Secreted protein acidic and rich in cysteine (SPARC), also called basement-membrane protein 40 or osteonectin, is a matricellular protein that is abundant not only in bone tissue as a non-collagenous protein but is also ubiquitously expressed in non-calcified tissue. SPARC is located intracellularly and disruption of the
Secreted protein acidic and rich in cysteine (SPARC), also known as basement-membrane protein 40 or osteonectin, is a 43-kDa glycoprotein classified as a matricellular protein (
SPARC has also been reported to localize to nuclei (
Adipogenesis by mesenchymal stem cells is induced by several transcription factors, such as peroxisome proliferator-activated receptor-γ (PPARγ) and C/EBPα. C/EBPβ and C/EBPδ are factors that induce PPARγ- and C/EBPα-expressing preadipocytes, which suggests that PPARγ and C/EBPα serve roles during the late stages of adipogenic differentiation (
AP-1 is a homo- or hetero-dimeric transcription factor consisting of basic region leucine zipper domain proteins, such as Fos and Jun, that translocates into the nucleus. Although the Fos proteins, such as c-Fos, Fra-1, Fra-2, FosB and the short isoform of FosB (ΔFosB), heterodimerize only with their counterpart Jun proteins, such as c-Jun, JunB and JunD, the Jun proteins homodimerize or heterodimerize with Fos proteins. The Fos/Jun and Jun/Jun dimers bind to TPA-response element (TRE; 5′-TGACTCA-3′) (
RPMI 1640 medium and simvastatin were purchased from MilliporeSigma; α-minimum essential medium (α-MEM) was purchased from MP Biomedicals; and ascorbic acid, β-glycerophosphate alizarin red-S, Oil red O and ethidium bromide were purchased from FUJIFILM Wako Pure Chemical Corporation. Fetal bovine serum (FBS) was purchased from Hyclone (Cytiva). Guanidinium thiocyanate, phenol, chloroform and Bacto Yeast Extract were purchased from Nacalai Tesque, Inc. Prime STAR GXL DNA Polymerase and Xfect Transfection Reagent, SYBR Premix Ex
Anti-SPARC polyclonal antibody (pAb) (1:1,000; cat. no. ab55847) was purchased from Abcam, anti-c-Jun (G-4) monoclonal antibody (mAb) (1:1,000; cat. no. sc-74543), and anti-c-Fos (H-125) mAb (1:1,000; cat. no. sc-7202) were purchased from Santa Cruz Biotechnology, Inc. Anti-β actin pAb (1:1,000; cat. no. GTX109639) and anti-GAPDH pAb (1:1,000; cat. no. GTX100118) were purchased from GeneTex, Inc.; anti-Lamin-A pAb (1:1,000; cat. no. 3267) was purchased from BioVision, Inc. Anti-FLAG M2 mAb (1:1,000; cat. no. F1804) was purchased from MilliporeSigma; and biotin-conjugated anti-rabbit IgG pAb (1:10,000; cat. no. 111-065-144) and biotin-conjugated anti-mouse IgG pAb (1:10,000; cat. no. 115-065-003) were purchased from Jackson ImmunoResearch Laboratories.
p3×FLAG-CMV-9 and p3×FLAG-CMV-10 vectors were purchased from MilliporeSigma. The pAP1(1)-Luc vector was purchased from Affymetrix, Inc.; pGL4.75[hRluc CMV] was from Promega Corporation; and pNCMO2 was from Takara Bio, Inc.
Sequence data for cDNA and proteins were downloaded from the National Center for Biotechnology Information (
The mouse bone marrow stromal ST2 cell line was purchased from the RIKEN BioResource Center (
The ST2 cell clone with low SPARC production (
For osteoblastic differentiation, 70% confluent ST2 cells were incubated with α-MEM supplemented with 10% FBS, 50 µg/ml ascorbic acid and 10 mM β-glycerophosphate for 3 weeks. In some cases, 10−6 M simvastatin was also added and cultured for 3 weeks. Calcified deposits were assessed by staining with 40 mM alizarin red-S (pH, 4.2) at room temperature for 10 min. After washing with distilled water five times, images of the culture plates were captured using a digital camera and the red-stained areas were quantified using ImageJ software version 1.5.3 (National Institutes of Health) (
Total RNA was extracted from Ca9-22 cells using the standard acid guanidinium-phenol-chloroform (AGPC) extraction method (
Transfection of vectors into SPARC-low ST2 cells was proceeded using Xfect Transfection Reagent according to the manufacturers' protocol. Briefly, 5 µg plasmids were mixed with 1.5 µl Xfect polymer and incubated at room temperature for 10 min, followed by the mixture being added to the cultures in a 6-well culture plate. After incubation of the cells in a CO2 incubator for 4 h, the culture medium was refreshed and the cells were further incubated for 24 h for AP-1 measurements and 48 h for preparation of CM.
