Osteosarcoma (OS) is the commonest primary malignant bone tumor in children and adolescents. However, chemotherapy resistance is a major challenge for the treatment of OS. Exosomes have been reported to serve an increasingly important role in different stages of tumor progression and chemotherapy resistance. The present study investigated whether exosomes derived from doxorubicin-resistant OS cells (MG63/DXR) could be taken up in doxorubicin-sensitive OS cells (MG63) and induce a doxorubicin-resistant phenotype. MDR-1, as the specific mRNA of chemoresistance, can be transferred by exosomes from MG63/DXR cells to MG63 cells. In addition, the present study identified 2,864 differentially expressed miRNAs (456 upregulated and 98 downregulated with fold-change >2.0, P<5×10−2, and FDR<0.05) in all three sets of exosomes from MG63/DXR cells and MG63 cells. The related miRNAs and pathways of exosomes involved in the doxorubicin resistance were identified by bioinformatic analysis. A total of 10 randomly selected exosomal miRNAs were dysregulated in exosomes from MG63/DXR cells relative to MG63 cells by reverse transcription-quantitative PCR detection. As a result, miR-143-3p was found high expressed in exosomes from doxorubicin-resistant OS cells compared with doxorubicin-sensitive OS cells and upregulation of exosomal miR-143-3p abundance associated with the poor chemotherapeutic response to OS cells. Briefly, transfer of exosomal miR-143-3p confers doxorubicin resistance in osteosarcoma cells.
Osteosarcoma (OS) is the commonest primary malignant bone tumor in young patients. Although, with the development of surgical skills and the application of neoadjuvant chemotherapy, the 5-year survival rate of patients has increased to 70%, there are still a number of challenges that physicians face in OS, including the chemoresistance, local recurrence and pulmonary metastasis (
Exosomes are a class of 30- to 150-nm extracellular vesicles (EVs) generated by almost all cell types, including cancer cells (
A total of four OS cell lines, MG63 cells (doxorubicin-sensitive OS cells), doxorubicin-resistant MG63 cells (MG63/DXR), KHOS cells (doxorubicin-sensitive OS cells) and doxorubicin-resistant KHOS cells (KHOS/DXR), were chosen in the present study and purchased from the American Type Culture Collection. All four cell lines were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS depleted of exosomes (FDE; ScienCell Research Laboratories, Inc.) and 1% penicillin/streptomycin (Gibco; Thermo Fisher Scientific, Inc.). All of the cells were cultured in a humidified incubator with 5% CO2 at 37°C. When the cell density reached 70–80%, the conditioned medium was collected.
After the collection of the conditioned medium from OS cells, the supernatant was collected and centrifuged as follows: 300 × g for 10 min to remove cells, 2,000 × g for 10 min to remove dead cells, 10,000 × g for 30 min to remove cell debris, 100,000 × g for 70 min to collect pellets, washed with PBS and 100,000 × g for 70 min to collect exosomes all at 4°C. NanoSight particle tracking analysis (NTA) was conducted to identify the concentration and number of exosomes and the bicinchoninic acid (BCA) method (Thermo Fisher Scientific, Inc.) was applied to examine the exosomal protein concentration.
For TEM observation, 10 µl of exosome solution was placed onto copper mesh and incubated at room temperature for 10 min. After that, the copper mesh was washed with sterile distilled water and 10 µl of 2% uranyl acetate was pipetted on the copper mesh for negative staining for 1 min, the excess fluid was removed and the mesh was dried under an incandescent lamp for 2 min. Finally, the copper mesh was observed under a transmission electron microscope at 80 KV (JEOL, Ltd.).
After the isolation of the exosomes from OS cells, PBS was used to dilute at a factor of 100 or 1,000 for exosomes to obtain an approximate number of vesicles prior to NTA. ZetaView PMX 110 (Particle Metrix GmbH) and its corresponding software (ZetaView 8.02.28) were applied to analyze the size and concentration of the exosomes from OS cells.
