Contributed equally
Endothelial injury induced by hyperglycemia is the most critical initial step in the development of diabetic vasculopathy. The aim of this present study was to explore the prevention and treatment strategies and elucidate the specific mechanism of diabetes-induced vascular endothelial injury. Melatonin, a hormone secreted by the pineal gland to regulate biological rhythm, serves an important role in maintaining human physiological function. Pyroptosis is a type of newly discovered inflammatory cell death. The current study first found by western blotting that melatonin could activate nuclear factor erythroid 2-related factor 2 (Nrf2) pathway in human umbilical vein endothelial cells (HUVECs) under high glucose (HG) condition. Second, it found that pretreatment with Luzindole, a specific inhibitor of melatonin receptor (MT1/MT2), significantly reduced the activation of Nrf2 pathway by melatonin in HUVECs. It also found that pretreatment with melatonin or a specific NOD-like receptor family, pyrin domain-containing 3 (NLRP3) inhibitor (MCC950) pretreatment reduced HG-induced endothelial cell pyroptosis. Finally, it was found that the protective effect of melatonin against reactive oxygen species/NLRP3 inflammasome pathway activation induced by HG in HUVECs was decreased after Nrf2 knockdown. In conclusion, the present study showed that melatonin may serve a protective role in HG-induced vascular endothelial cell pyroptosis by activating the Nrf2 pathway to inhibit NLRP3 inflammasome activation. In addition, it was further found that melatonin attenuated HG-induced vascular endothelial cell injury by interacting with its receptors (MT1/MT2) to promote activation of Nrf2 pathway.
Vascular disease is the core of diabetes mellitus (DM), which endangers life and health. Severe vascular disease can cause insufficient blood supply and function loss in the heart, brain, kidney, eyes, lower limbs and other important tissues and organs, which seriously threatens human life and health (
Melatonin, a hormone secreted by the pineal gland to regulate biological rhythm, serves an important role in maintaining human physiological function (
Pyroptosis, a type of newly discovered inflammatory cell death, depends on the activation of caspase-1 (
Nuclear factor erythroid 2-related factor 2 (Nrf2) is an activator of antioxidant response elements (ARE) and a key target when reducing oxidative stress. Nrf2 binds to kelch-like ECH-associated protein 1 (Keap1) in the cytoplasm under physiological conditions (
MT1 and MT2 melatonin membrane receptors are G protein-coupled receptors widely expressed in the cardiovascular system. Previous studies have shown that melatonin can bind to the melatonin receptor (MT1/MT2) on the cell membrane surface, activate the phosphorylated kinase pathway in the cytoplasm, and then participate in the regulation of normal physiological functions (
Primary human umbilical vein endothelial cells (HUVECs; cat. no. 8000) were purchased from ScienCell Research Laboratories (Carlsbad, CA, USA) and cultured in endothelial cell medium (ScienCell Research Laboratories, Inc.) supplemented with 5% fetal bovine serum under 5% CO2 at 37°C. All experiments were performed between cell passages three and five. Melatonin (100 µM; MilliporeSigma), a specific NLRP3 inhibitor MCC950 (50 µM; Selleck Chemicals), and a melatonin receptor antagonist luzindole (5 µM; MilliporeSigma) were added to the cell cultures 3 h in advance before being co-incubated with HG (30 mM) for 72 h. All experiments were performed at least three times and representative results are presented in the present study.
The predesigned siRNA duplexes for Nrf2 and the negative control (NC) were purchased from HippoBio Co., Ltd.
The HUVEC culture supernatants were collected following an intervention for 72 h. The concentrations of IL-1β (cat. no. SEA563Hu) and IL-18 (cat. no. SEA064Hu) in the cell culture supernatants were determined using ELISA kits (both from Cloud-Clone Corp.) according to the manufacturer's instructions.
ROS levels in the HUVECs were measured using an ROS assay kit (Beijing Solarbio Science & Technology Co., Ltd.) in accordance with the manufacturer's instructions.
A Cell Counting Kit (CCK-8) assay (Nanjing Jiancheng Bioengineering Institute) was used to measure the level of cell viability.
