U251 cells (cat no. TCHu58) and U87 glioblastoma of unknown origin (cat. no. TCHu138) cells were purchased from The Cell Bank of Type Culture Collection of The Chinese Academy of Sciences (Shanghai, China) and the cell lines were identified by STR. Cells were cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 10% FBS (Gibco; Thermo Fisher Scientific, Inc.). The serum-free medium (SFM) was composed of DMEM/F12 (Gibco; Thermo Fisher Scientific, Inc.) with 20 µl/ml B27 supplement (Thermo Fisher Scientific, Inc.), 20 ng/ml basic fibroblast growth factor (MilliporeSigma) and 20 ng/ml epidermal growth factor (MilliporeSigma). Glioblastoma stem-like cells (GSCs) were isolated from U251 cells transfected with shCTRL or shVAV3-#1/2 using the serum-free medium (SFM). These cells can form neurosphere-like cell aggregates in <7 days (19). For the selection of stable glioma cell lines, U251 cells were cultured in 400 µg/ml neomycin for 14 days after transfection.

mRNA expression of VAV3 in human glioblastoma samples was analyzed by the online database GlioVis (gliovis.bioinfo.cnio.es/). Total RNA from cells was isolated using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The total RNA was subsequently treated with RNase-free DNase I (Roche Diagnostics). Complementary DNA synthesis was performed using a BcaBest RNA PCR kit from Takara Bio, Inc. according to the manufacturer's protocols. qPCR was performed using an iQ™5 Multicolor Real-Time PCR Detection system (Bio-Rad Laboratories, Inc.) with Realtime PCR Master Mix (SYBR Green, Toyobo Life Science). The thermocycling conditions used for qPCR were as follows: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec, in a total volume of 20 µl. Relative mRNA expression levels were assessed using the 2^−ΔΔCq method (20). GAPDH was used as the endogenous control. The PCR primer sequences used were as follows: VAV3 forward (F): 5′-CTGCCAGCTGCTTAACAACC-3′ and reverse (R), 5′-CAGGCCGTGAGAAATGTCCT-3′; miR-218 RT primer, 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATGG-3′ (21); miR-218 qPCR F primer, 5′-GTGCAGGGTCCGAGGTATTC-3′, miR-218 qPCR R primer, 5′-TTGATCTAACCATGTGTCGTA-3′; and GAPDH F, 5′-GAAGGTGAAGGTCGGAGTC-3′ and R, 5′-GAAGATGGTGATGGGATTTC-3′.

The glioblastoma cells lysates were prepared using RIPA lysis and extraction buffer (Thermo Fisher Scientific, Inc.) with complete protease inhibitor cocktail (Roche Diagnostics). The protein concentration was determined using a BCA protein assay kit (Pierce; Thermo Fisher Scientific, Inc.). The samples (20 µg/line) were separated by 12 % SDS-PAGE and transferred to polyvinylidene fluoride membranes (Roche Diagnostics). The membranes were blocked using 5% non-fat dry milk in TBS, followed by incubation with the primary antibodies at 4°C overnight and then HRP-labeled secondary antibodies at room temperature for an hour (Cat#: 61-6520, 1:5,000, HRP-labeled, Thermo Fisher Scientific, Inc). The immunolabeled proteins were detected using an ECL detection system (Wuhan Boster Biological Technology, Ltd). The primary antibodies used were as follows: Actin (1:1,000, cat. no. AA128; Beyotime Institute of Biotechnology), VAV3 (1:1,000, cat. no. 2398s, Cell Signaling Technology, Inc.), Nestin (1:1,000, cat. no. MAB5326, MilliporeSigma) and SOX2 (1:1,000, cat. no. 3579s, Cell Signaling Technology, Inc.).

