Contributed equally
Heterogeneous nuclear ribonucleoprotein A/B (hnRNPAB) is an RNA binding protein that is closely associated with the biological function and metabolism of RNA, which is involved in the malignant transformation of various tumor cells. However, the role and mechanisms of hnRNPAB in non-small cell lung cancer (NSCLC) are still unclear. In the present study, the expression levels of hnRNPAB in NSCLC and normal tissues were analyzed using the human protein atlas database and UALCAN database. The clinical significance of hnRNPAB was assayed using the data of NSCLC cases from The Cancer Genome Atlas database. Subsequently, two stable NSCLC cell lines with hnRNPAB knockdown were constructed and the effects of hnRNPAB silencing on cell viability, migration, invasion and epithelial-mesenchymal transition (EMT) were identified. Genes associated with hnRNPAB expression in NSCLC were screened using the Linked Omics database and verified by quantitative real-time PCR (RT-qPCR). The database analysis indicated that hnRNPAB was mainly expressed in the nucleus of NSCLC cells. Compared with the normal tissues, hnRNPAB expression was overexpressed in NSCLC tissues and was closely associated with the overall survival, sex, tumor-node-metastases classification, and poor prognosis of patients with lung adenocarcinoma. Functionally, knockdown of hnRNPAB inhibited the proliferation, migration, invasion and EMT of NSCLC cells and arrested the cell cycle at G1 phase. Mechanistically, the bioinformatics analysis and RT-qPCR verification demonstrated that hnRNPAB knockdown led to a significant expression change of genes associated with tumorigenesis. In conclusion, the present study indicated that hnRNPAB played an important role in the malignant transformation of NSCLC, supporting the significance of hnRNPAB as a novel potential therapeutic target for the early diagnosis and prognosis of NSCLC.
Lung cancer is one of the most common malignancies (
Tumor invasion and metastasis are important reasons for the poor prognosis of patients with NSCLC (
Heterogeneous nuclear ribonucleoproteins (hnRNPs) are a kind of RNA binding proteins (RBPs) closely related to the function and metabolism of RNA, such as transcription, alternative splicing, nucleocytoplasmic transport, stability, and translation (
In this study, the expression and localization of hnRNPAB in NSCLC tissues and its correlation with clinicopathological parameters of patients with NSCLC were analyzed through public databases. Then the role of hnRNPAB silencing in the malignant transformation of NSCLC cells was investigated
The expression and localization of hnRNPAB in lung cancer and normal tissues were analyzed by the human protein atlas database (
The human NSCLC cell line NCI-H292 and the human renal epithelial cell line 293T were purchased from Kunming Cell Bank of Chinese Academy of sciences. The human NSCLC cell line PC-9 was obtained from FuHeng Biology Company (Shanghai, China). NCI-H292 and PC-9 were maintained in RPMI-1640 medium (C11875500BT, Gibco, Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (10270-106, FBS, Gibco). 293T was cultured in Dulbecco's Modified Eagle Medium (DMEM, C11995500BT, Gibco) with 10% FBS. All cell lines were cultured at 37°C in a 5% CO2 humidified atmosphere.
To construct hnRNPAB knockdown recombinants, hnRNPAB and negative control (NC) shRNA sequences (sense and antisense) were designed (shown in
293T cells were plated in a 6-well plate and the cell confluence reached 90% after 24 h. The hnRNPAB shRNA or NC shRNA recombinants, lentivirus packaging plasmid psPASX2 and PMD2G were mixed in a 4:3:1 ratio and then transfected into 293T cells using an Entranster™-R4000 reagent (4000-4, Engreen Biosystem, Beijing, China) following the manufacturer's instructions. At 48 h after transfection, the viral supernatant was collected and filtered with 0.22 µm filters. The virus solution was mixed with lentivirus infection reagent (30001-2-0.5, Engreen Biosystem) according to the manufacturer's instructions and then added into the NCI-H292 or PC-9 cells with a 40–60% cell confluence. After 8 h of lentivirus infection, the infection solution was replaced by fresh RPMI-1640 medium (10% FBS, no antibiotics). After 72 h of infection, puromycin (final concentration 2.0 µg/ml) was added to screen the stable cell lines.