Pyroptotic cell death was assessed using a lactate dehydrogenase (LDH) release assay and Hoechst 33342/propidium iodide (PI) staining. For LDH release, the LDH activity of the cell culture supernatants was measured using an LDH assay kit (Nanjing Jiancheng Bioengineering Institute). For Hoechst 33342/PI double staining, the collected cells were washed with PBS and subsequently incubated with PI (5 µl) for 10 min at 37°C in the dark. After three washes with PBS, the nuclei were stained with Hoechst 33342 (10 µl) for 30 min at 37°C in the dark. Images were captured under a fluorescence microscope. The proportion of PI-positive cells was calculated using Image J software (version 1.46; National Institutes of Health).
The experimental method, which had been described in our previous study (
Total protein or nuclear protein (nucleoprotein extraction kit, Beijing Solarbio Science & Technology Co., Ltd.) was extracted from the collected HUVECs, and protein concentration was determined using a BCA Protein Assay Kit (cat. no. P0012A; Beyotime Institute of Biotechnology). Subsequently, equal amounts of protein lysates (30 µg/lane) were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride (PVDF) membranes (MilliporeSigma). After transfer, the PVDF membranes was incubated in 25 ml blocking buffer (1X Tris-buffered saline and 0.1% Tween-20 with 5% non-fat dry milk) for 1 h at room temperature and incubated overnight at 4°C with the following primary antibodies: β-actin (1:1,000; MDL; cat. no. MD6553), Histone H3 (1:1,000; Abcam; cat. no. ab1791), Nrf2 (1:1,000; CST; cat. no. 12721T), heme oxygenase-1 (HO-1; 1:1,000; Affinity; cat. no. AF5393), NQO1 (1:1,000; Novus; cat. no. NB200-209SS), superoxide dismutase 2 (SOD2; 1:1,000; Novus; cat. no. NB100-1992SS), NLRP3 (1:1,000; Abcam; cat. no. ab214185), ASC (1:1,000; ABclonal Biotech Co., Ltd.; cat. no. A1170), cleaved-caspase-1 (1:1,000; CST; cat. no. 4199T), GSDMD (1:1,000; Abcam; cat. no. ab210070), and cleaved N-terminal GSDMD (1:1,000; Abcam; cat. no. ab215203). The membranes were then incubated with HRP-linked anti-mouse IgG (cat. no. 7076; 1:3,000; Cell Signaling Technology, Inc.) or HRP-linked anti-rabbit IgG (cat. no. 7074; 1:3,000; Cell Signaling Technology, Inc.) for 1 h at room temperature. The antibody-antigen complexes were detected using enhanced electrochemiluminescence reagents (Santa Cruz Biotechnology, Inc.) and densitometric analysis was conducted using Image J software (version 1.46; National Institutes of Health).
All data were analyzed using GraphPad Prism version 9.0 (Dotmatics). All experimental data are represented as the means ± standard deviation. The Shapiro-Wilk test was used to evaluate Gaussian distributions, while the Brown-Forsythe test was used to evaluate homogeneity of variance. All data fitted the Gaussian distribution and the variances were equal. One-way ANOVA followed by Šídák's multiple comparisons test was used to compare differences between three or more groups. P<0.05 was considered to indicate a statistically significant difference.
The present study found that melatonin inhibited HG-induced pyroptosis of vascular endothelial cells by activating the Nrf2 pathway to inhibit NLRP3 inflammasome activation. It was further found that melatonin protects vascular endothelial cells from HG-induced injury through the activation of Nrf2 pathway, which is mediated by MT1/MT2.
