*Contributed equally
MIR503HG is a 786 bp long lncRNA located on chromosome Xq26.3, and it can regulate diverse cellular processes. The pathogenesis of adenomyosis (AD) is associated with endometrial stromal cells (ESCs). The present study investigated the specific role of MIR503HG in AD pathogenesis and progression using ESCs derived from the endometrium of patients with AD as a model. Expression of MIR503HG and microRNA (miR)-191 were assessed using reverse transcription-quantitative PCR. An immunocytochemistry assay was used to detect cytokeratin- or vimentin-positive ESCs. Transfections of ESCs with MIR503HG overexpression plasmid, short hairpin-MIR503HG and miR-191 inhibitor were performed. ESC viability, migration, invasion and apoptosis were evaluated using Cell Counting Kit-8, Transwell and flow cytometry assays. The association between MIR503HG and miR-191 was predicted by StarBase and confirmed using a dual-luciferase reporter assay. Expression of epithelial-mesenchymal transition-related markers (E-cadherin and N-cadherin) and Wnt/β-catenin pathway-related molecules (β-catenin) in ESCs were analyzed by western blotting. The isolated ESCs were vimentin-positive and cytokeratin-negative. MIR503HG was lowly expressed in the endometrial tissues derived from patients with AD. MIR503HG overexpression hindered ESC viability, migration and invasion while enhancing the apoptosis and downregulating miR-191 expression. MIR503HG knockdown induced the opposite effects, accompanied by downregulation of the E-cadherin expression and upregulation of N-cadherin and β-catenin levels. MIR503HG directly targeted miR-191 that was highly expressed in endometrial tissues derived from patients with AD. In ESCs, downregulation of miR-191 inhibited the viability, migration and invasion and the expression of N-cadherin and β-catenin levels while enhancing the apoptosis and E-cadherin expression in ESCs. Moreover, downregulation of miR-191 partially reversed the effect of MIR503HG knockdown. Collectively, overexpressed MIR503HG impeded the proliferation and migration of ESCs derived from endometrium of patients with AD, while promoting apoptosis via inhibition of the Wnt/β-catenin pathway via targeting miR-191.
Adenomyosis (AD) is defined as invasion of endometrial glands and stroma into the myometrium (
It may be a novel approach to develop the treatment of AD from the perspective of genetics, as long non-coding RNAs (lncRNAs) are aberrantly expressed in both eutopic and ectopic endometria of patients with AD (
In addition, the conventional view is that AD results from the abnormal down-growth and invagination of the endometrium into the myometrium (
In the present study, the expression of MIR503HG in AD was characterized and a potential mechanism by which MIR503HG regulates AD by modulating its downstream miRNAs was investigated. Meanwhile, since MIR503HG has been reported to target miR-191 to promote tumor inhibition in cervical cancer (
The study was ratified by the Ethics Committee of People's Hospital of Deyang City (approval no. GD202000524; Deyang, China) and written informed consent from all participants was obtained for experimental work involving tissues obtained from humans.
AD tissue (n=30) was collected from the endometrium of patients with AD (mean age, 42.75±5.62 years; range, 31-58 years) who had been diagnosed clinically and pathologically at People's Hospital of Deyang City in July 2020 to November 2020. None of the patients had received preoperative chemotherapy, radiotherapy or hormone therapy or had a history of chronic disease such as coronary heart disease and hypertension. During the same period, specimens taken from the endometrium (n=30) of patients with cervical lesions or uterine fibroids after hysterectomy but without AD (mean age, 40.24±3.73 years; range, 32-49 years) were used as the control group. In the control group, the patients had no history of hormone therapy or chronic diseases. All tissues were immediately snap-frozen in liquid nitrogen at -80˚C for 40 min for further use.