Total protein was isolated using cell lysis buffer and the bicinchoninic acid (BCA) method (Thermo Scientific, Inc.) was applied to examine the exosomal protein concentration as described before. The densitometry of the protein was detected by NanoDrop-1000 (Thermo Scientific, Inc. USA) with the software Nanodrop 3.3.0 by the BCA method. The equal amounts of protein (50 µg per lane) were loaded for western blot analysis. To identify the three specific proteins, CD9 (23 kDa), CD63 (26 kDa), and TSG-101 (72 kDa) were positive experssed, exosomes were collected and lysed using RIPA protein extraction reagent (Beyotime Institute of Biotechnology) supplemented with a protease inhibitor cocktail (Roche Applied Science). Proteins were loaded onto 10% SDS-PAGE gels for electrophoresis, transferred to PVDF membranes and blocked in 5% milk for 1 h at 4°C overnight prior to incubation with the indicated primary antibodies for 3 h at room temperature. After washing with trisbuffered saline with 0.1% Tween 20 (TBST) four times, the secondary antibodies were incubated with the membrane at room temperature for 1.5 h. The antibodies used in the experiments included anti-CD63 (1:1,000; Santa Cruz Biotechnology, Inc.), anti-CD9 (1:1,000; Santa Cruz Biotechnology, Inc.), anti-TSG101 (1:1,000; Santa Cruz Biotechnology, Inc.) and anti-β-actin (1:1,000; Santa Cruz Biotechnology, Inc.). All experiments were repeated three times. The bound antibodies were visualized with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific). Image pro-Plus 6.0 (Media Cybernetics, Inc.) was used for the densitometry of the brands.
MG63 cells were stained with the CellTrace CFSE Cell Proliferation kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and exosomes were labeled using the PKH67 Blue Fluorescent Cell Linker kit (MINI67-1KT; MilliporeSigma). PKH67 dye solution (1 ml; 1:1,000) was mixed with 20 µg of exosomes for 20 min at 36.5°C, washed with PBS and centrifuged at 100,000 × g for 70 min at 4°C. PKH67-labeled exosomes (4 µg) were resuspended in IMDM supplemented with 10% FDE and added to MG63 cells at 36.5°C. The cells were washed and fixed in 3.7% PFA for 10 min to stop the process of uptake with different time of incubation. Then, the cells were stained with fluorescein isothiocyanate (FITC)-conjugated phalloidin (MilliporeSigma) and the uptake of exosomes at different time points was observed under a confocal fluorescence microscope (Nikon Eclipse E800M; Nikon Corporation).
Cell viability was evaluated by the CellTiter-Glo 2.0 Reagent (cat. no. G7572; Promega Corporation). MG63 cells were seeded at a density of 2×103 cells/well in 96-well flat-bottomed tissue culture plates in the presence of DMEM +10% FDE and test compound at room temperature for approximately 30 min. Then, 100 µl of CellTiter-Glo 2.0 Reagent was added and the content was mixed for 2 min on an orbital shaker. After incubating the plate at room temperature for 10 min, the luminescence was recorded.
Transwell experiment was conducted for the migration assay. OS cells were seeded at a density of 1.2×105 cells/well in 24-well plates with 500 µl of cell culture medium for 48 h. Then the MG63 cells were fixed with 500 µl of 4% paraformaldehyde at room temperature for 15 min. After washing with deionization water for 3 to 5 times, the OS cells were observed under a microscope. Experiments were performed at least three times and the results were recorded as the mean of these experiments.
MG63 cells were seeded at the destiny of 2.0×105 cells/ml in 24-well plates and incubated with exosomes from MG63/DXR (Exo-MG63-DXR; 100 µl/ml) for 48 h at 36.5°C. Matrigel (cat. no. 356235; Corning, Inc.) was thawed on a shaker at 4°C for 2 h. Matrigel (10 µl) was added the cell pellet in an Eppendorf tube and mixed gently. Cells that were mixed with cold Matrigel were gently pipetted into the middle of a well in a 24-well plate into a drop-like shape. The Matrigel drops are solidified in a 37°C incubator with 5% CO2 injection for 20 min. The cells were digested and centrifuged with the speed of 200 × g for 5 min at room temperature. After termination of digestion, the cells washed twice with PBS, and resuspended in 10 g/l BSA. The cells were seeded at a density of 1.2×105 cells/well in 24-well plates. Doxorubicin (100 ng/ml) was added into the treated MG63 cells for 24 h and the cells were fixed with 500 µl of 4% paraformaldehyde at room temperature for 15 min. The chamber in the control group was treated with 500 µl crystal violet staining solution for 20 min at room temperature (control group). After washing with deionized water 3–5 times, the tumor cells were observed under a confocal microscope (LSM 900; Carl Zeiss AG) with magnification ×400. Experiments were performed at least three times and the results were recorded as the mean of these experiments.
