Dementia is defined as memory loss and other cognitive decline and it severely influences daily life. Alzheimer's disease (AD) is the most common cause of dementia. Dedicator of cytokinesis 8 (DOCK8) is reported to be involved in neurological diseases. The present study focused on investigating the role that DOCK8 serves in AD and addressing its hidden regulatory mechanism. Initially, Aβ1-42 (Aβ) was applied for the administration of BV2 cells. Subsequently, the mRNA and protein expression levels of DOCK8 were evaluated utilizing reverse transcription-quantitative PCR (RT-qPCR) and western blotting. After the DOCK8 silencing, immunofluorescence staining (IF), ELISA, wound healing and Transwell assays were applied to assess ionized calcium binding adapter molecule-1 (IBA-1) expression, release of inflammatory factors, migration and invasion in Aβ-induced BV2 cells. IF was used to evaluate cluster of differentiation (CD)11b expression. RT-qPCR and western blotting were to analyze the levels of M1 cell markers inducible nitric oxide synthase (iNOS) and CD86. The expression of STAT3/NLR family pyrin domain containing 3 (NLRP3)/NF-κB signaling-related proteins were determined by western blotting. Finally, the viability and apoptosis in hippocampal HT22 cells with DOCK8 depletion were estimated. Results revealed that Aβ induction greatly stimulated the expression levels of IBA-1 and DOCK8. DOCK8 silencing suppressed Aβ-induced inflammation, migration and invasion of BV2 cells. Additionally, DOCK8 deficiency conspicuously decreased the expression levels of CD11b, iNOS and CD86. The expression of phosphorylated (p-)STAT3, NLRP3, ASC, caspase1 and p-p65 was downregulated in Aβ-induced BV2 cells after DOCK8 depletion. STAT3 activator Colivelin reversed the effects of DOCK8 knockdown on IBA-1 expression, inflammation, migration, invasion and M1 cell polarization. In addition, the viability and apoptosis in hippocampal HT22 cells stimulated by neuroinflammatory release of BV2 cells were repressed following DOCK8 deletion. Collectively, DOCK8 interference alleviated Aβ-induced damage of BV2 cells by inhibiting STAT3/NLRP3/NF-κB signaling.
Dementia, which features memory loss and cognitive decline, severely influences daily life (
The dedicator of cytokinesis (DOCK) proteins, which are the members of the family of atypical guanine exchange factors, can trigger ρGTPases Rac1 and/or Cdc42 and serve as critical players in cellular activities, such as cell migration, neuronal polarization as well as neuroprotection (
In the present study, Aβ1-42 (Aβ) was used for the stimulation of BV2 cells to induce inflammatory damage. The present study was performed to discuss the role of DOCK8 in Aβ-induced BV2 cells and to elucidate its hidden regulatory mechanism in alleviating hippocampal neuronal damage.
BV2 microglia cells and hippocampal HT22 cells provided by Shanghai Hongshun Biotechnology Co., Ltd were cultivated in modified Eagle's medium (MEM; Thermo Fisher Scientific, Inc.) which contained 10% fetal bovine serum (FBS; Guangzhou Perseco Biotechnology Co., Ltd.) and 1% penicillin/streptomycin and were placed in a humid atmosphere at 37˚C in the presence of 5% CO2. To stimulate inflammatory damage, 10 µM Aβ oligomers (GL Biochem) was administered to BV2 cells for 24 h at 37˚C and the culture medium was considered as conditioned medium (CM) (
To deplete DOCK8 expression, 100 nM small interfering RNAs (siRNA) specific to DOCK8 (siRNA-DOCK8-1, CGGAAAAACCAAGGAAGTTCAGA; siRNA-DOCK8-2, CTCTGAAGTTTGAGATTGAAATT) as well as its negative control (siRNA-NC, CCCGATTTCCGAGAATTCTCATTCA) provided by Shanghai GeneChem Co., Ltd. were transfected into BV2 cells or HT22 cells seeded into 6-well plates (2x105 cells/well) using Lipofectamine® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.) for 48 h at 37˚C according to the manufacturer's protocols. At 48 h following transfection, the transfection efficacy was tested with reverse transcription-quantitative polymerase chain reaction (RT-qPCR).
