The cells were routinely cultured with Dulbecco’s modified Eagle’s medium (DMEM) (PAA Laboratories Ltd., Somerset, UK) supplemented with 10% fetal calf serum (PAA Laboratories Ltd.), penicillin and streptomycin. This study used human prostate cancer (DU-145, PC-3 and CA-HPV10) and human breast cancer (ZR-751 and MDA-MB-231) cell lines. The cell lines were purchased from the American Type Culture Collection (ATCC, Rockville, MD, USA) and were stored at 37°C in 5% CO₂ and under 95% humidity.

Total cellular RNA was isolated from the homogenized human cell lines using Total RNA Isolation reagent (Advanced Biotechnologies Ltd., Epsom, Surrey, UK). RNA concentration and quality were determined through spectrophotometric measurement (WPA UV 1101; Biotech Photometer, Cambridge, UK). cDNA was generated using 200 ng of each RNA sample and a transcription kit (Sigma, Poole, Dorset, UK) to reverse transcribe the RNA samples into cDNA. DNA quality was verified using GAPDH. MTSS1 mRNA levels were assessed using MTSS1 primers (sense, TCAAGAACAGATGGAAGAATGG; antisense, TGCGGTAGCGGTAATGTG). PCR was carried out using a T-Cy Thermocycler (Creacon Technologies Ltd., The Netherlands) and REDTaq^® ReadyMix™ PCR reaction mix (Sigma). The PCR conditions consisted of a 40-sec denaturation step (95°C), a 2-min annealing step (58°C) and a 3-min elongation step (72°C); elongation took place over 36 cycles. The PCR products were next loaded onto a 0.8% agarose gel and electrophoretically separated prior to being stained with ethidium bromide and visualised under UV light.

Quantitative real-time polymerase chain reaction (QPCR) is a technology that provides a broad dynamic range for detecting specific gene sequences with high sensitivity. To quantify the level of MTSS1 transcripts in the prostate cancer cell lines, the iCycler IQ system (BioRad, Camberley, UK) was used. cDNA samples were examined for MTSS1 expression using the MTSS1 QPCR primers (sense, ATATCCCAGGATGCCTTC; antisense, ACTGAACCTGACCGTACACGGTTCTCGCTTCTCTTT). The QPCR technique utilized the Amplifluor System™ (Intergen Inc., UK) and Q-PCR master mix (ABgene, Surrey, UK), in conjunction with a universal probe (UniPrimer™). The real-time QPCR conditions were: 95°C for 15 min, followed by 60 cycles at 95°C for 20 sec, 55°C for 30 sec and 72°C for 20 sec.

MTSS1 expression levels were reduced in the DU-145 prostate cancer cell line using a ribozyme system. Briefly, ribozyme transgenes that specifically cleave MTSS1 mRNA were designed based on the predicted secondary structure of MTSS1. These ribozymes were then generated using touchdown PCR and subsequently cloned into the pEF6/V5-His-TOPO vector and amplified in Escherichia coli. Plasmids were purified and verified for correct size and orientation of the ribozymes, and electroporated into the DU-145 prostate cancer cell line. A closed pEF6/V5/His-TOPO plasmid (containing no ribozyme sequence) was also electroporated into the same cell line to create a control group. After selection using blasticidin, the unaltered wild-type cells were termed DU-145 WT, the wild-type cells containing closed plasmid only were termed DU-145 PEF and the wild-type cells containing plasmid with a ribozyme sequence were termed DU-145 MTSSIKD.

The full sequence of MTSS1 was amplified from cDNA using the standard PCR procedure and a master mix with a proofreading enzyme (sense primer, ATGGAGGCTGTGATTGAG; antisense, CTAAGAAAAGCGAGGGG). This MTSS1 sequence was then T-A cloned into the pEF6/V5/His-TOPO vector (Invitrogen, Paisley, UK) and then electroporated into the PC-3 prostate cancer cell line with the aim of enhancing MTSS1 expression in a cell line that does not normally express it. Multiple clones were used, assessed and sequenced. The PC-3 cells thus prepared and expressing MTSS1 were referred to in the study as PC-3 MTSS1Exp. The control group of cells contained the same plasmid vector (minus the MTSS1 sequence) and was termed PC-3 PEF.