Exosomal RNAs were extracted using TRIzol® (Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions and miRNAs were extracted by the RNeasy/miRNeasy Mini kit (Qiagen, Inc.). The amount and quality of small RNAs in the total RNAs were tested by Heyuan Biotechnology (Shanghai) Co., Ltd. Small RNA library construction and sequencing were performed by Heyuan Biotechnology (Shanghai) Co., Ltd. Then, the cDNA library was sequenced on an Illumina Hiseq 2500 (Illumina, Inc.). Raw reads were collected using related Illumina analysis software and RT-qPCR was performed on a CFX96 Real-Time System (Bio-Rad Laboratories, Inc.) using iTaq Universal One-Step RT-qPCR kits (Bio-Rad Laboratories, Inc.). The PCR cycling conditions were: 94°C for 5 min, 94°C for 1 min, 55°C for 40 sec, 72°C for 50 sec, 72°C for 7 min and the temperature lowered to 4°C at the end of each cycles. The cycles were repeated 29 times. The probes and primers by a web based assay design software (Probe Finder
MG63 cells and KHOS cells (4×104 cell/ml) were transfected with 100 nM of the exosomal miRNA mimic (0.16 µM/µl) [Heyuan Biotechnology (Shanghai) Co., Ltd.] and MG63/DXR and KHOS/DXR were transfected with 100 nM of the exosomal miRNA inhibitor (0.16 µM/µl) [Heyuan Biotechnology (Shanghai) Co., Ltd.] using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). PBS was used as the negative control (NC). The negative control inhibitor and mimic of the exosomal miRNAs were used for corresponding negative controls (NC;
According to the exosomal miRNA sequences of MG63 and MG63/DXR, Gene Ontology (GO) analysis of target genes were conducted using the DAVID database (
The expression levels of exosomal miRNA from RNA sequence were analyzed by SDS software version 2.2.2 (Applied Biosystems; Thermo Fisher Scientific, Inc.). R software for Windows 4.1.2 (
First, the exosomes of the MG63 cells and MG63/DXR cells were isolated and under the TEM, the vesicles from the OS cells exhibited a cup shape with bilayered membranes and a diameter ranging from 30–150 nm (
To examine whether exosomes from MG63/DXR (Exo-MG63/DXR) could be taken up in MG63 cells, PKH67-labeled Exo-MG63/DXR were incubated with MG63 cells and examined using fluorescence microscopy. After 3 h of incubation, the PKH67 signal was detected in the perinuclear region and an increasing PKH67 signal was observed in the perinuclear region of MG63 cells 6 and 12 h later (
To investigate the influence of Exo-MG63/DXR on the proliferation of MG63 cells to doxorubicin, cell viability was examined in MG63 cells in the presence of increasing concentrations of doxorubicin (1–1,000 ng/ml) for 24 h after incubation with Exo-MG63/DXR (100 µg/ml) for 48 h. MG63 viability was affected by doxorubicin in a dose-dependent way and the resistance of doxorubicin for MG63 cells was increased following incubation with Exo-MG63/DXR (
The expression of MDR-1 was evaluated by RT-qPCR after extracting total RNA from Exo-MG63/DXR, exosomes of MG63 (Exo-MG63) and their cells of origin. Exo-MG63/DXR expressed higher levels of MDR-1 mRNA compared with Exo-MG63. In addition, the expression of MDR-1 mRNA in Exo-MG63/DXR was significantly higher compared with that in MG63 cells (
According to the analysis of the miRNA sequence of exosomes from MG63 cells and MG63/DXR cells, 2864 differentially expressed exo-miRNAs were detected and 456 miRNAs were upregulated and 98 miRNAs were downregulated significantly (fold-change>2.0, P<5×10−2 and FDR<0.05;
Based on the statistical significance and biological plausibility, 10 miRNAs, including miR-30a-5p, miR-16-5p, miR-96-5p, let-7c-5p, miR-182-5p, miR-210-3P, miR-378a-3P, miR-493-5p, miR-494-3p and miR-143-3p, were selected for validation from the exo-miRNA sequence by RT-qPCR in four OS cells including MG63 cells, MG63/DXR cells, KHOS cells and KHOS/DXR cells (
Multidrug resistance (MDR) is a major concern regarding the clinical management of osteosarcoma patients and a key issue in the failure of current treatment (
Exosomes facilitate cell-cell crosstalk within the tumor environment, which serves a crucial role in augmenting MDR pathways (
A number of studies have identified that exosomes have the ability to transport molecular information such as proteins, mRNAs and miRNAs from one cell to another to induce chemoresistance and malignant phenotypic traits (
miR-143 is located on human chromosome 5. Depending on the different site of cleavage, the stem-loop structure of miR-143 precursor can form miR-143-3p and miR-143-5p (
There are some limitations to the present study. First, multivariate analysis, such as Fisher discriminant analysis, could be further applied to explore the differential role of miRNAs in the chemotherapeutic response. Second, animal experiments need to be conducted to support the conclusion of the present study. Last but not least, the investigation of the different samples from different OS patients, such as serum of the patients and the specimen of the osteosarcoma, need to be performed to prove the results of the present study.
