ETM Experimental and Therapeutic Medicine 1792-0981 1792-1015 D.A. Spandidos ETM-25-2-11779 10.3892/etm.2022.11779 Articles Cimigenol depresses acute myeloid leukemia cells protected by breaking bone marrow stromal cells via CXCR4/SDF‑1α MaBangyun DaiHuibo DaiXingbin QianShushu ShaXiaocao SunXuemei Department of Hematology, Affiliated Hospital of Nanjing University of Chinese Medicine, Nanjing, Jiangsu 210000, P.R. China Correspondence to: Dr Xuemei Sun, Department of Hematology, Affiliated Hospital of Nanjing University of Chinese Medicine, 155 Hanzhong Road, Qinhuai, Nanjing, Jiangsu 210000, P.R. China sunxuemei1104@163.com 02 2023 30 12 2022 25 2 80 11 05 2022 30 11 2022 Copyright: © Ma et al. 2020 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

The purpose of the present study was to evaluate cimigenol (Cim) treatment effects to cell proliferation by breaking bone marrow stromal cells (BMSCs) through C-X-C chemokine receptor type 4 (CXCR4)/stromal cell-derived factor-1α (SDF-1α) pathway. MV-4-11 and U937 cell lines were used. The present study was divided into two parts. First, the cell lines were divided into normal control (NC), BMSC (cells co-cultured with BMSCs), BMSC + DMSO, BMSC + Low (treated with 5 mg/ml Cim), BMSC + Middle (treated with 10 mg/ml Cim), BMSC + High (treated with 20 mg/ml Cim). In the second step, the cell lines were divided into NC, BMSC, BMSC + BL8040 (treated with BL8040 which inhibits CXCR4), BMSC + Cim and BMSC + Cim + BL8040. EdU positive cell numbers were measured by EdU assay and apoptosis rate by flow cytometry and TUNEL assay. Relative gene and protein expression was measured by reverse transcription-quantitative PCR and western blotting assay. BMSCs were able to protect proliferation of cancer cells and decreased cell apoptosis compared with the NC group (P<0.001, respectively). With Cim supplement, the cell proliferation was decreased with cell apoptosis increasing compared with NC group (P<0.001 respectively). However, the anti-tumor effects of Cim were not significantly different from the BL8040 treated groups (P<0.001, respectively). In conclusion Cim decreased acute myeloid leukemia cells protected by BMSCs through the CXCR4/SDF-1α pathway.

 cimigenol acute myeloid leukemia proliferation apoptosis C-X-C chemokine receptor type 4 stromal cell-derived factor-1α Funding: The present study was supported by the Youth Fund of Natural Science Foundation of Jiangsu Province (grant no. BK20201096). Introduction

Acute myeloid leukemia (AML), characterized by blocked differentiation and clonal proliferation of hematopoietic stem/progenitor cells, is the commonest hematological malignancy and seriously endangers human health. So far, multiple methods including combined chemotherapy, targeted therapy and hematopoietic stem cell transplantation have not been effective in the treatment of AML (1). Therefore, exploring new therapies for AML is a focus of research. Bone marrow microenvironment (BMME) is a vital research field. Abnormal BMME has long been considered as one of the important factors affecting the onset of AML. Relevant studies have also confirmed that some components of BMME can promote the survival of AML cells and induce chemotherapy resistance by secreting cytokines and interacting with AML cells (2,3).

Natural drug extracts play an important role in the prevention and treatment of tumors in various systems, and have their own distinctiveness in the clinical treatment of leukemia. The regulation of the tumor microenvironment through multi-target effect on tumor cells is one of the important characteristics of anti-tumor therapy of traditional Chinese medicine. Cimigenol (Cim) is one of the main effective components of natural Cimicifugae Rhizoma (4). Research results have shown that Cim has a clear inhibitory effect on the biological activity of tumor cells (5-7). However, the role of Cim in AML and relevant mechanisms remains to be elucidated. In clinical treatment, it was found that Cim did not directly affect AML cells promoted by BMSCs (in vitro research data not shown as it is a part of another study), and due to this result, the present study did not use Cim to treat MV-4-11 or U937 cells. Therefore, in present study, the role of Cim in inducing AML cell apoptosis and inhibiting AML-related angiogenesis was explored. Cim might affect the occurrence and progression of AML by regulating BMME, but the specific regulatory mechanism is unclear and requires further exploration.