Following Aβ induction, BV2 cells were subjected to 4% paraformaldehyde for 20 min at room temperature and 0.2% Triton X-100 permeation for 20 min at room temperature. Subsequently, the PBS-rinsed cells were blocked with 1% bovine serum albumin at room temperature. The overnight exposure of cells to primary antibodies targeting IBA-1 (ab178846; 1:500; Abcam) and CD11b (ab184308; 1:500; Abcam) was performed at 4˚C, followed by probing with rabbit anti-mouse IgG H&L (ab6728; 1:1,000; Abcam) at 37˚C for 30 min. After nuclear staining with DAPI (Shenzhen Ziker Biotechnology Co., Ltd.) for 10 min at room temperature, a fluorescence microscope (Olympus Corporation) was used to capture images.
Using ELISA kits (Shanghai Xitang Biotechnology, China), the levels of inflammatory cytokines TNF-α (cat. no. F11630), IL-1β (cat. no. F10770) and IL-6 (cat. no. F10830) in cell supernatants were detected according to the manufacturer's protocols. Optical density (OD) value was resolved at λ=450 nm using a microplate reader (Molecular Devices, LLC). The results were calculated according to the standard curve.
The migrative capability of Aβ-induced BV2 cells was assessed using wound healing assay. Initially, BV2 cells were cultured in 6-well plates using serum-free medium until 95% confluence was achieved. Thereafter, a wound in the cell monolayer was created with a 10-µl pipette tip. The BV2 cells were rinsed with PBS and cultured at 37˚C in the presence of 5% CO2. At 0 and 24 h, images of the wound areas were captured by a light microscope (Olympus Corporation). Image J software (Version 1.52r; National Institutes of Health) was used to visualize the of migrative cells.
The invasive capability of Aβ-induced BV2 cells was estimated using Transwell assay. The upper compartment of the Transwell was coated with Matrigel (BD Biosciences) at 37˚C for 30 min and used for BV2 cells. Medium, with 10% FBS, was added to the low chamber. Invaded BV2 cells were fixed with 4% paraformaldehyde for 30 min and stained with 0.1% crystal violet for 20 min at room temperature. The area of invaded cells was tracked using a light microscope (Olympus Corporation).
BV2 cells in 96-well plates were cultured for 24 h at 37˚C. CCK-8 reagent (10 µl; Beyotime Institute of Biotechnology) was added and the cells cultured for another 2 h at 37˚C. A microplate reader (Molecular Devices, LLC) was used to assess absorbance at 450 nm.
The apoptosis level of BV2 cells was assessed using TUNEL staining (Beyotime Institute of Biotechnology). Paraformaldehyde (4%) and Triton X-100 (0.5%) was used to treat BV2 cells for 15 and 20 min respectively at room temperature. Subsequently, the cells were labeled with TUNEL for 1 h at 37 ˚C. The counterstaining of cells with 1 µg/ml DAPI was performed at 37˚C for 30 min in the dark. The observation of positive cells in five randomly selected fields was performed under a florescent microscope (Olympus Corporation).
Total RNA was isolated from sample cells placed in a 6-well plate (6x104 cells/well) with TRIzol® reagent (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocols and reverse transcribed into cDNA using the RevertAid cDNA Synthesis kit (Beijing Zhijie Fangyuan Technology Co., Ltd.) according to the manufacturer's protocols. PCR reactions were performed using iTaq Universal SYBR Green kit (Bio-Rad Laboratories, Inc.) on the MX3000p PCR system (Agilent Technologies, Inc.) according to the manufacturer's protocols. RT-qPCR was performed at 50˚C for 2 min and 95˚C for 2 min, followed by 40 cycles at 95˚C for 15 sec and 60˚C for 1 min. The calculation of relative gene expression was operated with the 2-ΔΔCq (
Total proteins were isolated from samples with RIPA lysis buffer (Beyotime Institute of Biotechnology), after which was the concentration quantification applying a bicinchoninic acid (protein assay kit (Shanghai Yisheng Biotechnology Co., Ltd.). The proteins (30 µg) were separated by 8% SDS-PAGE, transferred to PVDF membranes and blocked by 5% non-fat milk at room temperature for 1 h. Subsequently, the overnight cultivation of membranes with primary antibodies was performed at 4˚C, after which was the probe with HRP-labeled rabbit anti-mouse secondary antibody (cat. no. 7074P2; 1:5,000; Cell Signaling Technology, Inc.) at room temperature for 2 h. Finally, the visualization and analysis of protein blots were performed with ECL (Yeasen Biotech) and ImageJ (Version 1.52r; National Institutes of Health). GAPDH was used as the loading control. The following primary antibodies were used: anti-DOCK8 (cat. no. 39263S; 1:1,000), anti-CD86 (cat. no. 19589S; 1:1,000), anti-iNOS (cat. no. 13120S; 1:1,000), anti-NOD-like receptor family pyrin domain containing 3 (NLRP3; cat. no. 15101S; 1:1,000), anti-apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC; cat. no. 67824T; 1:1,000), anti-caspase1 (cat. no. 24232S; 1:1,000), anti-p-p65 (cat. no. 3033T; 1:1,000), anti-p65 (cat. no. 8242T; 1:1,000), anti-Bcl2 (cat. no. 3498T; 1:1,000), anti-Bax (cat. no. 14796S; 1:1,000), anti-cleaved caspase3 (cat. no. 9664T; 1:1,000), anti-caspase3 (cat. no. 9662S; 1:1,000) and anti-GAPDH (cat. no. 5174T; 1:1,000) antibodies were from by Cell Signaling Technology, Inc. Anti-p-STAT3 (cat. no. ab76315; 1:2,000) and anti-STAT3 (cat. no. ab68153; 1:2,000) antibodies were purchased from Abcam.