To conclude, the present study corroborated the evidence that exosomes from doxorubicin-resistant osteosarcoma cells are capable of transferring chemoresistant phenotypic traits and MDR-1, a specific mRNA of chemoresistance. In addition, it revealed a substantial abundance of differentially expressed miRNAs present in the exosomes from OS cells with the different chemotherapeutic response. Importantly, the present study found that the upregulation of exosomal miR-143-3p abundance was associated with poor chemotherapeutic response to osteosarcoma cells, which was highly expressed in doxorubicin-resistant OS cells, highlighting the importance of miR-143-3p as an oncogene in osteosarcoma; this may provide new insights into chemotherapy of osteosarcoma.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
TC contributed to the conception and design of the study, analysis and interpretetion of the data. TZ contributed to the drafting of the manuscript and acquisition of data. CZ contributed to the design of the study, gave final approval of the version to be published and agreed to be accountable for all aspect of work. TC and CZ confirm the authenticity of all the raw data. All authors read and approved the final manuscript.
The the study was approved by the Institutional Review Board of Tongji University (Shanghai, China) and was performed in accordance with the ethical standards prescribed by the Helsinki Declaration.
Not applicable.
The authors declare that they have no competing interests.
Tao Cai was an undergraduate medical student in the Department of Orthopedic Surgery, Shanghai Tenth People's Hospital Affiliated To Tongji University when the article was submitted. Now, Dr Tao Cai is a surgeon of the Department of Orthopedic Surgery, Tongji Hospital Affiliated to Tongji University.
Isolation and identification of exosomes for MG63/DXR cells and MG63 cells. (A and B, E and F)
The influence of Exo-MG63/DXR for MG63 cells in the proliferation, migration and expression of MDR-1 after treated by doxorubicin. (A) PKH67 (Green) labelled Dox-MG63-Exo was taken up by MG63 cells after incubation for 3, 6 and 12 h. (B and C) Doxorubicin affected the MG63 viability in a dose-dependent way and Dox-MG63-Exo decreased the sensitivity of MG63 cells to doxorubicin. In particular, the sensitivity of MG63 cells was decreased most significantly with the concentration of doxorubicin at 100 ng/ml after incubation of Dox-MG63-Exo. (D-F) The invasion of MG63 cells was significantly inhibited after incubation with Dox-MG63-Exo, but the migration of MG63 cells was not affected by the Dox-MG63-Exo although the invasion and migration of MG63 cells was significantly inhibited at the same time after treated by doxorubicin. (G) Exo-MG63/DXR expressed higher levels of MDR-1 mRNA compared with Exo-MG63 and the expression of MDR-1 mRNA in Exo-MG63/DXR has significantly higher levels compared with MG63 cells. (H) MG63 cells expressed higher levels of MDR-1 mRNA following incubation with Exo-MG63/DXR and there was no difference of the expression of MDR-1 mRNA for the MG63 cells incubated with Exo-MG63. *P<0.05, **P<0.01 and ***P<0.001. Exo, exosomal; NS, not significant.