 Materials and methods <sec> <title>Reagents and instruments

Cim was purchased from MilliporeSigma, and RPMI 1640 culture medium and fetal bovine serum from Gibco; Thermo Fisher Scientific, Inc. EdU kit, TUNEL kit and Annexin V-APC/7-AAD apoptosis kit were purchased from Jiangsu KeyGEN Biotech Co., Ltd. RNA extraction kit, reverse transcription kit, One Step TB Green PrimeScript RT-PCR kit II (SYBR Green) were purchased from Takara Bio, Inc. Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Rabbit anti-human GAPDH was purchased from Jiangsu KeyGEN Biotech Co., Ltd., and rabbit anti-human C-X-C chemokine receptor type 4 (CXCR4), stromal cell-derived factor-1α (SDF-1α), vascular cell adhesion molecule 1 (VCAM1), leukocyte function-associated antigen-1 (LFA-1), Fms like tyrosine kinase receptor 3 (FLT3), nucleophosmin 1 (NPM-1), CCAAT/enhancer-binding protein alpha (C/EBPA), AKT, phosphorylated (p-)AKT, mTOR and p-mTOR were purchased from Abcam; very-late-antigen-4 (VLA-4) was purchased from ProteinTech Group, Inc. Flow cytometer FC500 was from Beckman Coulter, Inc., ND2000 ultra-microspectrophotometer was from Thermo Fisher Scientific, Inc., and gel image analysis system was produced by GeneGenius. BL8040 (CXCR4 antagonist) was from Roche Diagnostics.

 Cell culture

Human AML cell lines MV-4-11 and U937 were purchased from ATCC and primary BMSCs cell were purchased from Procell Life Science & Technology Co., Ltd. (cat. no. CP-H166) and cultured in RPMI 1640 medium containing 10% fetal bovine serum in a 5% CO2 incubator at 37˚C. According to cell proliferation, the medium was changed from time to time for subculture. Cells in the logarithmic growth phase were collected for subsequent experiment. MV-4-11 and U937 cell lines were not contaminated and the STR profiles were positive. The present study was approved by ethics Committee of Affiliated Hospital of Nanjing University of Chinese Medicine (approval no. 2021010606).

 Cell treatment

MV-4-11 or U937 cells were inoculated onto 96-well plate (2x105/well), and subsequent experiments were performed when confluence reached >80%. The cells in the NC group were routinely cultured. In the BMSC group, MV-4-11 or U937 cells were co-cultured with BMSCs. In the BMSC + DMSO group, MV-4-11 or U937 cells were co-cultured with BMSCs, to which was added 250 µl DMSO. In the BMSC + Low group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 5 mg/l Cim (final concentration). In the BMSC + Middle group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 10 mg/l Cim (final concentration). In the BMSC + High group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 20 mg/l Cim (final concentration). In the BMSC + BL8040 group, MV-4-11 or U937 cells were co-cultured with BMSCs, to which was added 10 nM BL8040. In the BMSC + Cim group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 20 mg/l Cim (final concentration). In the BMSC + Cim + BL8040 group, MV-4-11 or U937 cells were co-cultured with BMSCs and to 250 µl of the mixed solution was added 20 mg/l Cim (final concentration) and 10 nM BL8040. After the cells in each group were treated for 48 h at room temperature, the subsequent experiment was conducted.

The co-culture method for the BMSCs cells was to inoculate on a treated glass slide and when the cells adhered, place the slide into the dish of AML cells and co-culture them.

 Detection of cell proliferation by EdU staining

After corresponding treatment in each group for 48 h, 50 µmol/l EdU staining solution was added to each well for incubation for 2 h at room temperature, followed by washing with PBS for 3 times. Then, 4% paraformaldehyde was added for fixation for 30 min, and 50 µl 2 mg/ml glycine was added for incubation on a shaking table for 5 min. Additionally, 100 µl 0.5% TritonX-100 was added for penetration enhancement at room temperature, followed by PBS washing for 3 times. Afterwards, each well had 100 µl Hoechst33342 staining solution added for reaction at room temperature in the dark for 30 min, followed by washing with PBS for 3 times. Finally, observation and capturing of images were conducted under a fluorescence microscope, with three duplicated wells in each group.

 TUNEL assay

After corresponding treatment for 48 h, MV-4-11 or U937 cells were collected from each group, fixed with 4% paraformaldehyde for 30 min at room temperature, and then washed twice with PBS. After adding 100 µl TUNEL balanced buffer and incubation at room temperature for 5 min, 50 µl reaction buffer was finally added for incubation in the dark for 60 min at room temperature. Following centrifugation (8,000 x g, 4˚C, 2 min), the supernatant was discarded, followed by washing with 5x10-3 mg/l BSA. The morphological changes of cells were observation and capturing of images were conducted under a fluorescence microscope.