ESCs were isolated from the endometrium of patients with AD (n=3) as follows: The endometrium was cut into 0.5-1.0 mm3 sections and digested with 0.25% trypsin (cat. no. 9002-07-7; Sigma-Aldrich; Merck KGaA) that was diluted to 1.25 mg/l with Dulbecco's Modified Eagle Medium (DMEM)/F-12 (cat. no. 21041025; Thermo Fisher Scientific, Inc.). The sections were incubated at 37˚C with 5% CO2 for 80 min, then a cell suspension was obtained and filtered twice through a nylon mesh (140- and 37-µm mesh in sequence). Subsequently, the filtered suspension was centrifugated at 1,000 x g for 5 min at 4˚C and ESCs were obtained as previously described (
After being fixed in 4% paraformaldehyde (cat. no. P6148; Sigma-Aldrich; Merck KGaA) for 15 min at room temperature, ESCs (2x104 cells/ml) were washed with PBS (cat. no. P5493, Sigma-Aldrich; Merck KGaA) three times and incubated with 0.1% Triton X-100 (cat. no. X100; Sigma-Aldrich; Merck KGaA) for improvement of permeability. The cells were washed with PBS three times and blocked in 5% bovine serum albumin (cat. no. A7030; Sigma-Aldrich; Merck KGaA) for 20 min at room temperature. Subsequently, anti-vimentin (cat. no. PA5-27231; 1:1,000; Thermo Fisher Scientific, Inc.) and anti-cytokeratin antibody (cat. no. PA5-32465; 1:100; Thermo Fisher Scientific, Inc.) were used to incubate the cells at 4˚C overnight. After being washed with PBS, cells were incubated with goat anti-Rabbit IgG HRP (cat. no. 31466; 1:1,000; Thermo Fisher Scientific, Inc.) at 4˚C for 60 min in the dark. Following washing with PBS, cells were color-developed using diaminobenzidine (cat. no. D8001; Sigma-Aldrich; Merck KGaA) for 5 min at room temperature and counterstained with hematoxylin (cat. no. H3136, Sigma-Aldrich; Merck KGaA) for 1 min at room temperature. ESCs were observed by a light microscope (IX71; Olympus Corporation; magnification, x200).
MIR503HG overexpression plasmids were constructed with pcDNA3.1 vector (cat. no. V79520; Thermo Fisher Scientific, Inc.). Short hairpin (sh)-MIR503HG (5'-CATCCAGCATCTCCAGTTA-3') was constructed using MISSION pLKO.1-puro Empty Vectors (cat. no. SHC001; Sigma-Aldrich; Merck KGaA). Empty vector and scrambled sequence (5'-TTCTCCGAACGTGTCACGT-3') were used as negative controls (NCs). miR-191 inhibitor/inhibitor control (IC; miR20000440-1-5, 5'-CAGCUGCUUUUGGGAUUCCGUUG-3'; miR2N0000001-1-5, 5'-UCUACUCUUUCUAGGAGGUUGUGA-3') and mimic/mimic control (miR10000440-1-5, 5'-CAACGGAAUCCCAAAAGCAGCUG-3'; miR1N0000001-1-5, 5'-UUCUCCGAACGUGUCACGU-3') were purchased from Guangzhou RiboBio Co., Ltd. ESCs were transfected with MIR503HG overexpression plasmids, sh-MIR503HG, miR-191 inhibitor/mimic or a combination of sh-MIR503HG and miR-191 inhibitor using Lipofectamine 3000® (cat. no. L3000015; Thermo Fisher Scientific, Inc.). Briefly, ESCs were plated in 96-well plates at a density of 1x104 cells/well and cultured to 80% confluence. Opti-MEM (10 µl; cat. no. 31985062; Thermo Fisher Scientific, Inc.) and P3000 reagents (0.4 µl; Thermo Fisher Scientific, Inc.) were used in combination to dilute the plasmids (0.2 µg) and Lipofectamine 3000 (0.15 µl), and the diluted Lipofectamine 3000 reagent and diluted plasmid was mixed, followed by incubation at 37˚C for 10 min. Finally, RNA-lipid complex was added to 96-well plates to incubate the cells at 37˚C for 24 or 48 h before further use.