Cells were lysed in RIPA buffer (P0013B, Beyotime, Shanghai, China) for 20 min on ice and then centrifuged at 12,000 × g for 10 min at 4°C. The proteins in harvested supernatants were separated on 10% SDS-PAGE gels and then transferred onto polyvinylidene difluoride membranes (IPVH00010, Millipore, Merck, Billerica, MA, USA), which were successively probed with indicated antibodies and detected with an Enhanced Chemiluminescence Reagent (WBKLS0100, Millipore). Rabbit polyclonal antibodies against hnRNPAB (A17497, 1:2,000, ABclonal, Wuhan, China), Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, 60004-1-Ig, 1:5,000, Proteintech, Wuhan, China), ZEB1 (21544-1-AP, 1:1,000, Proteintech), N-cadherin (22018-1-AP, 1:5,000, Proteintech), E-cadherin (20874-1-AP, 1:5,000, Proteintech), Vimentin (10366-1-AP, 1:10,000, Proteintech) and SNAI1 (13099-1-AP, 1:2,000, Proteintech), and a horseradish peroxidase-conjugated secondary antibody (SA00001-2, 1:5,000, Proteintech) were used.
Total RNA was extracted using a TRIzol reagent (15596-026, Invitrogen, Thermo Fisher Scientific) and reverse transcribed into cDNA by a PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, Takara). Fluorescence quantitative PCR was performed using a 2× SYBR Green quantitative PCR Master Mix (B21203, Bimake, Shanghai, China) according to the manufacturer's protocol in an Applied Biosystems StepOne Plus Real-Time PCR System (Applied Biosystems, Foster, CA, USA). The primer sequences of each gene were shown in
Cells were seeded into 96-well plates at a concentration of 2×103 cells per well and then cultured for 24, 48, and 72 h, respectively. At the indicated time, 10 µl CCK-8 solution was added to each well and mixed. The cells were incubated for 1–4 h at 37°C and the absorbance at 450 nm was measured with a Biotek ELx800 (Biotek Winooski, Vermont, USA).
Cells were seeded in 6-well plates at a concentration of 1×103 cells per well and cultured for 2 weeks. The cells were washed twice with 1× phosphate buffered solution (PBS), fixed with 4% paraformaldehyde for 30 min, and stained with 0.01% crystal violet for 15 min. The number of colonies was counted using ImageJ.
Cells were plated in 6-well plates and reached confluence after 24 h. A straight wound was scratched on the cell layer with a 200 µl pipette. Then the cells were washed twice with 1× PBS and cultured in the medium with 4% FBS. The photographs were taken at 0 and 24 h for the same visual fields. Cell migration was expressed as the percentage of scratch healing, which was calculated by [(scratch area at 0 h-scratch area at 24 h)/scratch area at 0 h] ×100%.
The upper Transwell chamber (CLS3464, Corning Costar, Tewksbury, MA, USA) was coated with 100 µl 10% BD Matrigel matrix (356234, BD Biosciences, San Jose, CA, USA) diluted with the serum-free medium, and then incubated in a cell incubator for 2 h. 2×104 cells per well suspended in the serum-free medium were plated into the upper chamber. The bottom chamber was filled with 700 µl medium containing 10% FBS. After incubation for 48 h, cells in the upper membrane of chamber were removed and cells adhering to the lower membrane were fixed with 4% paraformaldehyde for 30 min and stained with crystal violet for 15 min. Five random areas for each chamber were selected to count cell numbers.
Cells were collected, washed twice with precooled 1× PBS, and fixed overnight at 4°C with 75% alcohol (diluted with 1× PBS). Then the cells were harvested again, washed twice with precooled PBS, and incubated with 500 µl staining solution (50 µg/ml propidium iodide, 100 µg/ml RNase A, 0.2% Triton X-100, 1× PBS) for 30 min. Cell-cycle was detected on a BD Accuri C6 flow cytometry (BD Biosciences, San Jose, CA, USA) and the results were analyzed with the software Modifit (Verity Software House, Topsham, ME, USA).