Exosomal miRNA sequence and bioinformatic analysis of exosomal miRNAs. (A) Heatmap of different exosomal miRNA profiles in MG63/DXR and MG63 cell lines. (B) Volcano map for exosomal miRNAs of the two cell lines according to the results of exo-miRNA sequence. (C) Among the exosomal miRNAs, 456 were upregulated and 98 were downregulated significantly (fold-change>2.0, P<0.05 and FDR<0.05) in exosomes. (D and E) Bioinformatic analysis of the exo-miRNAs by KEGG and GO enrichment. Pathways in cancer, PI3K-Akt signaling pathway, Proteoglycans in cancer, Rap1 signaling pathway, Ras signaling pathway and Regulation of actin cytoskeleton were the most prominent pathways enriched in quantiles with different exo-miRNAs in MG63/DXR cells. The protein binding, membrane, cytosol and cytoplasm were the prominent GO terms for the different expressed exo-miRNAs in MG63/DXR and MG63 cells. (F) Number of the target genes and (G) heatmap for the 10 randomly selected exosomal miRNAs. miRNA, microRNA; KEGG, Kyoto Encyclopedia of Genes and Genomes; GO, Gene Ontology; Exo, exosomal.
Validation of different exo-miRNAs confer doxorubicin resistance to OS cells by RT-qPCR. A total of 10 randomly exosomal miRNAs, including (A) miR-30a-5p, (B) let-7c-5p, (C) miR-210-3P, (D) miR-96-5p, (E) miR-143-3p, (F) miR-182-5p, (G) miR-16-5p, (H) miR-378a-3P, (I) miR-493-5p and (J) miR-494-3p were selected for validation by TaqMan RT-qPCR in four OS cells. *P<0.05, **P<0.01 and ***P<0.001. miRNA, microRNA; OS, osteosarcoma; RT-qPCR, reverse transcription-quantitative PCR; NS, not significant.
The transfection for each of the three miRNA mimics in MG63 cells and KHOS cells and inhibitors in MG63/DXR cells and KHOS/DXR cells (A-L) and the results of cell viability evaluated by CTG following infection of MG63 cells and KHOS cells with lentiviral vectors expressing mimic of exosomal miR-143-3p, miR-493-5p and miR-494-3p. (M and N) MG63/DXR cells and (O and P) KHOS/DXR cells were infected with lentiviral vectors expressing inhibitor of the three miRNAs. miRNA, microRNA; CTG, CellTiter-Glo; Exo, exosomal; *P<0.05 and **P<0.01.
Sequences of all miRNA mimics, mimic NC, miRNA inhibitors and inhibitor NC.
miRNA | Sequence |
---|---|
miRNA inhibitor NC | CAG UAC UUU UGU GUA GUA CAA |
miRNA mimic NC | UUC UUC GAA CGU GUC ACG UTT |
ACG UGA CAC GUU CGG AGA ATT | |
miRNA-143-3p inhibitor | GAG CUA CAG UGC UUC AUC UCA |
miRNA-143-3p mimic | UGA GAU GAA GCA CUG UAG CUC |
GCU ACA GUG CUU CAU CUC AUU | |
miRNA-493-5p inhibitor | AAU GAA AGC CUA CCA UGU ACAA |
miRNA-493-5p mimic | UUG UAC AUG GUA GGC UUU CAUU |
UGA AAG CCU ACC AUG UAC AAUU | |
miRNA-494-3p inhibitor | UGA AAC AUA CAC GGG AAA CCU UCU |
miRNA-494-3p mimics | UGA AAC AUA CAC GGG AAA CCU CU |
AGG UUU CCC GUG UAU GUU UCA UU |
miRNA, microRNA; NC, negative control.
Ten most up- and downregulated exo-miRNAs.