 Flow cytometry

After corresponding treatment for 48 h, MV-4-11 or U937 cells were collected from each group. In 1 h after Annexin V/PI staining at room temperature, 10,000 cells were collected and fixed in each group, and the apoptotic rate of hepatoma cells was detected by flow cytometry. Samples were repeated three times in each group. The quantification was analyzed by FlowJo 7.6.5 software (FlowJo LLC). The apoptosis rate=early + late apoptotic cells/all cells x100%

 Reverse transcription-quantitative (RT-q) PCR

After corresponding treatment for 48 h, MV-4-11 or U937 cells (10,000 cells) were collected from each group. Total RNA was extracted from cells using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. Then, 0.5 µg RNA was converted into cDNA at 37˚C for 1 h using PrimeScript RT MasterMix (Takara Bio, Inc.). qPCR was performed using ChamQ SYBR® qPCR MasterMix (Vazyme Biotech, Co., Ltd.). Primer sequences are listed in Table I. The reaction system (20 µl) included: 10 µl SYBR FAST qPCR Mix (2X), 1 µl upstream primer (10 µmol/l), 1 µl downstream primer (10 µmol/l), 2 µl cDNA template and 6 µl ddH2O. The reaction conditions were as follows: 95˚C for 5 min, 95˚C for 15 sec, 60˚C for 1 min for 40 cycles. Finally, the relative expression of each gene was analyzed using the 2-ΔΔCq method (8). The experiment was repeated three times.

 Western blotting

After corresponding treatment for 48 h, MV-4-11 or U937 cells were collected from each group. Total protein was extracted from cells using RIPA buffer (Changsha Auragene Biological Technology Co., Ltd.) and quantified using a BCA Protein Assay kit (Beijing Dingguo Changsheng Biotechnology, Co., Ltd.). The lysates were incubated at 95˚C for 5 min, an equal amount of total protein (30 µg/lane), separated using 10% SDS-PAGE (Bio-Rad Laboratories) and transferred onto PVDF membranes (MilliporeSigma).

After being blocked with 5% skimmed milk at room temperature for 2 h, the membrane was incubated with primary antibodies CXCR4 (1:1,000; cat. no. ab16502), SDF-1α (1:1,000; cat. no. ab25117), VLA-4 (1:1,000; ProteinTech Group, Inc., cat. no. 19676-1-AP), VCAM1 (1:1,000; cat. no. ab134047), LFA-1 (1:1,000; cat. no. ab235456), FLT3 (1:1,000; cat. no. ab52648), NPM-1 (1:1,000; cat. no. ab10530), C/EBPA (1:1,000; cat. no. ab40761), AKT (1:1,000; cat. no. ab179463), mTOR(1:1,000; cat. no. ab2732), p-AKT(1:1,000; cat. no. ab81283), p-mTOR(1:1,000; cat. no. ab109268) or GAPDH (1:500; cat. no. ab8245) at 4˚C overnight. The membrane was washed with TBST three times for 10 min. Subsequently, HRP-labeled goat anti-rabbit IgGⅡ antibody (1:5,000) was added for incubation at room temperature for 1 h, and the membrane was washed with TBST three times for 10 min. Finally, Proteins were visualized using an ECL reagent kit (Shanghai Yeasen Biotech Co., Ltd.) and were semi-quantified using ImageJ software (1.46r; National Institutes of Health).

 Statistical analysis

Experiments were performed in triplicate at minimum. Data are presented as the mean ± standard deviation and were analyzed using GraphPad Prism 8.0 (GraphPad Software, Inc.). For statistical analysis, pairwise comparisons between two groups were analyzed using the unpaired Student's t-test. One-way ANOVA followed by Tukey's post hoc test was used for comparisons between >2 groups. P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Different Cim concentrations suppresses AML cell proliferation protected by BMSC

Compared with NC group, EdU positive cell rates of BMSC and BMSC + DMSO groups were significantly upregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 1A and B). With Cim supplement, compared with BMSC group, EdU positive cell rates of Cim treated groups were significantly depressed in MV-4-11 and U937 cell lines (P<0.05, P<0.01 or P<0.001, respectively, Fig. 1A and B) and was dose-dependent (P<0.05, respectively, Fig. 1A and B).