Cells were harvested and washed twice with precooled 1× PBS. After staining with Annexin V-APC and 7-AAD (AP105, MULTISCIENCES, Hangzhou, China), cells were analyzed on a BD Accuri C6 flow cytometry (BD Biosciences). All samples were assayed in triplicate.
Software SPSS 21.0 (IBM, Armonk, NY, USA) was used for the statistical analysis. Differences between two groups were determined by Student's t-test, and analysis of one-way ANOVA followed by the post hoc Dunnett's test was used for comparisons of more than two. Survival curves were analyzed by the Kaplan-Meier log-rank test. Genes expression correlation was analyzed using the Pearson correlation coefficient. Experiments were performed in triplicate. All experimental data are presented as the mean ± SD. P<0.05 indicates a statistically significant difference.
Firstly, the expression and role of hnRNPAB in NSCLC tissues were examined. Immunohistochemical staining (IHC) analysis from the human protein atlas database indicated that hnRNPAB protein was mainly expressed in the nucleus of NSCLC cells (
The role of hnRNPAB expression dysregulation in NSCLC cells was further explored by constructing two stable hnRNPAB knockdown cell lines. Compared with the control group (NC shRNA), hnRNPAB protein and mRNA expression levels in NCI-H292 and PC-9 cells with hnRNPAB knockdown (hnRNPAB shRNA-1 and shRNA-2) were significantly reduced (
Next, the effects of hnRNPAB knockdown on cell migration, invasion, and EMT were detected. The scratch test showed that the wound healing degree of hnRNPAB shRNA group was significantly lower than that of NC shRNA group (
To explore the molecular mechanism of hnRNPAB promoting the malignant transformation of NSCLC cells, the genes related to hnRNPAB expression in NSCLC were analyzed using the LinkedOmics database. As shown in
NSCLC has seriously threatened human health. Once NSCLC was diagnosed, most patients usually were in the late stage or their tumors have metastasized, thus losing the opportunity for surgery (
HnRNPs are a kind of RNA binding proteins. So far, more than 20 hnRNP members have been identified, including hnRNPA ~ U (
HnRNPAB is a member of the hnRNP family. Previous studies have shown that hnRNPAB is dysregulated in multiple tumors, which is associated with various malignant phenotypes of tumors (
Metastasis is a main cause of mortality in cancer patients (
To explore the molecular mechanism of hnRNPAB regulating the proliferation and metastasis of NSCLC cells, 10 genes positively correlated with hnRNPAB expression were selected for verification. The results showed that the expressions of NOP16, NPM1, TCOF1, CENPH and CCNB1 were not only positively correlated with the expression of hnNRPAB in LUAD and LUSC cases but also down-regulated in hnRNPAB silenced cells. Previous studies have shown that these 5 genes were highly expressed in a variety of tumor tissues, which promoted the malignant transformation of tumor cells (
In conclusion, this study identified hnRNPAB as a useful biomarker in the prognosis of patients with LUAD. The overexpression of hnRNPAB promoted the proliferation and metastasis of NSCLC cells partially by up-regulating the expressions of NOP16, NPM1, TCOF1, CENPH and CCNB1. Our results may offer a potential novel target for the treatment of NSCLC.
Not applicable.
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
QW and KS designed the research and confirmed the authenticity of all the raw data. XG performed experiments. XG, LL and HY performed statistical analysis. QW wrote the manuscript. QW and XG prepared figures. TZ, YZ, YX and JZ interpreted the data. All authors read and approved the final manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
hnRNPAB expression is upregulated in NSCLC tissues and correlates with poor prognosis of patients with LUAD. (A) Localization of hnRNPAB protein in NSCLC tissues was analyzed using the human protein atlas database (left scale bar, 100 µm; right scale bar, 50 µm). (B) Expression levels of hnRNPAB in NSCLC and normal tissues were analyzed using the UALCAN database. (C) Prognostic effect of hnRNAPAB expression in NSCLC was analyzed using the Kaplan-Meier method and compared using the log-rank test. ***P<0.001 compared with normal group. hnRNPAB, heterogeneous nuclear ribonucleoprotein A/B; NSCLC, non-small cell lung cancer; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma.