miR name | miR sequence | Regulation | Fold change | P-values |
---|---|---|---|---|
hsa-miR-494-3p | TGAAACATACACGGGAAACCTCT | Up | inf | 8.53×10−4 |
hsa-miR-493-5p | TTGTACATGGTAGGCTTTCATT | Up | inf | 1.06×10−3 |
hsa-let-7c-5p | TGAGGTAGTAGGTTGTATGGTT | Up | 4.05 | 4.86×10−6 |
hsa-miR-210-3p | CTGTGCGTGTGACAGCGGCTGA | Up | 8.57 | 3.84×10−5 |
hsa-miR-182-5p | TTTGGCAATGGTAGAACTCACACCG | Up | 8.04 | 1.76×10−4 |
hsa-miR-30a-5p | TGTAAACATCCTCGACTGGAAGCT | Up | 5.30 | 1.79×10−4 |
hsa-miR-25-3p | CATTGCACTTGTCTCGGTCTGA | Up | 5.58 | 3.27×10−4 |
hsa-miR-143-3p | TGAGATGAAGCACTGTAGCTC | Up | 24.20 | 5.21×10−4 |
hsa-miR-183-5p | TATGGCACTGGTAGAATTCACT | Up | 7.53 | 6.43×10−4 |
hsa-miR-34c-5p | AGGCAGTGTAGTTAGCTGATTGC | Up | 190.42 | 9.40×10−4 |
hsa-miR-199a-5p_R-1 | CCCAGTGTTCAGACTACCTGTT | Down | 0.44 | 2.19×10−3 |
hsa-miR-152-3p | TCAGTGCATGACAGAACTTGG | Down | 0.42 | 2.59×10−3 |
hsa-miR-185-5p | TGGAGAGAAAGGCAGTTCCTGA | Down | 0.39 | 4.00×10−3 |
hsa-miR-23a-3p_R-1 | ATCACATTGCCAGGGATTTC | Down | 0.33 | 6.58×10−3 |
hsa-miR-16-2-3p_L+1R-1 | ACCAATATTACTGTGCTGCTTT | Down | 0.30 | 8.30×10−3 |
hsa-miR-27a-3p_R-1 | TTCACAGTGGCTAAGTTCCG | Down | 0.31 | 8.95×10−3 |
hsa-miR-24-3p_R-2 | TGGCTCAGTTCAGCAGGAAC | Down | 0.49 | 9.61×10−3 |
hsa-miR-146a-5p | TGAGAACTGAATTCCATGGGTT | Down | 0.26 | 1.25×10−2 |
hsa-miR-148a-3p | TCAGTGCACTACAGAACTTTGT | Down | 0.08 | 1.44×10−2 |
hsa-miR-423-5p | TGAGGGGCAGAGAGCGAGACTTT | Down | 0.43 | 1.79×10−2 |
miRNA/miR, microRNA.
Ten randomly selected miRNAs for validation from exo-miRNA sequence by TaqMan reverse transcription-quantitative PCR.
miR name | miR sequence | Regulation | Fold change | P-values | KEGG name | GO name | GO function |
---|---|---|---|---|---|---|---|
miR-30a-5p | TGTAAACATCCTCGACTGGAAGCT | Up | 5.30 | 1.79×10−4 | Pathways in cancer | Nucleoplasm | Cellular component |
miR-16-5p | TAGCAGCACGTAAATATTGGCG | Up | 2.55 | 1.83×10−4 | MicroRNAs in cancer | Nucleotide binding | Cellular component |
miR-96-5p | TTTGGCACTAGCACATTTTTGCT | Up | 3.83 | 1.32×10−5 | MicroRNAs in cancer | Nucleoplasm | Cellular component |
let-7c-5p | TGAGGTAGTAGGTTGTATGGTT | Up | 4.05 | 4.86×10−6 | MicroRNAs in cancer | Nucleoplasm | Cellular component |
miR-182-5p | TTTGGCAATGGTAGAACTCACACCG | Up | 8.04 | 1.76×10−4 | Hippo signaling pathway | Nucleoplasm | Cellular component |
miR-210-3P | CTGTGCGTGTGACAGCGGCTGA | Up | 8.57 | 3.84×10−5 | Ras signaling pathway | Nucleoplasm | Cellular component |
miR-378a-3P | ACTGGACTTGGAGTCAGAAGGC | Up | 3.56 | 3.47×10−5 | Ras signaling pathway | Protein binding | Molecular function |
miR-493-5p | TTGTACATGGTAGGCTTTCATT | Up | inf | 1.06×10−3 | p53 signaling pathway | Protein binding | Molecular function |
miR-494-3p | TGAAACATACACGGGAAACCTCT | Up | inf | 8.53×10−4 | Proteoglycans in cancer | Protein binding | Molecular function |
miR-143-3p | TGAGATGAAGCACTGTAGCTC | Up | 24.20 | 5.21×10−4 | Pathways in cancer | Protein binding | Molecular function |
miRNA/miR, microRNA; KEGG, Kyoto Encyclopedia of Genes and Genomes; GO, Gene Ontology.