Starbase v.2.0 (
RIP assay was performed using a RIP kit (cat. no. RIP-12RXN; Sigma-Aldrich; Merck KGaA). ESCs were digested with trypsin (Sigma-Aldrich; Merck KGaA) and collected the cells, and then cells were ransferred into a mixed solution containing PBS, nuclear separation buffer and double-distilled H2O. The solution was stirred on ice and centrifuged at 2,500 x g for 15 min at 4˚C. The precipitated nucleus of ESCs was resuspended in RIP buffer. The solution was uniformly divided into IgG and the Ago2 group. The supernatant in the IgG group was added to 10 µg anti-IgG antibody (cat. no. ab171870; 1:1,000; Abcam) while that in the Ago2 group was added to 10 µg Ago2 antibody (cat. no. ab186733; 1:30; Abcam), gently shaken and then incubated at 4˚C overnight. The supernatant was added to 40 µl protein A/G magnetic beads (cat. no. M2400; Beijing Solarbio Science & Technology Co., Ltd.) and cultured at 4˚C for 1 h. Unconjugated protein was removed by RIP buffer washing. The untreated cell lysate was used as an input group. The RNAs in the input group, IgG and Ago2 group were extracted and reverse-transcribed into cDNA. Subsequently, the expression of miR-191 and MIR503HG were measured via quantitative polymerase chain reaction (qPCR). Expression in the input group was considered to be positive control.
Following transfection, ESCs were plated into 96-well plates at a density of 5x103 cells/well. CCK-8 reagent (cat. no. C0037; Beyotime Institute of Biotechnology) was added into the cells at a ratio of 1:10, after which cell incubation was performed at 37˚C for 1 h. Cell viability was measured based on the optical density using a microplate reader (Synergy Neo2; BioTek Instruments, Inc.; Agilent Technologies, Inc.) at a wavelength of 450 nm.
Cell migration and invasion of transfected ESCs were evaluated by Transwell chambers (cat. no. 428; Corning, Inc.). For invasion assays, Transwell upper chambers were precoated with Matrigel (cat. no. 356234; Corning, Inc.) diluted at a ratio of 1:3 and incubated at 37˚C for 2 h. Following transfection, ESCs were suspended in serum-free DMEM/F12 to a concentration of 2x105 cells/ml and cell suspension (100 µl) was poured into the upper chamber. The lower chamber was filled with DMEM/F12 (600 µl) supplemented with 10% FBS (cat. no. F2442; Sigma-Aldrich; Merck KGaA). The whole Transwell chamber was incubated at 37˚C for 24 h, after which non-migratory or non-invading cells in the upper chamber were removed. The remaining cells were washed twice with PBS, fixed in 4% paraformaldehyde (cat. no. P6148; Sigma-Aldrich; Merck KGaA) at room temperature for 20 min and stained with Giemsa (800 µl; cat. no. 10092013; Thermo Fisher Scientific, Inc.) at room temperature for 15 min. Finally, stained cells were observed under an inverted light microscope (IX71; Olympus Corporation) and counted with ImageJ v.1.47 (National Institutes of Health, Bethesda, MD, USA) from eight randomly selected fields. The cell migration or invasion rate was set to 100% in control groups, while that in other groups was calculated by comparing the mean cell number with that in the control group.