 Different Cim concentrations increase AML cell apoptosis protected by BMSC by flow cytometry

Compared with NC group, apoptosis rates of BMSC and BMSC + DMSO groups were significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 2A and B). With Cim supplement, compared with BMSC group, apoptosis rates of Cim treated groups were significantly increased in MV-4-11 and U937 cell lines (P<0.05, P<0.01 or P<0.001, respectively, Fig. 2A and B) with dose-dependent (P<0.05, respectively, Fig. 2A and B).

 Different Cim concentrations increase number of apoptotic AML cells protected by BMSC by TUNEL assay

Compared with the NC group, the number of positive apoptotic cells in BMSC and BMSC + DMSO groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 3A and B). With Cim supplement, compared with BMSC group, the number of positive apoptotic cells in Cim treated groups was significantly increased in MV-4-11 and U937 cell lines (P<0.05, P<0.01 or P<0.001, respectively; Fig. 3A and B) dose-dependently (P<0.05, respectively; Fig. 3A and B).

 Different Cim concentrations affect relative gene expression by RT-qPCR assay

Compared with the NC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα mRNA expression in BMSC and BMSC + DMSO groups was significantly upregulated and FLT3 and NPM-1 mRNA expression in BMSC and BMSC + DMSO groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 4A and B). With Cim, compared with the BMSC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα mRNA expression was significantly downregulated and FLT3 and NPM-1 mRNA expression was significantly upregulated in MV-4-11 and U937 cell lines (P<0.05, P<0.01 or P<0.001, respectively, Fig. 4A and B) dose-dependently (P<0.05, respectively, Fig. 4A and B).

 Different Cim concentrations affect relative protein expression by western blotting

Compared with the NC group, CXCR4, SDF-1α, p-mTOR, p-AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα protein expression of BMSC and BMSC + DMSO groups was significantly upregulated, and FLT3 and NPM-1 protein expression of BMSC and BMSC + DMSO groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 5A and B). With Cim, compared with the BMSC group, CXCR4, SDF-1α, p-mTOR, p-AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα protein expression was significantly downregulated and FLT3 and NPM-1 protein expression was significantly upregulated in MV-4-11 and U937 cell lines (P<0.05, P<0.01 or P<0.001, respectively, Fig. 5A and B) dose-dependently (P<0.05, respectively, Fig. 5A and B).

 Effect of CXCR4 on the anti-tumor effects of Cim in cell proliferation

Compared with the NC group, EdU positive cell rates in BMSC groups were significantly upregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 6A and B). With BL8040 (CXCR4 inhibitor) and/or Cim treatment, compared with BMSC group, EdU positive cell rates of BMC + BL8040, BMSC + Cim and BMSC + Cim + BL8040 groups were significantly suppressed (P<0.001, respectively, Fig. 6A and B).

 Effect of CXCR4 on the anti-tumor effects of Cim in cell apoptosis by flow cytometry

Compared with the NC group, apoptosis rates in BMSC groups were significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 7A and B). With BL8040 (CXCR4 inhibitor) and/or Cim treatment, compared with BMSC group, apoptosis rates of BMC + BL8040, BMSC + Cim and BMSC + Cim + BL8040 groups were significantly increased (P<0.001, respectively, Fig. 7A and B).

 Effect of CXCR4 on the anti-tumor effects of Cim in cell apoptosis by TUNEL assay

Compared with the NC group, number of positive apoptotic cells in the BMSC groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 8A and B). With BL8040 (CXCR4 inhibitor) and/or Cim treatment, compared with BMSC group, the number of positive apoptotic cells in the BMC + BL8040, BMSC + Cim and BMSC + Cim + BL8040 groups was significantly increased (P<0.001, respectively, Fig. 8A and B).

 CXCR4 inhibitor affects relative gene expression

Compared with the NC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα mRNA expression in BMSC groups was significantly upregulated, and FLT3 and NPM-1 mRNA expression in BMSC groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 9A and B). With BL8040 (CXCR4 inhibitor) and/or Cim treatment, compared with the BMSC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα mRNA expression was significantly downregulated and FLT3 and NPM-1 mRNA expression was significantly upregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 9A and B).

 CXCR4 inhibitor affects relative protein expression

Compared with the NC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα protein expression of BMSC groups was significantly upregulated, and FLT3 and NPM-1 protein expression of BMSC groups was significantly downregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 10A and B). With BL8040 (CXCR4 inhibitor) and/or Cim treatment, compared with BMSC group, CXCR4, SDF-1α, mTOR, AKT, VLA-4, VCAM-1, LFA-1 and C/EBPα protein expression was significantly downregulated and FLT3 and NPM-1 protein expression was significantly upregulated in MV-4-11 and U937 cell lines (P<0.001, respectively, Fig. 10A and B).