Data were given as mean ± standard deviation (SD) and were analyzed using GraphPad Prism 8.0 software (Dotmatics). One-way ANOVA and Tukey's post-hoc test was used for comparisons between multiple groups. P<0.05 was considered to indicate a statistically significant difference.
Initially, Aβ was used for the induction of BV2 cells and IF adopted to analyze IBA-1 expression. Compared with the Control group, Aβ induction elevated IBA-1 expression in BV2 cells in a time-dependent manner (
To decrease DOCK8 expression, siRNAs specific to DOCK8 were transfected into BV2 cells and then RT-qPCR was used to the test transfection efficacy. As shown in
In contrast to the Control group, the migrative ability of BV2 cells was markedly increased by Aβ stimulation. Nevertheless, DOCK8 silencing imparted suppressive effects on the migration of Aβ-induced BV2 cells, as evidenced by reduced migrative ability in the Aβ + siRNA-DOCK8 group compared with the Aβ + siRNA-NC group (
Results from IF staining showed that Aβ stimulation conspicuously increased the level of CD11b compared with that in the Control group while DOCK8 deficiency showed opposite effects on this protein, evidenced by reduced CD11b content in Aβ + siRNA-DOCK8 in comparison with that in Aβ + siRNA-NC group (
Compared with the Control group, Aβ induction remarkably increased the expression of p-STAT3, NLRP3, ASC, caspase1 and p-p65. Nonetheless, DOCK8 depletion decreased the contents of the above proteins in Aβ-induced BV2 cells when compared to the Aβ + siRNA-NC group (
To further investigate the mechanism of DOCK8 in STAT3 signal, Colivelin, which is an activator of STAT3, was administered to BV2 cells. Results obtained from western blotting showed that the decreased contents of p-STAT3, NLRP3, ASC, caspase1 and p-p65 in Aβ-induced BV2 cells caused by DOCK8 interference were partially elevated after administration with Colivelin (
In comparison with the Control group, Aβ induction markedly increased the migrative ability of BV2 cells, which then declined following transfection of cells with siRNA targeting DOCK8 (
Evidently, the reduced CD11b level in Aβ-induced BV2 cells that resulted from DOCK8 interference was elevated by Colivelin compared with that in Aβ + siRNA-DOCK8 group (
As observed from
Extensive studies evidence that neuroinflammation acts as a predominant player in the pathogenesis of AD as well as other neurodegenerative disorders (
DOCK8, which is located on chromosome 9p24.3, is reported to be expressed in microglia (
On the basis of size similarity, antigenic as well as structural relatedness, STAT3 is identified as belonging to the STAT family (
In conclusion, the present study was the first, to the best of the authors' knowledge, to discuss the regulatory role DOCK8 in AD and uncover its detailed mechanism, which lays the foundation for the study of DOCK8 in neurodegenerative diseases. However, there were also some limitations. For example, the role of DOCK8 in animal model and in clinic was not addressed in the present study; more studies need to be performed in the future.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Not applicable.
Not applicable.
XZ and QW designed the study and performed the experiments. JH and DX performed the experiments and analyzed the data. XZ and SZ interpreted the data and drafted the manuscript. QW revised the manuscript for important intellectual content. All authors have read and approved the final manuscript. XZ and QW confirm the authenticity of all the raw data.
The authors declare that they have no competing interests.
DOCK8 expression is increased in Aβ-induced BV2 cells. (A) The expression of IBA-1 was detected using IF staining. Magnification, x200. The mRNA and protein expression levels of DOCK8 were detected using (B) Reverse transcription-quantitative PCR and (C) western blotting. **P<0.01 and ***P<0.001 vs. control. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β.