Previous studies have found that melatonin is beneficial for a variety of cardiovascular diseases, such as ischemia-reperfusion injury (
The current study, found through CCK-8 experiment under the condition of high glucose of 30 mM that the therapeutic concentration of melatonin of 100 µM could minimize the adverse effects of high glucose on the vitality of HUVECs. However, higher concentrations of melatonin showed similar or even reduced protective effects. In fact, one of our previous studies found that a therapeutic concentration of 100 µM of melatonin was optimal for alleviating the adverse effects of cigarette smoke extractants on the vitality of HUVECs (
Endothelial cell pyroptosis is involved in the pathogenesis of atherosclerosis (
Nrf2 is a key nuclear transcription factor that regulates antioxidant gene expression. Studies (
ROS is a key regulator of inflammasome activation (
MT1/MT2 is a G-protein-coupled receptor existing in cell membrane and widely exists in the nervous and cardiovascular systems (
In conclusion, the current study showed that melatonin may serve a protective role in HG-induced vascular endothelial cell pyroptosis by activating the Nrf2 pathway to inhibit NLRP3 inflammasome activation. In addition, it was further found that melatonin attenuates HG-induced vascular endothelial cell injury by interacting with its receptors (MT1/MT2) to promote activation of Nrf2 pathway (
In this part of the experiment, an optimal melatonin protective concentration was first determined through CCK-8 by setting control group, HG (30 mM) + different melatonin concentrations (0 µM-1 M) treatment group. It was found that a melatonin concentration of 100 µM was the most effective in alleviating the loss of cell viability caused by HG and 100 µM was selected as the treatment concentration for subsequent experiments (
Luzindole is an effective competitive MT1/MT2 membrane receptor antagonist and is widely used in melatonin research. In this part of the experiment, it was found that the protective effect of melatonin in promoting n-Nrf2 expression was significantly reduced when MT1/MT2 was blocked by Luzindole under HG conditions (
Hoechst 33342/PI staining and LDH release assay are often used to observe pyroptotic cell death (
In this part of the experiment, in order to confirm that melatonin inhibits the activation of ROS/NLRP3 inflammasome pathway in vascular endothelial cells induced by HG mainly through or at least partly through Nrf2 signaling pathway, Nrf2 expression was knocked down by siRNA interference, which was verified by RT-qPCR. hNrf2 siRNA-2 was selected as the interference sequence (
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
XW, HF and CL conceived and designed the present study. XW, RZ and BM performed the experiments. XW, WW and RZ interpreted the results, analyzed the data and wrote the paper. XW, WW and LN analyzed the data and designed the figures and table. HF and CL reviewed and edited the manuscript. XW, HF and CL confirmed the authenticity of all the raw data. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Mel activates the Nrf2 pathway in HUVECs under HG conditions. (A) CCK-8 cell viability test confirmed that the optimal protective concentration of melatonin was 100 µM. (B) Western blot analysis of n-Nrf2 expression in HUVECs at different HG incubation time. (C) Semi-quantitative analysis of n-Nrf2 relative expression. (D) Western blot analysis of n-Nrf2 expression in HUVECs of each group. (E) Semi-quantitative analysis of n-Nrf2 relative expression. (F) Western blot analysis of HO-1 and SOD2 expression in the HUVECs of each group. Semi-quantitative analysis of (G) HO-1 and (H) SOD2 relative expression. Results are presented as the mean ± standard deviation. *P<0.05, **P<0.01 and ***P<0.001. Mel, melatonin; Nrf2, nuclear factor erythroid 2-related factor 2; HUVECs, human umbilical vein endothelial cells; HG, high glucose; NC, negative control; HO-1, heme oxygenase-1; and SOD2, superoxide dismutase 2.
Mel activates the Nrf2 pathway in HUVECs mainly through the MT1/MT2 pathway under HG conditions. (A) Western blot analysis of n-Nrf2 expression in HUVECs of each group. (B) Semi-quantitative analysis of n-Nrf2 relative expression. (C) Western blot analysis of HO-1, NQO1 and SOD2 expression in HUVECs of each group. (D-F). Semi-quantitative analysis of HO-1, NQO1 and SOD2 relative expression. Results are presented as the mean ± standard deviation. *P<0.05, **P<0.01 and ***P<0.001. Mel, melatonin; Nrf2, nuclear factor erythroid 2-related factor 2; HUVECs, human umbilical vein endothelial cells; HG, high glucose; HO-1, heme oxygenase-1; NQO1, oxygenase-1 (HO-1), NADPH: Quinone Oxidoreductase 1; SOD2, superoxide dismutase 2; Luz, Luzindole.