HnRNPAB knockdown inhibits the proliferation of non-small cell lung cancer cells. (A) Protein and mRNA expression levels of hnRNPAB in stable hnRNPAB knockdown cells were examined using western blotting and reverse transcription-quantitative PCR. GAPDH was used as an internal control. (B) Cell viability and (C) proliferation were tested by Cell Counting Kit-8 and adherent colony formation assays. (D) Cell cycle was detected using flow cytometry. Results are representative of three independent experiments. **P<0.01 and ***P<0.001 compared with NC shRNA. HnRNPAB, heterogeneous nuclear ribonucleoprotein A/B; NC, negative control; shRNA, short hairpin RNA; OD, optical density.
HnRNPAB-silencing inhibits the migration, invasion and EMT of NSCLC cells. (A) Cell migration was evaluated using wound healing assay (magnification, ×100). (B) Cell invasion was evaluated using Matrigel matrix-coated Transwell assay (magnification, ×100). (C) Protein and mRNA expression levels of EMT-related markers ZEB1, E-cadherin, SNAI1, N-cadherin and Vimentin were determined using western blotting and reverse transcription-quantitative-PCR. GAPDH was used as a loading control. For western blotting, multiple membranes from the same sample at the same time were used to expose different target proteins and so >1 GAPDH were provided. Results are representative of three independent experiments. *P<0.05, **P<0.01 and ***P<0.001 compared with respective NC shRNA group. HnRNPAB, heterogeneous nuclear ribonucleoprotein A/B; NC, negative control; shRNA, short hairpin RNA; EMT, epithelial-mesenchymal transition; ZEB1, zinc finger E-box binding homeobox 1.
Analysis of genes related to hnRNPAB expression in NSCLC. (A) Analysis of hnRNPAB-related genes using LinkedOmics database based on Pearson correlation coefficient. (B) Analysis of positive and negative correlated genes with hnRNPAB. (C) Co-expression analysis between hnRNPAB and the screened genes using the mRNA expression data of NSCLC samples from The Cancer Genome Atlas database. HnRNPAB, heterogeneous nuclear ribonucleoprotein A/B; NSCLC, non-small cell lung cancer; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma; NOP16, NOP16 nucleolar protein; NPM1, nucleophosmin 1; TCOF1, treacle ribosome biogenesis factor 1; CENPH, centromere protein H; CCNB1, cyclin B1; HSP, heat shock protein family; SFXN1, sideroflexin 1; PPM1G, protein phosphatase, Mg2+/Mn2+ dependent 1G; TMED9, transmembrane p24 trafficking protein 9; DDX41, DEAD-box helicase 41.
Expression levels of the screened genes in stable hnRNPAB-silenced cells were verified using RT-qPCR. The total RNA was extracted and the mRNA expression levels of NOP16, NPM1, TCOF1, CENPH and CCNB1 in stable non-small cell lung cancer cell lines were determined using RT-qPCR. GAPDH was used as an internal control. Results are representative of three independent experiments. *P<0.05, **P<0.01 and ***P<0.001 compared with respective NC shRNA group. HnRNPAB, heterogeneous nuclear ribonucleoprotein A/B; RT-qPCR, reverse transcription-quantitative PCR; NOP16, NOP16 nucleolar protein; NPM1, nucleophosmin 1; TCOF1, treacle ribosome biogenesis factor 1; CENPH, centromere protein H; CCNB1, cyclin B1; NC, negative control; shRNA, short hairpin RNA.
Primer sequences.