 Discussion

Under the physiological state, BMSCs in BMME can produce a variety of adhesion molecules and chemokines, thus mediating multiple signal cascades to ensure and maintain the normal localization and homeostasis of HSCs in BM. In the pathological state of AML, these products can be hijacked and shared by AML cells, so that AML cells can obtain environmental conditions conducive to their own survival, expansion and progression, finally leading to the weakening of apoptosis in AML cells (9,10). The bindings and interactions of the chemokine receptor family represented by CXCR4 and its relevant ligands play a representative role in this process. CXCR4 directly or indirectly activates a variety of signal cascades by binding with its ligands to ensure the correct localization, homeostasis maintenance and normal survival of HSCs in BMME (11). CXCR4 may eventually cause the progression, difficulties in treatment and recurrence of AML by affecting the proliferation, migration, chemotaxis and angiogenesis as well as increasing the chemotherapy resistance of leukemia cells (12).

SDF-1α is one of the members of the chemokine family in BMME and also the only ligand of CXCR4. In BMME, many components such as BMSCs, immature osteoblasts and bone marrow endothelial cells can secrete SDF-1α (13). Among these cell components, BMSCs are the main source (14). SDF-1α is often expressed in bone marrow microvascular hot spots that attract the aggregation of AML cells in BMME (15). It can promote the survival and expansion of AML cells by guiding AML cells to a favorable environment in BMME (16). In addition, the adhesion between AML cells and bone marrow stroma in BMME is vital for the survival and proliferation of AML cells and SDF-1α participates in the regulation of this mechanism. This regulation can be briefly summarized as: SDF-1α regulates the adhesion of AML cells to matrix components in BMME by activating adhesion molecules, such as integrins CD44 and VLA-4, so that AML cells can obtain ‘concealment’ and produce chemotherapy resistance (17). The binding of CXCR4 and its ligand SDF-1α can initiate multiple Ca2+-dependent or independent signal events, leading to actin cytoskeleton reorganization and activating integrins, which results in its appropriate interaction with the endothelium of BM sinus and stromal cells, finally affecting the survival, chemotaxis, homing and proliferation of cells (18). A relevant study (19) demonstrated that CXCR4 inhibitor AMD3465 can promote the peripheral mobilization of AML cells and enhance the anti-leukemia effect of chemotherapeutic drugs. A further study (3) found that blocked CXCR4/SDF-1α interaction affects the activity of related downstream signaling pathways such as PI3K/AKT and MAPK and increases the mobilization rate of AML cells, finally leading to the increase in chemotherapy sensitivity. Experiments have confirmed that other CXCR4 antagonists and monoclonal antibodies, including LY2510924, CX-01, POL6326 and NOX-A12, can also effectively inhibit the growth of AML cells and produce sustained pharmacodynamic effects on peripheral mobilization of cells (20-22). Some related studies showed that the CXCR4/SDF-1α signaling pathway stimulation could improve cancer cell biological activating in vitro and in vivo studies (23,24). The results of the present study showed that after AML cells were co-cultured with BMSCs, the apoptosis of AML cells MV-4-11 and U937 was protected, the proliferation was increased and the CXCR4/SDF-1α signaling pathway was activated. Therefore, it was hypothesized that BMSCs possess a protective effect on AML cells.

Cim has an inhibitory effect on the activity of tumor cells in vivo and in vitro (5-7). The present study showed that Cim also had a certain killing effect on AML cells under the protection of BMSCs and that its mechanism might be through the inhibition of the CXCR4/SDF-1α signaling pathway, which further inhibited downstream AKT and mTOR activities and acted on the terminal VLA-4(25), VCAM-1(26), LFA-1(27), FLT3(28), NPM-1(29) and c/EBPα (30). Therefore, it is hypothesized that Cim can promote the apoptosis and inhibit the proliferation of AML cells by inhibiting the CXCR4/SDF-1α signaling pathway.

However, there were some limitations to the present study. It only studied the effect of cimigenol on AML cell lines via CXCR4/SDF-1α pathway; the anti-tumor effects of cimigenol might be regulated by other pathways, meanwhile there were some differences between in vitro in AML. Future in vivo studies will address the bioavailability of cimigenol.

 Acknowledgements

Not applicable.

 Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

 Authors' contributions

BM, HD and XMS contributed to the conceptualization and the design of the present study. BM, HD and XD performed the experiments and analyzed the data. XD, SQ, XCS and XMS were responsible for the acquisition, analysis and interpretation of the data. HD and XCS contributed to the drafting of the manuscript. XD and SQ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

 Ethics approval and consent to participate

The present study was approved by the ethics committee of the Affiliated Hospital of Nanjing University of Chinese Medicine (approval no. 2021010606).

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References KumarBGarciaMWengLJungXMurakamiJLHuXMcDonaldTLinAKumarARDiGiustoDLAcute myeloid leukemia transforms the bone marrow niche into a leukemia-permissive microenvironment through exosome secretionLeukemia3257558720182881623810.1038/leu.2017.259 HanahanDCoussensLMAccessories to the crime: Functions of cells recruited to the tumor microenvironmentCancer Cell2130932220122243992610.1016/j.ccr.2012.02.022 UyGLRettigMPMotabiIHMcFarlandKTrinkausKMHladnikLMKulkarniSAbboudCNCashenAFStockerl-GoldsteinKEA phase 1/2 study of chemosensitization with the CXCR4 antagonist plerixafor in relapsed or refractory acute myeloid leukemiaBlood1193917392420122230829510.1182/blood-2011-10-383406 SchmidDWoehsFSvobodaMThalhammerTChibaPMoeslingerTAqueous extracts of Cimicifuga racemosa and phenolcarboxylic constituents inhibit production of proinflammatory cytokines in LPS-stimulated human whole bloodCan J Physiol Pharmacol8796397220091993590410.1139/y09-091 SakuraiNKozukaMTokudaHMukainakaTEnjoFNishinoHNagaiMSakuraiYLeeKHCancer preventive agents. Part 1: Chemopreventive potential of cimigenol, cimigenol-3,15-dione, and related compoundsBioorg Med Chem131403140820051567094810.1016/j.bmc.2004.10.062 JöhrerKStuppnerHGreilRÇiçekSSStructure-guided identification of black cohosh (actaea racemosa) triterpenoids with in vitro activity against multiple myelomaMolecules2576620203205392110.3390/molecules25040766 LiXWangWFanYWeiYYuLQWeiJFWangYFAnticancer efficiency of cycloartane triterpenoid derivatives isolated from Cimicifuga yunnanensis Hsiao on triple-negative breast cancer cellsCancer Manag Res106715672920183058436610.2147/CMAR.S185387 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) methodMethods2540240820011184660910.1006/meth.2001.1262 ZaitsevaLMurrayMYShafatMSLawesMJMacEwanDJBowlesKMRushworthSAIbrutinib inhibits SDF1/CXCR4 mediated migration in AMLOncotarget59930993820142529481910.18632/oncotarget.2479 PeledATavorSRole of CXCR4 in the pathogenesis of acute myeloid leukemiaTheranostics3343920132338278410.7150/thno.5150 SugiyamaTKoharaHNodaMNagasawaTMaintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell nichesImmunity2597798820061717412010.1016/j.immuni.2006.10.016 KonoplevSRassidakisGZEsteyEKantarjianHLiakouCIHuangXXiaoLAndreeffMKonoplevaMMedeirosLJOverexpression of CXCR4 predicts adverse overall and event-free survival in patients with unmutated FLT3 acute myeloid leukemia with normal karyotypeCancer1091152115620071731523210.1002/cncr.22510 JiangZZhouWGuanSWangJLiangYContribution of SDF-1α/CXCR4 signaling to brain development and glioma progressionNeurosignals2124025820132292248110.1159/000339091 GreenbaumAHsuYMDayRBSchuettpelzLGChristopherMJBorgerdingJNNagasawaTLinkDCCXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenanceNature49522723020132343475610.1038/nature11926 SipkinsDAWeiXWuJWRunnelsJMCôtéDMeansTKLusterADScaddenDTLinCPIn vivo imaging of specialized bone marrow endothelial microdomains for tumour engraftmentNature43596997320051595951710.1038/nature03703 TavorSEisenbachMJacob-HirschJGolanTPetitIBenzionKKaySBaronSAmariglioNDeutschVThe CXCR4 antagonist AMD3100 