The apoptosis of transfected ESCs was measured using Annexin V-FITC/PI apoptosis detection kit (cat. no. 40302ES20; Shanghai Yeasen Biotechnology Co., Ltd.). After transfection, ESCs were digested in EDTA-free trypsin (cat. no. T2600000; Sigma-Aldrich; Merck KGaA) at room temperature for 2 min and centrifugated at 3,000 x g for 5 min at 4˚C, followed by washing with PBS. Subsequently, the cells were resuspended with 1X Binding Buffer to reach the concentration of 1x106 cells/ml. Annexin V-FITC solution (5 µl) and PI solution (10 µl) were used to incubate the cells in the dark for 10 min at room temperature. Apoptotic cells (early and late apoptosis) were examined using a flow cytometer (CytoFLEX; Beckman Coulter, Inc.) and analyzed with CytExpert software (Version 2.2.0.97; Beckman Coulter, Inc.).
AD tissues were homogenized using a UH-05 homogenizer (Union-Biotech). Total RNA and miRNA were extracted from ESCs, with or without transfection and AD and control tissues using TRIzol® (cat. no. 15596026; Thermo Fisher Scientific, Inc.) and PureLink miRNA Isolation kit (cat. no. K157001; Thermo Fisher Scientific, Inc.), respectively. The extracted total RNA and miRNA were reverse-transcribed to cDNA using SuperScript IV reverse transcriptase (cat. no. 18090010; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. qPCR was performed on a CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories, Inc.) using PowerUp SYBR Green Master Mix (cat. no. A25742; Thermo Fisher Scientific, Inc.). The primer pairs used for qPCR are listed in
Total protein from transfected ESCs was extracted using RIPA Buffer (cat. no. 89900; Thermo Fisher Scientific, Inc.) and quantified using a BCA assay (cat. no. A53227; Thermo Fisher Scientific, Inc.). The extracted protein (40 µg/lane) and marker (4 µl; cat. no. PR1910; Beijing Solarbio Science & Technology Co., Ltd.) were loaded and separated by SDS-PAGE on a 10 or 12% gel (cat. nos. P0670 and P0672, Beyotime Institute of Biotechnology) and then transferred onto PVDF membranes (cat. no. P2438; Sigma-Aldrich; Merck KGaA). The membranes were blocked with 5% non-fat milk in TBS with 1% Tween-20 (TBST; cat. no. T9039, Sigma-Aldrich; Merck KGaA) for 1 h at 37˚C. Subsequently, membranes were incubated with primary antibodies against E-cadherin (cat. no. ab40772; 97 kDa; 1:10,000; Abcam), N-cadherin (cat. no. ab18203; 130 kDa; 1:1,000; Abcam), β-catenin (cat. no. 9562; 92 kDa, 1:1,000; Cell Signaling Technology, Inc.), cleaved caspase-3 (cat. no. ab32042; 17 kDa; 1:500; Abcam) and GAPDH (cat. no. 5174; 37 kDa; 1:1,000; Cell Signaling Technology, Inc.) at 4˚C overnight. Following washing with TBST, membranes were incubated with a secondary Goat anti-Rabbit IgG Alexa Fluor™ Plus 488 (cat. no. A32731; 1:10,000; Thermo Fisher Scientific, Inc.) at 37˚C for 1 h. Immunoreactive bands were visualized using enhanced chemiluminescence reagent kit (cat. no. WP20005; Thermo Fisher Scientific, Inc.) on an imaging device (iBright CL750; Thermo Fisher Scientific, Inc.) and analyzed using ImageJ Software (1.52s version; National Institutes of Health).
All statistical analyses were conducted with GraphPad Prism (version 8.0; GraphPad Software Inc.). Data were obtained from independent experiments performed in triplicate and are presented as mean ± standard deviation. Differences between two groups were analyzed using the unpaired Student's t test, while those between multiple groups were analyzed using one-way analysis of variance followed by Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.