SPARC-low ST2 cells were transfected with mock or Flag-tagged SPARC expression vector as aforementioned. Post-transfection, the medium was refreshed with RPMI 1640 supplemented with 10% FBS, and the cells were incubated for a further 48 h. The CM was collected and clarified by centrifugation at 1,000 × g for 10 min to obtain the following: SPARC (+) CM and SPARC (−) CM.
Serum-free SPARC (+) or (−) CM was prepared from the parallel cultures and subjected to western blot analysis. Briefly, after the transfected cells were cultured for 24 h in RPMI 1640 supplemented with 10% FBS, they were cultured for a further 24 h in serum-free RPMI 1640. The serum-free CM was collected and clarified by centrifugation at 1,000 × g at room temperature for 10 min. The supernatant was analyzed by western blotting.
Total RNA was extracted from parental ST2 cells, SPARC-low ST2 cells and transfected cells using the (AGPC) extraction method. RNA was reverse transcribed at 55°C for 10 min, followed by 80°C for 10 min for inactivation of the enzyme, using SuperScript IV Reverse Transcriptase with Oligo dT for PCR and at 37°C for 60 min, followed by 95°C for 5 min for inactivation of the enzyme, using a High-Capacity cDNA Reverse Transcription Kit for qPCR.
For RT-PCR, the resultant cDNA was amplified using Prime STAR GXL DNA Polymerase using specific primers (
For quantification of mRNA expression, the resultant cDNA was amplified using SYBR Premix Ex
AP-1 activity was assessed using a luciferase reporter assay. Briefly, SPARC-low ST2 cells were seeded at a density of 1×105 cells/well in 24-well culture plates, incubated overnight in a CO2 incubator and co-transfected at 37°C for 4 h with the AP1(1) Luc vector and the pGL4.75 vector using Xfect Transfection Reagent. After removal of the transfection reagent, the cells were incubated for an additional 24 h at 37°C and luminescence intensity was assessed using a TriStar2 LB942 plate reader (Titertek-Berthold) using a dual reporter assay kit (
Whole cell lysates of parental ST2 cells, SPARC-low ST2 cells and transfected cells were prepared using RIPA buffer. Nuclear fractions were extracted as described previously (
Total RNA, which was extracted from Ca9-22 cells for
EMSA was performed using oligo DNA with a biotinylated 5′-end. Briefly, the following sequences: DNA oligonucleotide containing TRE sequence forward (F), 5′-TGAGTCAATGAGTCAGCTGACTCATTGACTCA-3′ and reverse (R), 5′-GGTGAGTCAATGAGTCAGCTGACTCATTGACTCA-3′; and DNA oligonucleotide containing mutant TRE sequence F, 5′-TGTGACAATGTGACAGCTGTCACATTGTCACA-3′ and R, 5′-GGTGTGACAATGTGACAGCTGTCACATTGTCACA-3′, were annealed and used as probes (underlined bases indicate mutation positions of the TRE element). Recombinant proteins (2 µg), which were prepared using the
To evaluate the direct binding of SPARC and AP-1 components, far western blotting was performed using recombinant proteins: The subjected protein is blotted on the membrane and then the candidate protein of the counterpart is overplayed. Finally, the yielded complex on the membrane is detected. This assay is considered suitable to assess the direct binding of proteins and is comparable with other assays, such as the immunoprecipitation assay, which are also able to detect indirect binding complex. Briefly, recombinant proteins (0.5, 1.0 and 2.0 µg) from
Protein concentrations were determined prior to western blotting, EMSA and far western blotting according to the Lowry protein assay method using DC™ protein assay kits with bovine serum albumin as the standard, according to the manufacturer's protocol.