Cell transfections with 1 µg nucleic acid were performed using Lipofectamine™ 2000 transfection reagent (Thermo Fisher Scientific, Inc) according to the manufacturer's protocol. For the selection of stable cell lines, the transformed cells were cultured in 400 ug/ml G418 for 14 days and the expression of VAV3 was assessed using western blotting and RT-qPCR. The sequences of the shRNAs were as follows: VAV3 shRNA-1#, CGAAGTTGTTGTCTAGCAGAA and VAV3 shRNA-2#, CGGAACCTAATGCAAGAGATT.

The binding site of miR-218 to VAV3 was predicted by the online database Target scan (targetscan.org/vert_80/; version 8.0). The miR-218 vector and pmirGLO-VAV3-3′UTR, pmirGLO-VAV3-3′UTR-mutant (mut), were co-transfected into U251 cells using Lipofectamine™ 2000 transfection reagent(Thermo Fisher Scientific, Inc). The cells were harvested and lysed at 24 h post-transfection. The luciferase activity was measured using the dual-luciferase reporter assay system (Promega Corporation) according to the manufacturer's protocol. A total of 48 h post-transfection, firefly and Renilla luciferase activities were detected using the GloMax^®-Multi Jr Single Tube Multimode Reader (Promega, Madison, WI, USA), according to the Dual-Luciferase Reporter Assay system (Promega, Madison, WI, USA).

Glioblastoma Cells (5×10⁵) were added on the top side of polycarbonate Transwell filters (without Matrigel for Transwell migration assays) or plated on the top side of polycarbonate Transwell filter coated with Matrigel at 37°C for an hour (for Transwell invasion assay) in the upper chamber of the QCM™ 24-Well Cell Invasion Assay (Cell Biolabs, Inc.) plates. For Transwell migration assays, cells were suspended in SFM and SFM was used in the lower chamber. For the invasion assay, cells were suspended in SFM and DMEM with fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) was used as a chemoattractant in the lower chamber. The cells were incubated at 37°C for 8 h (migration assay) or 48 h (invasion assay). The cells in the top chambers were then removed using cotton swabs. The migrated and invaded cells on the lower membrane surface were fixed using 100% methanol for 10 min at room temperature, air-dried, then stained with DAPI at room temperature for 10 min and quantified using a fluorescence OLYMPUS U-HGLGPS microscope and cellSens entry software 1.0 (Olympus, Japan).

U251 cells were seeded in six-well plates and cultured at 37°C overnight in DMEM medium until 100% confluency. A wound was then created by manually scraping the cell monolayer with a 200 µl pipette tip. The cultures were washed twice with PBS to remove floating cells. The cells were then incubated at 37°C in DMEM (Gibco; Thermo Fisher Scientific, Inc.) supplemented with 1% FBS (Gibco; Thermo Fisher Scientific, Inc.). Cell migration into the wound was assessed at three preselected time points (0, 24 and 48 h) in eight randomly selected fields of view for each condition and time point. Images were captured using a Nikon DS-5M Camera System mounted on a phase-contrast Leitz microscope. The distance traveled by the cells was determined by measuring the wound width at different time points and then subtracting it from the wound width at 0 h using Image-Pro Plus 6.0 (Media Cybernetics, Bethesda, MD).

A limiting dilution assay was performed as described previously (19,22). Cancer sphere cells were dissociated and plated on 96-well micro-well plates in 0.2 ml SFM. Final cell dilutions ranged from 20 cells/well to 160 cell/well in a total volume of 0.2 ml. Cultures were added with 0.025 ml of SFM every 2 days until day 7, then the percentage of wells without spheres was calculated for each cell plating density and plotted against the number of cells per well. Limiting dilution analysis was performed using online software ELDA 1.0 (Extreme Limiting Dilution Analysis) (http://bioinf.wehi.edu.au/software/elda/).

U251 cells (3000 cells/well in 100 µl DMEM medium) were seeded into 96 well tissue culture plate, each group was repeated 3 times. CCK8 (Selleck Chemicals) regent was add with 10 µl/well at four time points (24, 48, 72 and 96 h), incubated 2 h at 37°C; after shaking the plates for 1 min, the absorbance of samples was measured using an ELISA reader at 450 nm.