DOCK8 interference inhibits the activation and inflammatory factors release of Aβ-induced BV2 cells. (A) The transfection efficacy was detected using reverse transcription-quantitative PCR. ***P<0.001 vs. siRNA-NC. (B) The expression of IBA-1 in transfected cells was detected using immunofluorescence staining. Magnification, x200. (C) The levels of inflammatory cytokines were detected using ELISA. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; siRNA, short interfering RNA; NC, negative control; IBA-1, ionized calcium binding adapter molecule-1.
DOCK8 interference inhibits the migration and invasion of Aβ-induced BV2 cells. (A) The migration was detected using wound healing assay. Magnification, x100. (B) The invasion was detected using Transwell assay. Magnification, x100. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; siRNA, short interfering RNA; NC, negative control.
DOCK8 interference inhibits the polarization of Aβ-induced BV2 cells to M1 cells. (A) The expression of CD11b was detected using immunofluorescence staining. Magnification, x200. The expression levels of iNOS and CD86 using (B) reverse transcription-quantitative PCR and (C) western blotting. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; CD, cluster of differentiation; iNOS, inducible nitric oxide synthase; siRNA, short interfering RNA; NC, negative control.
DOCK8 interference inhibits STAT3/NLRP3/NF-κB signaling in Aβ-induced BV2 cells. The expression levels of STAT3, p-STAT3, NLRP3, ASC, caspase1, p-p65 and p65 were detected using western blotting. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-NC. DOCK8, dedicator of cytokinesis 8; NLRP3, NLR family pyrin domain containing 3; Aβ, amyloid β; p-, phosphorylated; siRNA, short interfering RNA; NC, negative control.
DOCK8 interference inhibits the activation and inflammatory factors release of Aβ-induced BV2 cells by suppressing STAT3/NLRP3/NF-κB signaling. (A) The expression levels of STAT3, p-STAT3, NLRP3, ASC, caspase1, p-p65 and p65 were detected using western blotting. (B) The expression of IBA-1 was detected using immunofluorescence staining. Magnification, x200. (C) The levels of inflammatory cytokines were detected using ELISA. ***P<0.001 vs. control; #P<0.05, ##P<0.01, ###P<0.001 vs. Aβ + siRNA-DOCK8. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; NLRP3, NLR family pyrin domain containing 3; p-, phosphorylated; siRNA, short interfering RNA; NC, negative control; IBA-1, ionized calcium binding adapter molecule-1.
DOCK8 interference inhibits the migration and invasion of Aβ-induced BV2 cells by suppressing STAT3/NLRP3/NF-κB signaling. (A) The cell migration was detected using wound healing assay. Magnification, x100. (B) The cell invasion was detected using Transwell assay. Magnification, x100. ***P<0.001 vs. control; ###P<0.001 vs. Aβ + siRNA-DOCK8. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; NLRP3, NLR family pyrin domain containing 3; siRNA, short interfering RNA; NC, negative control.
DOCK8 interference inhibits the polarization of Aβ-induced BV2 cells to M1 cells by suppressing STAT3/NLRP3/NF-κB signaling. (A) The expression of CD11b was detected using immunofluorescence staining. Magnification, x200. The expression levels of iNOS and CD86 using (B) reverse transcription-quantitative PCR and (C) western blotting. ***P<0.001 vs. control; ##P<0.01, ###P<0.001 vs. Aβ + siRNA-DOCK8. DOCK8, dedicator of cytokinesis 8; Aβ, amyloid β; NLRP3, NLR family pyrin domain containing 3; CD, cluster of differentiation; iNOS, inducible nitric oxide synthase; siRNA, short interfering RNA; NC, negative control.
DOCK8 interference inhibits the neuronal activity damage and apoptosis of hippocampal HT22 cells induced by neuroinflammatory release in BV2 cells. (A) The transfection efficacy was detected using reverse transcription-quantitative PCR. ***P<0.001 vs. siRNA-NC. (B) The viability was detected using CCK-8. (C-D) The apoptosis was detected using terminal-deoxynucleotidyl transferase mediated nick end labeling. Magnification, x200. (E) The expression levels of apoptosis-related proteins were detected using western blotting. ***P<0.001 vs. control (CM); ##P<0.01, ###P<0.001 vs. Aβ + siRNA-NC (CM). DOCK8, dedicator of cytokinesis 8; siRNA, short interfering RNA; NC, negative control; CM, conditioned medium.