impairs survival of human AML cells and induces their differentiationLeukemia222151515820081876944610.1038/leu.2008.238 AvigdorAGoichbergPShivtielSDarAPeledASamiraSKolletOHershkovizRAlonRHardanICD44 and hyaluronic acid cooperate with SDF-1 in the trafficking of human CD34+ stem/progenitor cells to bone marrowBlood1032981298920041507067410.1182/blood-2003-10-3611 ZhanTCaoCLiLGuNCivinCIZhanXMIM regulates the trafficking of bone marrow cells via modulating surface expression of CXCR4Leukemia301327133420162696528410.1038/leu.2016.39 ZengZShiYXSamudioIJWangRYLingXFrolovaOLevisMRubinJBNegrinRREsteyEHTargeting the leukemia microenvironment by CXCR4 inhibition overcomes resistance to kinase inhibitors and chemotherapy in AMLBlood1136215622420091895556610.1182/blood-2008-05-158311 GalskyMDVogelzangNJConklingPRaddadEPolzerJRobersonSStilleJRSalehMThorntonDA phase I trial of LY2510924, a CXCR4 peptide antagonist, in patients with advanced cancerClin Cancer Res203581358820142472732410.1158/1078-0432.CCR-13-2686 KarpovaDBräuningerSWiercinskaEKrämerAStockBGraffJMartinHWachAEscotCDouglasGMobilization of hematopoietic stem cells with the novel CXCR4 antagonist POL6326 (balixafortide) in healthy volunteers-results of a dose escalation trialJ Transl Med15220172804949010.1186/s12967-016-1107-2 HoellenriegelJZboralskiDMaaschCRosinNYWierdaWGKeatingMJKruschinskiABurgerJAThe spiegelmer NOX-A12, a novel CXCL12 inhibitor, interferes with chronic lymphocytic leukemia cell motility and causes chemosensitizationBlood1231032103920142427707610.1182/blood-2013-03-493924 GrosSJGraeffHDrenckhanAKurschatNBlessmannMRawnaqTIzbickiJRCXCR4/SDF-1α-mediated chemotaxis in an in vivo model of metastatic esophageal carcinomaIn Vivo26711718201222773586 ZhuHSunQTanCXuMDaiZWangZFanJZhouJTacrolimus promotes hepatocellular carcinoma and enhances CXCR4/SDF-1α expression in vivoMol Med Rep1058559220142491249510.3892/mmr.2014.2302 HoltRUFagerliUMBaykovVRøTBHovHWaageASundanABørsetMHepatocyte growth factor promotes migration of human myeloma cellsHaematologica9361962220081832652610.3324/haematol.11867 FanXChenXFengQPengKWuQPasseriniAGSimonSISunCDownregulation of GATA6 in mTOR-inhibited human aortic endothelial cells: Effects on TNF-α-induced VCAM-1 expression and monocytic cell adhesionAm J Physiol Heart Circ Physiol316H408H42020193046255210.1152/ajpheart.00411.2018 WagnerJARosarioMRomeeRBerrien-ElliottMMSchneiderSELeongJWSullivanRPJewellBABecker-HapakMSchappeTCD56bright NK cells exhibit potent antitumor responses following IL-15 primingJ Clin Invest1274042405820172897253910.1172/JCI90387 ChenWDrakosEGrammatikakisISchletteEJLiJLeventakiVStaikou-DrakopoulouEPatsourisEPanayiotidisPMedeirosLJRassidakisGZmTOR signaling is activated by FLT3 kinase and promotes survival of FLT3-mutated acute myeloid leukemia cellsMol Cancer929220102106758810.1186/1476-4598-9-292 MarzecMKasprzyckaMLiuXEl-SalemMHalasaKRaghunathPNBuckiRWlodarskiPWasikMAOncogenic tyrosine kinase NPM/ALK induces activation of the rapamycin-sensitive mTOR signaling pathwayOncogene265606561420071735390710.1038/sj.onc.1210346 WatanabeMHisatakeMFujimoriKFisetin suppresses lipid accumulation in mouse adipocytic 3T3-L1 cells by repressing GLUT4-mediated glucose uptake through inhibition of mTOR-C/EBPα signalingJ Agric Food Chem634979498720152594578610.1021/acs.jafc.5b00821

Different concentrations of Cim suppress AML cell proliferation protected by BMSC. EdU-positive cell rate in (A) MV-4-11 and (B) U937 cell line (%, magnification, x200). ***P<0.001 vs. NC; #P<0.05, ##P<0.01, ###P<0.001 vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim.

Different concentrations of Cim suppress increased AML cell apoptosis protected by BMSC by flow cytometry. Apoptosis cell rates in (A) MV-4-11 and (B) U937 (%). ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim.