RT-qPCR demonstrated that the MIR503HG expression in AD tissues was much lower than that in tissues collected from patients with cervical lesions or uterine fibroids (P<0.001;
Starbase bioinformatics analysis demonstrated that miR-191 had binding sites with MIR503HG (
miR-191 inhibitor was introduced to determine the role of miR-191 in the MIR503HG-associated effects on ESCs derived from patients with AD. According to RT-qPCR results, expression of miR-191 was significantly decreased after ESCs were transfected with miR-191 inhibitor (P<0.001;
A previous study demonstrated that EMT is a cellular process key for miR-191 upregulation-promoted cancer progression (
Although no direct evidence has indicated that AD triggers infertility, AD interferes with the success of
Aberrantly expressed lncRNAs, which are been proposed to serve as diagnostic and therapeutic markers in assorted diseases, such as cancer, cardiovascular disease and osteoarthritis, have been detected in patients with AD (
ESCs are closely associated with the pathogenesis of AD, and inhibited ESC proliferation contributes to AD progression (
Eutopic endometrium of patients with AD exhibits reciprocally dysregulated miRNAs such as upregulated miR-191, the analysis of which may be a promising low-invasive method for efficient diagnosis of AD (
Additionally, a previous study discovered that the activation of the Wnt/β-catenin signaling pathway contributes to the pathogenesis of AD via EMT (
In conclusion, the present findings demonstrated that MIR503HG was lowly expressed in AD, and MIR503HG exerted a suppressive impact on AD progression by targeting miR-191, which was enriched in ESCs derived from patients with AD, to decrease viability, migration, invasion and EMT while enhancing apoptosis. This suppression may involve inhibition of the Wnt/β-catenin pathway. The present study provided new insights into the therapeutic strategies for AD. However, examinations in a clinical situation or peripheral blood samples were not performed to elucidate the role of MIR503HG or miR-191 in survival or prognosis of patients with AD. Also, the size of samples was small. In addition, the analysis of Wnt/β-catenin signaling pathway in future studies requires MIR503HG overexpression and rescue experiments.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XX and BC provided substantial contributions to conception and design and wrote and revised the manuscript. YL, RL and JL performed data acquisition, analysis and interpretation. All authors have read and approved the final manuscript. XX and BC confirm the authenticity of all the raw data.
The present study was approved by the ethics committee of People's Hospital of Deyang City (approval no. GD202000524) and written informed consent from all participants was obtained for experiments involving tissue.
Not applicable.
The authors declare that they have no competing interests.
MIR503HG is lowly expressed in AD tissue and regulates viability, migration, invasion and apoptosis in ESCs derived from patients with AD. (A) Expression of MIR503HG in the endometrium of patients with AD or cervical lesions/uterine fibroids was analyzed using RT-qPCR. (B) ESCs isolated from AD tissue were observed under an optical microscope (scale bar, 100 µm). (C) Cytokeratin and vimentin expression in ESCs was assessed via immunocytochemistry (scale bar, 100 µm). (D) Expression of MIR503HG in ESCs derived from patients with AD transfected with MIR503HG overexpression plasmids/sh-MIR503HG was analyzed using RT-qPCR. (E) Viability of ESCs derived from patients with AD transfected with MIR503HG overexpression plasmids/sh-MIR503HG was measured via Cell Counting Kit-8 assay. (F) Invasion and (G) migration rate of ESCs derived from patients with AD transfected with MIR503HG overexpression plasmids/sh-MIR503HG were evaluated. (H) Invasion and (I) migration of ESCs transfected with MIR503HG overexpression plasmids/sh-MIR503HG was detected via Transwell assay (scale bar, 50 µm). (J) Apoptosis of ESCs derived from patients with AD transfected with MIR503HG overexpression plasmid/sh-MIR503HG was measured via flow cytometry. (K) Apotosis rate of ESCs was quantified. *P<0.05, **P<0.01 and ***P<0.001 vs. NC. ###P<0.001 vs. control. AD, adenomyosis; ESCs, endometrial stromal cells; RT-q, reverse transcription-quantitative; NC, negative control; sh, short hairpin; lnc, long non-coding.