MTSS1 protein expression was assessed in the human prostate cancer cell line lysates through standard SDS-PAGE and Western blot analysis. The cells were grown to confluence in a 75-cm² tissue culture flask before being detached using a cell scraper and pelleted. The cell pellet was then lysed in HCMF buffer with 0.5% SDS, 1% Triton X-100, 2 mM CaCl₂, 100 μg/ml phenylmethylsulfonyl fluoride, 1 mg/ ml leupeptin, 1 mg/ml aprotinin and 10 mM sodium orthovana-date on a rotor wheel for 1 h and spun at 13,000 × g for 15 min to remove insolubles. The lysed protein was then quantified using the Bio-Rad DC Protein Assay kit (Bio-Rad Laboratories, CA, USA), and the samples were normalized to a standard final concentration of 1.5 mg/ml following addition of Sample Buffer, Laemmli 2X concentrate (Sigma) in a 1:1 ratio. The samples were then boiled for 5 min before being loaded into a 10% polyacrylamide gel. Following electrophoresis, proteins were blotted onto a Hybond-C Extra nitrocellulose membrane (Amersham Biosciences UK Ltd., Bucks, UK), blocked in 10% milk and subjected to specific antibody probing. The anti-MTSS1 antibody (SC-98376, Santa Cruz Biotechnologies Inc., Santa Cruz, CA, USA) was used to probe for MTSS1 at a concentration of 1:500 and anti-GAPDH (Santa Cruz Biotechnologies Inc.) at a concentration of 1:500 for GAPDH. Probing with the primary antibody was followed by probing with peroxidase-conjugated anti-rabbit (MTSS1) or anti-rabbit (GAPDH) antibody (Sigma) at a 1:1,000 concentration. The Supersignal West Dura Extended Duration substrate chemiluminescent system (Perbio Science UK Ltd., Cramlington, UK) was then used to visualize the protein bands. GAPDH expression was used as an internal control (Santa Cruz Biotechnologies, Santa Cruz, CA, USA). Protein expression was assessed and quantified using Uvitech analysis software (Uvitech, Cambridge, UK).

The effects of the modification of MTSS1 expression on prostate cancer cell growth rates were assessed using an in vitro growth assay. The cells were seeded in triplicate into 96-well plates at a density of 3,000 cells/well. Plates were then incubated for 1, 3 and 5 days. Cell density was recorded after 1, 3 and 5 days by fixing cells in 4% formaldehyde, washing and staining with 0.5% (w/v) crystal violet. Following this, the crystal violet stain was extracted with 10% (v/v) acetic acid before reading the absorbance on a Bio-Tek ELx800 multiplate reader (Bio-Tek Instruments Inc., VT, USA).

The adhesive properties of the MTSS1-modified cells to an artificial basement membrane were quantified using the in vitro Matrigel adhesion assay. DU-145 WT, DU-145 PEF control and DU-145 MTSS1KD cells and PC-3 WT, PC-3 PEF control and PC-3 MTSS1Exp prostate cancer cells were seeded at a density of 50,000/well (in triplicate) into a 96-well plate that had been previously coated with 5 μg of Matrigel artificial basement membrane. The cells were then incubated for 45 min to allow them to adhere before being subjected to vigorous washing (x4) in BSS to remove the non-adherent cells. The adherent cells were then fixed in 4% formaldehyde (v/v) and stained with 0.5% (w/v) crystal violet. The number of stained adherent cells was counted in several random fields (≤40 objective magnifications).

The migratory properties of PC-3 and DU-145 cells were assessed to determine the impact of the forced expression or knockout of MTSS1 on the invasive nature of these prostate cancer cells. Cells at a density of 10⁶ were incubated in 10 ml of growth medium containing 100 μl of Cytodex-2 beads (GE Healthcare, Cardiff, UK) for 3 h to allow the cells to adhere to the beads. The beads were then washed to remove non-adherent or dead cells and resuspended in 5 ml of medium. The cell/bead complex was then incubated in a 96-well plate overnight. Following incubation, the cells were washed with BSS, and cells that had migrated from the Cytodex-2 beads and adhered to the base of the well were fixed in 4% formaldehyde (v/v), stained with 0.5% crystal violet (w/v) and counted under x40 objective magnification. At least five random fields were counted per well, and five duplicate wells were set up per sample. The entire experimental procedure was repeated three independent times.

