XD and SQ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.
The present study was approved by the ethics committee of the Affiliated Hospital of Nanjing University of Chinese Medicine (approval no. 2021010606).
Not applicable.
The authors declare that they have no competing interests.
Different concentrations of Cim suppress AML cell proliferation protected by BMSC. EdU-positive cell rate in (A) MV-4-11 and (B) U937 cell line (%, magnification, x200). ***P<0.001 vs. NC; #P<0.05, ##P<0.01, ###P<0.001 vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim.
Different concentrations of Cim suppress increased AML cell apoptosis protected by BMSC by flow cytometry. Apoptosis cell rates in (A) MV-4-11 and (B) U937 (%). ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim.
Different concentrations of Cim suppress increased apoptosis AML cell number protected by BMSC by TUNEL assay. Positive apoptotic cell number in (A) MV-4-11 and (B) U937 (magnification, x200). ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
Different concentrations of Cim suppress affect relative gene expression by reverse transcription-quantitative PCR. Relative gene expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
Different concentrations of Cim suppress affected relative protein expression by western blotting. Relative protein expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; CXCR4, C-X-C chemokine receptor type 4; SDF-1α, stromal cell-derived factor-1α; p-, phosphorylated; VLA-4, very-late-antigen-4; VCAM1, vascular cell adhesion molecule 1; LFA-1, leukocyte function-associated antigen-1; FLT3, Fms like tyrosine kinase receptor 3; NPM-1, nucleophosmin 1; C/EBPA, CCAAT/enhancer-binding protein alpha; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
Effect of CXCR4 on the anti-tumor effects of Cim in cell proliferation. EdU-positive cell rate in (A) MV-4-11 and (B) U937 (%, x200). ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. CXCR4, C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
Effect of CXCR4 on the anti-tumor effects of Cim in cell apoptosis by flow cytometry. Apoptosis cell rate in (A) MV-4-11 and (B) U937 (%). ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
Effect of CXCR4 on the anti-tumor effects of Cim in cell apoptosis by TUNEL assay. Number of positive apoptotic cells in (A) MV-4-11 and (B) U937 (magnification, x200). ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
CXCR4 inhibitor affected relative gene expression. Relative gene expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
CXCR4 inhibitor affects relative protein expression. Relative protein expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. Cim, cimigenol; CXCR4, C-X-C chemokine receptor type 4; SDF-1α, stromal cell-derived factor-1α; p-, phosphorylated; VLA-4, very-late-antigen-4; VCAM1, vascular cell adhesion molecule 1; LFA-1, leukocyte function-associated antigen-1; FLT3, Fms like tyrosine kinase receptor 3; NPM-1, nucleophosmin 1; C/EBPα, CCAAT/enhancer-binding protein alpha; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.
Primer sequences.
Gene | Forward (5'-3') | Reverse (5'-3') | Size |
---|---|---|---|
AKT | CAGGATGTGGACCAACGTGA | AAGGTGCGTTCGATGACAGT | 137 bp |
c/EBPα | GACAAGAACAGCAACGAGTACC | GTCATTGTCACTGGTCAGCTC | 132 bp |
CXCR4 | TTCCAGTTTCAGCACATCATGG | GTCGATGCTGATCCCAATGTAG | 192 bp |
FLT3 | GTGAATCCTTACCCTGGCATTC | GTCAAATTAGGGAAGGATGGCC | 164 bp |
LFA-1 | GGTTGACGTGGTGTATGAGAAG | GAAACCAACCTTGTACAGCACT | 109 bp |
mTOR | AACCTCCTCCCCTCCAATGA | TCAGCGGTAAAAGTGTCCCC | 92 bp |
NPM-1 | CACCAAAAGGACCTAGTTCTGT | TGCCAGAGATCTTGAATAGCCT | 157 bp |
SDF-1α | GATTCTTCGAAAGCCATGTTGC | TCAATGCACACTTGTCTGTTGT | 121 bp |
VCAM-1 | AGTTCTTGTTTGCCGAGCTAAA | AAATCTCTGGAGCTGGTAGACC | 197 bp |
VLA-4 | AACATGAGCAGATTGGTAAGGC | CAGACAGAAGCTCCAAAGTACG | 112 bp |
GAPDH | CAAATTCCATGGCACCGTCA | AGCATCGCCCCACTTGATTT | 109 bp |