All experiments were performed in triplicate to ensure that ≥2 independent experiments yielded similar results. Results were presented as the mean ± standard error of the mean (n=3). Comparisons between two independent groups were evaluated using unpaired Student's t-test using Microsoft Excel version 2210 (Microsoft Corporation) and multiple comparisons of ≥3 groups were evaluated using one-way ANOVA followed by Scheffé's F-test (
A clone without obvious expression of SPARC was selected from parental ST2 cells and was thereafter named SPARC-low ST2 cells. The mRNA and protein expression levels of SPARC in the parental and SPARC-low ST2 cells were shown in
The intracellular function of SPARC was initially evaluated by assessing its presence in the nuclear and post-nuclear fractions of ST2 cell lysates, and in their CM. SPARC was not detected in the nucleus but was demonstrated in the post-nuclear fractions of both parental ST2 cells and SPARC-rescued SPARC-low ST2 cells (
The effects of
When SPARC-low ST2 cells and their parental cells were cultured in CM from SPARC-rescued SPARC-low ST2 cells [SPARC (+) CM], AP-1 activity was significantly lower compared with that in cells cultured in CM from mock-transfected SPARC-low ST2 cells [SPARC (−) CM] (
To evaluate whether SPARC reduced AP-1 transcription activity by interfering with its dimerization, the recombinant peptides c-Fos, c-Jun and SPARC were expressed in
The matricellular proteins include SPARC, thrombospondins, tenascins and CCNs, such as cysteine-rich 61 and connective tissue growth factor (
Phenotypically,
This hypothesis was supported by previous studies, which reported that Fra-2 suppressed PPARγ2 in adipocytes (
In the present study, it was demonstrated that secreted SPARC functioned intracellularly as a decoy counterpart of c-Fos, after its incorporation from the extracellular space. The un-secreted form (absence of signal peptide) demonstrated no AP-1-inhibiting activity. Furthermore, the far western blotting assay using recombinant proteins, which were not in their glycosylated forms, demonstrated that SPARC bound c-Fos. Because SPARC is a highly glycosylated protein, it is still possible that glycosylation of SPARC may affect AP-1 activity. Further studies are required to elucidate the inhibitory mechanism.
SPARC levels (both mRNA and protein) have been reported to be closely related to obesity and diabetes mellitus. Weight loss resulting from a very low-calorie diet has been reported to cause a concomitant 33% reduction of
The aforementioned clinical observations seemingly oppose the
The present study was based on a PhD thesis (Tomoya Hatori), which was published by Ohu University Press in 2020.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
TH and YK wrote the manuscript. TH, TM and AS performed the experiments. TH, KT and YK analyzed the data. TM, KT and YK designed the experiments. TH, TM and YK confirm the authenticity of all the raw data. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Adipogenesis is higher but osteoblastogenesis is lower in SPARC-low ST2 cells compared with in parental ST2 cells. (A) SPARC expression was assessed at the mRNA and protein levels in cells and CM using RT-PCR and western blotting. (B) SPARC-low ST2 cells demonstrated low mineralized nodule formation activity. Data were presented relative to those of parental ST2 cells cultured in osteogenic medium without simvastatin. (C) Relative mRNA expression levels of osteoblastogenesis-associated genes, including
Rescued secreted SPARC localizes to the post-nuclear fraction and inhibits AP-1 activity. (A) SPARC localized to the post-nuclear fraction. Cells were lysed and fractionated into nuclear and post-nuclear fractions. SPARC protein expression levels were assessed using western blotting. Lamin A/C and GAPDH were used as internal controls for the nuclear fraction and post-nuclear fraction, respectively. Mock, empty vector. (B) Comparison of the amino acid sequences of human and mouse SPARC. The amino acid sequences of SPARC were downloaded from NCBI (human, NP_003109.1; mouse, NP_033268.1). Mouse SPARC was 92% homologous with human SPARC including the signal peptide (AA 1 to 17). (C) Secreted SPARC reduced AP-1 activity (left panel). Cells were transfected with the AP1(1)-Luc vector, with or without SPARC expression vectors, as follows: w/o vector; Mock, empty vector; SPARC (AA 18 to 303) with WT SP; SPARC (AA 18 to 303) with PPT SP (AA 1 to 17); SPARC (AA 18 to 303) w/o SP. Luciferase activity was measured 24 h after transfection. N-terminal structure of the SPARC expression vectors is illustrated (right panel). ***P<0.001. AP-1, activator protein-1; AA, amino acid residue; SPARC, secreted protein acidic and rich in cysteine; w/o, without; WT, wild type; SP, signal peptide; PPT, preprotrypsin.