The present study was compliant with all relevant ethical regulations regarding animal research and was approved by the Institutional Animal Care and Use Committee of Xi'an Medical University (No. XYLS2022190). U251 cells stably expressing VAV3-shRNA-1# or empty vector controls (4.0×10⁶ cells in 200 µl per mouse) were injected subcutaneously in the flanks of female athymic nude BALB/c nu/nu mice (n=6 per treatment group; age, ~6 weeks). Mice were housed in a standard environment which was characterized by 12 h light/dark cycle, 22–25°C and 40–60% humidity with free access to water and chow. Tumor volumes were calculated according to the formula: Volume=length × width²/2. The experiment lasted for 20 days and no animals died during the experimental period. Animal health was monitored every day and the size of the tumor was measured every four days. A total of six mice per group were used and tumor cells were injected in both sides to minimize the number of mice used. The mice were euthanized when a single tumor volume reached 3,000 mm³. The mice were euthanized cervical dislocation and death was confirmed when mice stopped breathing and had no nerve reflex.

In vitro experiments were performed with at least three independent biological samples unless otherwise stated. Data were presented as mean ± standard error. Comparisons between two groups were performed using the Student's t-test. Comparisons among multiple groups were performed using one-way ANOVA followed by Dunnett's post-hoc test. Survival of animals in in vivo studies was analyzed using Kaplan-Meier analyses and log-rank test. GraphPad Prism 8.0 for windows (GraphPad Software, Inc.) was used for data analysis. P<0.05 was considered to indicate a statistically significant difference.

To evaluate whether VAV3 was crucial for human glioblastoma tumorigenesis, the publicly available data at GlioVis (23) were assessed. Analysis of GlioVis by The Cancer Genome Atlas (TCGA) demonstrated that VAV3 mRNA was expressed at a significantly higher level in GBM compared with normal brain tissues (Fig. 1A). Further analysis of the Chinese Glioma Genome Atlas (CGGA) (24), demonstrated that the mRNA expression level of VAV3 was significantly increased with increasing tumor grade (Fig. 1B), the levels of VAV3 expression in tumor specimens were associated with their World Health Organization grades. Kaplan-Meier analysis using the optimal cutoff demonstrated that mRNA expression levels of VAV3 in GBM specimens were inversely associated with patients' survival time based on data from TCGA (Fig. 1C) and CGGA (Fig. 1D). Collectively, these analyses suggested that VAV3 was an oncogene and could be a potential therapeutic target for GBM therapy.

To evaluate the function of VAV3 in glioblastoma cells, shRNA targeting VAV3 mRNA (shVAV3) was used to suppress the expression of VAV3 in U251 cells. The knockdown effect of shRNA was assessed using RT-qPCR and western blotting analysis (Fig. 2A and B). The results demonstrated that both the VAV3 shRNAs markedly suppressed VAV3 mRNA and protein expression levels and that VAV3-shRNA-1# was better. CCK-8 cell viability assays demonstrated that the suppression of the expression of VAV3 in U251 cells significantly inhibited the proliferation of glioblastoma cells compared with the control (Fig. 2C). The wound healing assay demonstrated that reduced VAV3 expression significantly suppressed the migration ability of U251 cells compared with the control (Fig. 2D and E). Furthermore, the migration and invasive potential of VAV3 shRNA U251 cells was also markedly reduced compared with the control (Fig. 2F and G). All these suggest that VAV3 regulate the U251 glioblastoma cell migration, invasion and proliferation, migration and invasion.