Different concentrations of Cim suppress increased apoptosis AML cell number protected by BMSC by TUNEL assay. Positive apoptotic cell number in (A) MV-4-11 and (B) U937 (magnification, x200). ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

Different concentrations of Cim suppress affect relative gene expression by reverse transcription-quantitative PCR. Relative gene expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; AML, acute myeloid leukemia; BMSC, bone marrow stromal cells; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

Different concentrations of Cim suppress affected relative protein expression by western blotting. Relative protein expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; #P<0.05, ##P<0.01, ###P<0.001, vs. BMSC; $P<0.05, $$P<0.01, vs. BMSC + Low; &P<0.05, vs. BMSC + Middle. Cim, cimigenol; CXCR4, C-X-C chemokine receptor type 4; SDF-1α, stromal cell-derived factor-1α; p-, phosphorylated; VLA-4, very-late-antigen-4; VCAM1, vascular cell adhesion molecule 1; LFA-1, leukocyte function-associated antigen-1; FLT3, Fms like tyrosine kinase receptor 3; NPM-1, nucleophosmin 1; C/EBPA, CCAAT/enhancer-binding protein alpha; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

Effect of CXCR4 on the anti-tumor effects of Cim in cell proliferation. EdU-positive cell rate in (A) MV-4-11 and (B) U937 (%, x200). ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. CXCR4, C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

Effect of CXCR4 on the anti-tumor effects of Cim in cell apoptosis by flow cytometry. Apoptosis cell rate in (A) MV-4-11 and (B) U937 (%). ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

Effect of CXCR4 on the anti-tumor effects of Cim in cell apoptosis by TUNEL assay. Number of positive apoptotic cells in (A) MV-4-11 and (B) U937 (magnification, x200). ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

CXCR4 inhibitor affected relative gene expression. Relative gene expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. C-X-C chemokine receptor type 4; Cim, cimigenol; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

CXCR4 inhibitor affects relative protein expression. Relative protein expression in (A) MV-4-11 and (B) U937. ***P<0.001, vs. NC; ###P<0.001, vs. BMSC. Cim, cimigenol; CXCR4, C-X-C chemokine receptor type 4; SDF-1α, stromal cell-derived factor-1α; p-, phosphorylated; VLA-4, very-late-antigen-4; VCAM1, vascular cell adhesion molecule 1; LFA-1, leukocyte function-associated antigen-1; FLT3, Fms like tyrosine kinase receptor 3; NPM-1, nucleophosmin 1; C/EBPα, CCAAT/enhancer-binding protein alpha; NC, cells in normal culture medium; BMSC, cells co-cultured with BMSC; BMSC + DMSO, cells co-cultured with BMSCs and treated with 250 µl DMSO; BMSC + Low, cells co-cultured with BMSCs and treated with 5 mg Cim; BMSC + Middle, cells co-cultured with BMSCs and treated with 10 mg Cim; BMSC + High, cells co-cultured with BMSCs and treated with 20 mg Cim; BMSCs, breaking bone marrow stromal cells.

Primer sequences.

Gene Forward (5'-3') Reverse (5'-3') Size
AKT CAGGATGTGGACCAACGTGA AAGGTGCGTTCGATGACAGT 137 bp
c/EBPα GACAAGAACAGCAACGAGTACC GTCATTGTCACTGGTCAGCTC 132 bp
CXCR4 TTCCAGTTTCAGCACATCATGG GTCGATGCTGATCCCAATGTAG 192 bp
FLT3 GTGAATCCTTACCCTGGCATTC GTCAAATTAGGGAAGGATGGCC 164 bp
LFA-1 GGTTGACGTGGTGTATGAGAAG GAAACCAACCTTGTACAGCACT 109 bp
mTOR AACCTCCTCCCCTCCAATGA TCAGCGGTAAAAGTGTCCCC 92 bp
NPM-1 CACCAAAAGGACCTAGTTCTGT TGCCAGAGATCTTGAATAGCCT 157 bp
SDF-1α GATTCTTCGAAAGCCATGTTGC TCAATGCACACTTGTCTGTTGT 121 bp
VCAM-1 AGTTCTTGTTTGCCGAGCTAAA AAATCTCTGGAGCTGGTAGACC 197 bp
VLA-4 AACATGAGCAGATTGGTAAGGC CAGACAGAAGCTCCAAAGTACG 112 bp
GAPDH CAAATTCCATGGCACCGTCA AGCATCGCCCCACTTGATTT 109 bp