miR-191 is highly expressed in AD tissue and is directly targeted and negatively regulated by MIR503HG in ESCs derived from patients with AD. (A) Binding sites of miR-191 on MIR503HG WT were predicted by StarBase. (B) miR-191 was confirmed as a target miR of MIR503HG by dual-luciferase reporter assay. (C) RNA immunoprecipitation assay validated the co-expression of miR-191 with MIR503HG. The expression of miR-191 in (D) ESCs derived from patients with AD transfected with sh-MIR503HG or MIR503HG overexpression plasmids and (E) endometrium from patients with AD or cervical lesions or uterine fibroids was analyzed via RT-qPCR. ###P<0.001 vs. MC. ***P<0.001 vs. NC. &&&P<0.001 vs. control. ΔΔΔP<0.001 vs. anti-IgG. AD, adenomyosis; ESCs, endometrial stromal cells; RT-q, reverse transcription-quantitative; M, miR-191 mimic; MC, mimic control; WT, wild-type; MUT, mutant; NC, negative control; miR, microRNA.
miR-191 inhibition partially reversed the effect of MIR503HG knockdown on the viability and migration/invasion and apoptosis in ESCs derived from patients with AD potentially. (A) Expression of miR-191 in ESCs derived from patients with AD that were transfected with I was analyzed via RT-qPCR. (B) Expression of miR-191 in ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination was analyzed via RT-qPCR. (C) Viability of ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination was measured via Cell Counting Kit-8 assay. (D) Invasion rate of ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination was quantified. (E) Invasion of ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination were evaluated via Transwell assay (scale bar, 50 µm). (F) Migration of ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination were evaluated via Transwell assay (scale bar, 50 µm). (G) Migration rate of ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination was quantified. (H) Apoptosis of ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination was measured via flow cytometry. (I) Apotosis rate of ESCs was quantified. (J) Expression of cleaved caspase-3 in ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination was measured by western blotting with GAPDH as reference gene. (K) Protein expression of cleaved caspase-3 in ESCs was quantified. ΔΔΔP<0.001 vs. IC. **P<0.01 and ***P<0.001 vs. NC + IC. ##P<0.01 ###P<0.001 vs. sh-MIR503HG + I. AD, adenomyosis; ESC, endometrial stromal cell; RT-q, reverse transcription-quantitative; I, miR-191 inhibitor; IC, inhibitor control; NC, negative control; miR, microRNA; sh, short hairpin.
MIR503HG knockdown promotes epithelial-mesenchymal transition and activates the Wnt/β-catenin pathway by reversing miR-191 inhibition in ESCs derived from patients with AD. (A) Expression of E-cadherin and N-cadherin in ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination was detected by western blotting. (B) Protein expression of E-cadherin and N-cadherin in ESCs was quantified. (C) Expression of β-catenin in ESCs derived from patients with AD transfected with sh-MIR503HG or I alone or in combination were analyzed by western blotting with GAPDH as the reference gene. (D) Protein expression of β-catenin in ESCs was quantified. *P<0.01, **P<0.05 and ***P<0.001 vs. NC + IC. #P<0.05, ##P<0.01 and ###P<0.001 vs. sh-MIR503HG + I. AD, adenomyosis; ESCs, endometrial stromal cells; RT-q, reverse transcription-quantitative; I, miR-191 inhibitor; IC, inhibitor control; NC, negative control; sh, short hairpin; miR, microRNA.
Human primers used for reverse transcription-quantitative PCR.
Gene | Forward, 5'→3' | Reverse, 5'→3' |
---|---|---|
MIR503HG | CTTGAAGGCATCCAGCATCTC | TTGGGACACTTGGGTGGTTTT |
microRNA-191 | CGGAATCCCAAAAGCAGCTG | TGTCGTGGAGTCGGCAATTG |
GAPDH | GAGAAGGCTGGGGCTCATTT | AGTGATGGCATGGACTGTGG |
U6 | CTCGCTTCGGCAGCACA | AACGCTTCACGAATTTGCGT |