Gene | Direction | Primer sequences (5′-3′) |
---|---|---|
hnRNPAB (NM_004499) shRNA-1 | Sense | GATCCGTGGAAGCAAGTGTGAGATCAATTCAA |
GAGATTGATCTCACACTTGCTTCCATTTTTTG | ||
Antisense | AATTCAAAAAATGGAAGCAAGTGTGAGATCAA | |
TCTCTTGAATTGATCTCACACTTGCTTCCACG | ||
hnRNPAB (NM_004499) shRNA-2 | Sense | GATCCGGTTTGGGTTTATCCTGTTCATTCAAGA |
GATGAACAGGATAAACCCAAACCTTTTTTG | ||
Antisense | AATTCAAAAAAGGTTTGGGTTTATCCTGTTCA | |
TCTCTTGAATGAACAGGATAAACCCAAACCG | ||
NC shRNA | Sense | GATCCGCTTCGCGCCGTAGTCTTATTCAAG |
AGATAAGACTACGGCGCGAAGCTTTTTTG | ||
Antisense | AATTCAAAAAAGCTTCGCGCCGTAGTCTTA | |
TCTCTTGAATAAGACTACGGCGCGAAGCG | ||
hnRNPAB (NM_004499) qPCR | Sense | TTTGGCGAGTTTGGGGAGATT |
Antisense | GCCATACTGCTGCTGATAGAC | |
NOP16 (NM_001256539) qPCR | Sense | AAAGGAAATACTCTGTCTCGGG |
Antisense | CTTCTGCAAAGAATCGAGGAAG | |
DDX41 (NM_001321732) qPCR | Sense | CCACTACCTTCATCAACAAAGC |
Antisense | ACCTTCTGCTTGGCTTCTAG | |
NPM1 (NM_001355007) qPCR | Sense | AGTATATCTGGAAAGCGGTCTG |
Antisense | CATTTTTGGCTGGAGTATCTCG | |
TCOF1 (NM_001135243) qPCR | Sense | TTTGTCGACCCTAATCGTAGTC |
Antisense | CAGGAGTCAAGCACTGTGTAG | |
TMED9 (NM_017510) qPCR | Sense | GAGACCATGGTCATAGGAAACT |
Antisense | TATGGGAAGTGAAAGTGAACCT | |
CENPH (NM_022909) qPCR | Sense | TTCCAGAACCTTATTTTGGGGA |
Antisense | CTTCTCAAGCTGCAGAACAATT | |
CCNB1 (NM_001354844) qPCR | Sense | CTTGCAGTAAATGATGTGGATG |
Antisense | GTGACTTCCCGACCCAGTAG | |
PPM1G (NM_177983) qPCR | Sense | AACTCCTTCACAAGAAAATGGC |
Antisense | TGTCCTCAAAGAACTTGGACTT | |
SFXN1 (NM_001322977) qPCR | Sense | TGGGATCAAAGCACTTTCATTG |
Antisense | TTTCTGTAAGACCAGGAGGAAC | |
HSPA9 (NM_004134) qPCR | Sense | GTCAGATTGGAGCATTTGTGTT |
Antisense | CGAGTCATTGAAATAAGCTGGG | |
GAPDH (NM_001357943) qPCR | Sense | GGAGCGAGATCCCTCCAAAAT |
Antisense | GGCTGTTGTCATACTTCTCATGG | |
ZEB1 (NM_001128128) qPCR | Sense | TTACACCTTTGCATACAGAACCC |
Antisense | TTTACGATTACACCCAGACTGC | |
E-cadherin (NM_001317185) qPCR | Sense | CGAGAGCTACACGTTCACGG |
Antisense | GGGTGTCGAGGGAAAAATAGG | |
N-cadherin (NM_001308176) qPCR | Sense | AGCCAACCTTAACTGAGGAGT |
Antisense | GGCAAGTTGATTGGAGGGATG | |
Vimentin (NM_003380) qPCR | Sense | TGCCGTTGAAGCTGCTAACTA |
Antisense | CCAGAGGGAGTGAATCCAGATTA | |
SNAI1 (NM_005985) qPCR | Sense | ACTGCAACAAGGAATACCTCAG |
Antisense | GCACTGGTACTTCTTGACATCTG |
Correlations between hnRNPAB mRNA expression level and clinicopathological parameters in NSCLC.