To evaluate the role of VAV3 in glioblastoma cells, VAV3-shRNA-1# was used to specifically suppress the expression of VAV3 in U87 cells. The knockdown effect of shRNA was assessed using RT-qPCR and western blotting analysis (Fig. 3A and B). The results demonstrated that the VAV3 shRNA could markedly suppress VAV3 expression in U87 cells compared with the control. CCK-8 cell viability assays demonstrated that the suppression of the expression of VAV3 in U87 cells significantly inhibited the proliferation of glioblastoma cells compared with the control (Fig. 3C). Furthermore, the migration and invasion ability of VAV3 shRNA U87 cells was also significantly reduced compared with the control (Fig. 3D and E). Collectively, these analyses suggested that VAV3 regulate the U87 glioblastoma cell migration, invasion and proliferation, migration and invasion.

The effects of VAV3 on glioblastoma stem like cell self-renewal, U251 cells were cultured in SFM to induce the tumor sphere formation. A significant decrease in the diameter of U251 neurospheres in VAV3 knockdown groups (VAV3 shRNA-1#, 217.3±9.9 µm; VAV3 shRNA-2#, 235.2±14.8 µm) was demonstrated compared with that of the control (311.5±15.4 µm) (Fig. 4A and B). Furthermore, downregulation of VAV3 reduced the self-renewal capacity of U251 cancer stem-like cells compared with the control. The number of cells required to generate at least one tumor sphere/well was 113.9 µm in VAV3 shRNA-1#-U251 cells, 120.6 µm in VAV3 shRNA-2#-U251 cells, and 50.4 µm in control shRNA-U251 cell (Fig. 4C). The protein expression levels of the stem cell markers Nestin and Sox2 in these tumor neurospheres was assessed using western blotting, which demonstrated that the expression of these GSC makers were markedly decreased in the tumor spheres from VAV3 shRNA-transfected U251 cells compared with control shRNA (Fig. 4D). These data suggested that the downregulation of VAV3 expression could inhibit the self-renewal capacity of glioblastoma stem-like cells.

To analyze the role of VAV3 in glioblastoma carcinogenesis, the effect of VAV3 decrease on tumor growth were assessed in vivo. VAV3-shRNA-1#-U251 cells and control cells were implanted into the left and right flanks of nude mice (n=6 per group) by subcutaneous injection. At 20 days post-injection, the tumors derived from VAV3-shRNA-1#-U251 cells were significantly smaller than those derived from control-U251 cells (Fig. 5). Which demonstrated that knockdown of VAV3 significantly inhibited the proliferation of glioblastoma cells in vivo.

Several computational methods were used to evaluate the potential targets of miR-218 in humans. The TargetScan program identified two conserved binding sites for miR-218 in the 3′UTR region of the VAV3 mRNA) (Fig. 6A). To evaluate if VAV3 was a direct target of miR-218, RT-qPCR was used to assess VAV3 mRNA expression levels in U251 cells, which demonstrated significantly decreased VAV3 mRNA expression levels in miR-218 overexpression cells compared with the control (Figs. 6B and S1). To assess whether miR-218 directly targeted VAV3, a dual-luciferase reporter system containing the wild-type (WT) and mut 3′-UTR of VAV3 was used. The luciferase activity in the miR-218/WT-VAV3-UTR-transfected cells was significantly decreased compared with the control, whereas the luciferase activity in the miR-218/mut-VAV3-UTR-transfected cells demonstrated no significant difference, which suggested that miR-218 directly targeted the 3′-UTR of VAV3. Furthermore, miR-218 and the VAV3 overexpression vector were co-transfected into U251 cells to assess whether miR-218 performed its tumor suppression functions via targeting of VAV3. After co-transfection, it was demonstrated that the overexpression of VAV3 significantly counteracted the tumor suppressor effect of miR-218 in glioblastoma cells during migration and invasion (Fig. 6D). Further analysis demonstrated that VAV3 overexpression markedly reduced the effects of miR-218 on the self-renewal capacity of glioblastoma stem-like cells (Fig. 6E). These findings further demonstrated that VAV3 was a target gene of miR-218.