Secreted SPARC reduces AP-1 activity. CM from SPARC-low ST2 cells that had been transfected with SPARC expression vector with wild-type signal peptide, which had a FLAG sequence inserted between the signal peptide (AA 1 to 17) and mature protein (AA 18 to 303), or with the mock vector were obtained [SPARC (+) CM or SPARC (−) CM]. Cells were transfected with AP1(1) Luc vector and treated using SPARC (+) CM or SPARC (−) CM, followed by evaluation of AP-1 activity using the luciferase reporter assay. *P<0.05, **P<0.01 and ***P<0.001. AP-1, activator protein-1; SPARC, secreted protein acidic and rich in cysteine; CM, conditioned media.
SPARC reduces AP-1 binding to Oligo incl TRE. Effect of SPARC on binding of AP-1 to the TRE was evaluated using an electrophoretic mobility shift assay. The recombinant AP-1 proteins (rc-Fos and/or rc-Jun) were incubated with the biotinylated Oligo incl TRE in the presence or absence of rSPARC. AP-1, activator protein-1; SPARC, secreted protein acidic and rich in cysteine; TRE, TPA-response element; Oligo incl TRE, DNA oligonucleotide containing TRE sequence; r, recombinant.
Binding of SPARC to c-Fos. Binding of SPARC to activator protein-1 components was evaluated using far western blotting. Briefly, the recombinant proteins were spotted on the membrane, overlaid with proteins as indicated and treated with antibodies against the overlaid proteins. The complex was visualized using the chemiluminescence method. SPARC, secreted protein acidic and rich in cysteine; r, recombinant; IB, immunoblot.
Sequences of primers used for reverse transcription-PCR.
Gene | Sequence, 5′-3′ | Product, bp | Accession number |
---|---|---|---|
F: ATGAGGGCCTGGATCTTCTTTCTCCTTT | 909 | NM_001290817.1 | |
R: TTAGATCACCAGATCCTTGTTGATGTCCTG | |||
F: CGCAGCCACTGTCGAGTC | 467 | NM_007393.5 | |
R: AAGGTCTCAAACATGATCTGGGT | |||
F: ATGAGGGCCTGGATCTTCTTTCTCCTTT | 909 | NM_003118.4 | |
R: GATCACAAGATCCTTGTCGATATCCTTCTG | |||
F: ATGATGTTCTCGGGTTTCAACGCCGACTAC | 1,155 | NM_010234.2 | |
R: TTCTCTGACTGCTCACAGGGCCAGCA | |||
F: ATGACTGCAAAGATGGAAACGACCTTCTAC | 1,005 | NM_010591.2 | |
R: TCAAAACGTTTGCAACTGCTGCGTTAG |
F, forward, R, reverse; SPARC, secreted protein acidic and rich in cysteine.
Sequences of primers used for reverse transcription-quantitative PCR.
Genes | Sequence, 5′-3′ | Accession number |
---|---|---|
F: AGTTTACACTGCCCCTGCT | NM_009367.4 | |
R: AGAGGTGCCATCAATACCTGC | ||
F: GCAGTATGAATTGAATCGGAACAA | NM_007431.3 | |
R: ATGGCCTGGTCCATCTCCAC | ||
F: GACATGTTCAGCTTTGTGGACCTC | NM_007742.4 | |
R: GGGACCCTTAGGCCATTGTGTA | ||
F: CAACAGGAGGGTGCAGAACAGA | NM_001305448.1 | |
R: GCTTGGACATGAAGGCTTTGTC | ||
F: GGATGGAGTGACGGATGACG | NM_013459.4 | |
R: TGAGGCACTACACTCTGCAC | ||
F: TGAAATCACCGCAGACGACA | NM_024406.4 | |
R: ACACATTCCACCACCAGCTT | ||
F: GCTTATTTATGATAGGTGTGATC | NM_001127330.2 | |
R: GCATTGTGAGACATCCCCAC | ||
F: GCCCGGACCCTATACCCTAT | NM_009204.2 | |
R: GGGTTCCCCATCGTCAGAG | ||
F: CATCCGTAAAGACCTCTATGCCAAC | NM_007393.5 | |
R: ATGGAGCCACCGATCCACA |
F, forward, R, reverse; Tfgb2,