All in vitro experimentation was repeated at least three independent times. The results were assessed using a two-sample, two-tailed t-test and the Minitab 14 statistical package. The values presented represent the mean ± SEM, and p≤0.05 was considered statistically significant. In vivo data were analysed using a non-parametric Mann-Whitney test, as the data did not follow a normal distribution.

MTSS1 was found to be highly expressed in the DU-145 and 3T3 prostate cancer cells and at moderate levels in the CA-HPV-10 prostate and ZR 75-1 breast cancer cells, while the highly invasive prostate cancer cell line PC-3 showed little expression (Fig. 1A). The highly invasive PC-3 prostate cancer cell line was transfected with the MTSS1 expression vector. Following selection, an MTSS1-overexpressing subline was established (Fig. 1B–D). The DU-145 prostate cancer cell line was also an appropriate candidate for knockdown as the low-invasive cell line expressed levels of MTSS1. Anti-MTSS1 trangenes were used to knockdown MTSS1 expression in the DU-145 cells, followed by the establishment of a new subline which expressed a low level of MTSS1 (Fig. 1B and C).

Knockdown of MTSS1 expression increases prostate cancer cell growth. This study found that the levels of MTSS1 protein had an effect on the growth rate of cells. The effects of the suppression of MTSS1 expression on the growth of DU-145 cells was examined following a 5-day incubation period using an in vitro cell growth assay. There was a significant difference in the cell growth rate between the wild-type (DU-145 WT) and MTSS1-suppressed (DU-145 MTSSIKD) cells. Suppression of MTSS1 expression was found to increase the cell growth rate (DU-145 MTSSIKD compared to DU-145 WT cells; p=0.001) (Fig. 2A).

Enhanced MTSS1 expression suppresses prostate cancer cell growth. The growth capacity of the prostate cancer cells following MTSS1 overexpression was examined and compared to the wild-type cells using an in vitro cell growth assay for PC-3 cell lines. A significant reduction in cell growth after 5 days following enhancement of MTSS1 expression was noted (PC-3 MTSS1Exp when compared to PC-3 WT cells; p=0.002) (Fig. 2B).

To identify and examine the adhesive nature of the prostate cancer cells to attach to a basement membrane, an adhesion assay was carried out (Fig. 3). The results obtained show a significant increase (DU-145 MTSSIKD compared to DU-145 WT cells; p=0.001) in the ability to adhere to a basement membrane (Fig. 3A, top panel), indicating that the knockdown of MTSS1 expression in this cell line resulted in a dramatic increase in the degree of adhesion. However, a significant reduction (p=0.0001) in adhesive ability was noted when PC-3 MTSS1Exp cells were compared to PC-3 WT cells (Fig. 3A, bottom panel).

The results revealed that the presence of MTSS1 had a significant impact on the motile nature of the prostate cancer cells (Fig. 3B). A significant increase (p=0.0001) was observed in motility between the DU-145 MTSSIKD and DU-145 WT cells (Fig. 3B, top panel). However, forced expression of MTSS1 in the PC-3 cell line resulted in a dramatic reduction in the degree of motility (PC-3 MTSS1Exp compared to PC-3 WT cells; p=0.002) (Fig. 3B, bottom).

The DU-145 prostate cancer cells demonstrated motile properties in the wound closure motility assay; however, the absence of MTSS1 expression in these cells significantly increased cell migration to close the wound as compared to the DU-145 WT cells (p=0.001) (Fig. 4A). As shown in Fig. 4B, the presence of MTSS1 expression in the PC-3 MTSS1Exp cells significantly suppressed cell migration when compared to the extent of cell migration in the PC-3 WT cells (p=0.01).