Mel or MCC950 inhibits HG-induced endothelial cell pyroptosis. (A) Representative pyroptotic cell death images of each group obtained using Hoechst33342/PI staining (original magnification, ×100; scale bar, 100 µm. (B) The proportion of PI-positive cells in each group. (C) LDH release activity in each group. (D) Western blot analysis of GSDMD and GSDMD-N expression in HUVECs of each group. Semi-quantitative analysis of (E) GSDMD and (F) GSDMD-N relative expression. Results are presented as the mean ± standard deviation. *P<0.05, **P<0.01 and ***P<0.001. Mel, melatonin; HG, high glucose; PI, propidium iodide; LDH, lactate dehydrogenase; GSDMD, gasdermin D; GSDMD-N, gasdermin D-N; HUVECs, human umbilical vein endothelial cells; NC, negative control.
Mel inhibits ROS/NLRP3 inflammasome pathway in HUVECs under HG conditions by activating the Nrf2 pathway. (A) Nrf2 knockdown was verified by reverse transcription-quantitative PCR. (B) Western blot analysis of NLRP3, ASC and cleaved-caspase-1 expression in HUVECs of each group. Semi-quantitative analysis of (C) NLRP3, (D) ASC and (E) cleaved-caspase-1 relative expression. Expression levels of (F) NLRP3 and (G). caspase-1 mRNA in HUVECs of each group; H-I. The levels of (H) IL-1β and (I) IL-18 in the supernatant of HUVEC cultures in each group. (J) The levels of ROS in HUVECs of each group. Results are presented as the mean ± standard deviation. **P<0.01 and ***P<0.001. Mel, melatonin; ROS, reactive oxygen species; NLRP3, pyrin domain-containing 3; HUVECs, human umbilical vein endothelial cells; HG, high glucose; Nrf2, nuclear factor erythroid 2-related factor 2; NC, negative control.
A schematic hypothetical model showing the specific signaling mechanisms by which melatonin attenuates HG-induced endothelial cell pyroptosis through MT1/MT2-Nrf2-ROS-NLRP3 signaling pathway. HG, high glucose; Nrf2, nuclear factor erythroid 2-related factor 2; ROS, reactive oxygen species; NLRP3, NOD-like receptor family, pyrin domain-containing 3; HO-1, heme oxygenase-1; NQO1, oxygenase-1 (HO-1), NADPH: Quinone Oxidoreductase 1; SOD2, superoxide dismutase 2; Keap1, kelch-like ECH-associated protein 1.
The sequences of all Nrf2 siRNAs and the siRNA-NC used.
Name | Sequence |
---|---|
hNRF2 siRNA-1 sense | GGUUGAGACUACCAUGGUUTT |
hNRF2 siRNA-1 antisense | AACCAUGGUAGUCUCAACCAG |
hNRF2 siRNA-2 sense | GCCCAUUGAUGUUUCUGAUTT |
hNRF2 siRNA-2 antisense | AUCAGAAACAUCAAUGGGCCC |
hNRF2 siRNA-3 sense | GCAGUUCAAUGAAGCUCAATT |
hNRF2 siRNA-3 antisense | UUGAGCUUCAUUGAACUGCTC |
si-NC sense | GUCUACUGCUAUGUCUGUATT |
si-NC antisense | AAUACAGACAUAGCAGUAGAC |
Nrf2, nuclear factor erythroid 2-related factor 2; siRNA, small interfering RNA; NC, negative control.
Primer sequences.
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
β-actin | TCCTCCTGAGCGCAAGTACTCC | CATACTCCTGCTTGCTGATCCAC |
Nrf2 | TCAGCGACGGAAAGAGTATGA | CCACTGGTTTCTGACTGGATGT |
NLRP3 | AAGGAAGTGGACTGCGAGAA | AACGTTCGTCCTTCCTTCCT |
Caspase-1 | GGCATGACAATGCTGCTACA | TCTGGGACTTGCTCAGAGTG |