hnRNPAB expression in LUAD | hnRNPAB expression in LUSC | |||||||
---|---|---|---|---|---|---|---|---|
Variable | Low (n=292) | High (n=293) | χ2 | P-value | Low (n=275) | High (n=275) | χ2 | P-value |
Sex | 6.419 | 0.011 |
1.133 | 0.287 | ||||
Female | 119 | 150 | 208 | 197 | ||||
Male | 173 | 143 | 67 | 78 | ||||
Age | 1.410 | 0.235 | 1.029 | 0.310 | ||||
≤60 | 94 | 108 | 58 | 68 | ||||
>60 | 198 | 185 | 217 | 207 | ||||
T classification | 10.487 | 0.033 |
4.077 | 0.253 | ||||
T1 | 112 | 79 | 55 | 71 | ||||
T2 | 150 | 171 | 172 | 151 | ||||
T3 | 21 | 29 | 38 | 39 | ||||
T4 | 7 | 13 | 10 | 14 | ||||
TX | 2 | 1 | 0 | 0 | ||||
N classification | 13.298 | 0.010 |
2.258 | 0.688 | ||||
N0 | 194 | 178 | 181 | 170 | ||||
N1 | 46 | 61 | 65 | 79 | ||||
N2 | 38 | 49 | 23 | 20 | ||||
N3 | 0 | 2 | 2 | 3 | ||||
NX | 14 | 3 | 4 | 3 | ||||
M classification | 6.050 | 0.049 |
3.144 | 0.208 | ||||
M0 | 188 | 212 | 227 | 221 | ||||
M1 | 12 | 15 | 6 | 2 | ||||
MX | 92 | 66 | 42 | 52 |
P<0.05 analyzed by χ2 test. hnRNPAB, heterogeneous nuclear ribonucleoprotein A/B; LUAD, lung adenocarcinoma; LUSC, lung squamous cell carcinoma.
Univariate and multivariate analyses of various prognostic parameters in patients with LUAD.
Univariate analysis | Multivariate analysis | ||||||
---|---|---|---|---|---|---|---|
Variable | Number of patients | ||||||
HR | 95% CI | P-value | HR | 95% CI | P-value | ||
Sex | 0.905 | 0.690-1.186 | 0.468 | 0.935 | 0.706-1.239 | 0.640 | |
Female | 262 | ||||||
Male | 309 | ||||||
Age | 1.236 | 0.925-1.653 | 0.151 | 1.191 | 0.889-1.1594 | 0.242 | |
≤60 | 192 | ||||||
>60 | 379 | ||||||
T classification | 1.511 | 1.285-1.776 | 0.000 |
1.340 | 1.136-1.581 | 0.001 |
|
T1 | 189 | ||||||
T2 | 312 | ||||||
T3 | 48 | ||||||
T4 | 19 | ||||||
TX | 3 | ||||||
N classification | 1.338 | 1.192-1.503 | 0.000 |
1.298 | 1.142-1.474 | 0.000 |
|
N0 | 365 | ||||||
N1 | 106 | ||||||
N2 | 82 | ||||||
N3 | 2 | ||||||
NX | 16 | ||||||
M classification | 0.943 | 0.803-1.107 | 0.471 | 1.0121 | 0.857-1.194 | 0.890 | |
M0 | 387 | ||||||
M1 | 26 | ||||||
MX | 158 | ||||||
hnRNPAB | 1.509 | 1.147-1.984 | 0.003 |
1.505 | 1.138-1.989 | 0.004 |
|
Low | 287 | ||||||
High | 284 |
P<0.001 and
P<0.01 by Cox proportional hazard model. HR, hazard ratio; CI, confidence interval; hnRNPAB, heterogeneous nuclear ribonucleoprotein A/B; LUAD, lung adenocarcinoma.