OL Oncology Letters 1792-1074 1792-1082 D.A. Spandidos 10.3892/ol.2023.13926 OL-26-2-13926 Articles MicroRNA expression profiles associated with the metastatic ability of MDA‑MB‑231 breast cancer cells PhannasilPhatchariya 1 AkekawatchaiChareeporn 2 JitrapakdeeSarawut 3 Thalassemia Research Center, Institute of Molecular Biosciences, Mahidol University, Nakhon Pathom 73170, Thailand Department of Medical Technology, Faculty of Allied Health Sciences, Thammasat University, Pathumtani 12121, Thailand Department of Biochemistry, Faculty of Science, Mahidol University, Bangkok 10400, Thailand Correspondence to: Dr Phatchariya Phannasil, Thalassemia Research Center, Institute of Molecular Biosciences, Mahidol University, 25/25 Phuttamonthon 4 Road, Salaya, Nakhon Pathom 73170, Thailand, E-mail: phatchariya.pha@mahidol.edu 08 2023 22 06 2023 26 2 339 17022023 18052023 Copyright: © Phannasil et al. 2023 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Breast cancer is an important worldwide public health concern. The incidence rate of breast cancer increases every year. The primary cause of death is metastasis, a process by which cancer cells spread from a primary site to secondary organs. MicroRNAs (miRs/miRNAs) are small non-coding RNAs that control gene expression at the post-transcriptional level. Dysregulation of certain miRNAs is involved in carcinogenesis, cancer cell proliferation and metastasis. Therefore, the present study assessed miRNAs associated with breast cancer metastasis using two breast cancer cell lines, the low-metastatic MCF-7 and the highly metastatic MDA-MB-231. miRNA array analysis of both cell lines indicated that 46 miRNAs were differentially expressed when compared between the two cell lines. A total of 16 miRNAs were upregulated in MDA-MB-231 compared with MCF-7 cells, which suggested that their expression levels may be associated with the highly invasive phenotype of MDA-MB-231 cells. Among these miRNAs, miR-222-3p was selected for further study and its expression was confirmed by reverse transcription-quantitative PCR (RT-qPCR). Under both non-adherent and adherent culture conditions, the expression levels of miR-222-3p in the MDA-MB-231 cell line were higher than those noted in the MCF-7 cell line under the same conditions. Suppression of endogenous miR-222-3p expression in MDA-MB-231 cells using a miR-222-3p inhibitor resulted in a 20–40% reduction in proliferation, and a ~30% reduction in migration, which suggested that the aggressive phenotype of MDA-MB-231 cells was partly regulated by miR-222-3p. Bioinformatic analysis of miR-222-3p using TargetScan 8.0, miRDB and PicTar identified 25 common mRNA targets, such as cyclin-dependent kinase inhibitor 1B, ADP-ribosylation factor 4, iroquois homeobox 5 and Bcl2 modifying factor. The results of the present study indicated that miR-222-3p was potentially associated with the proliferation and migratory ability of the MDA-MB-231 cell line.

 breast cancer metastasis miRNA Mahidol University A42/2562 Institute of Molecular Biosciences This research project was supported by Mahidol University (grant no. A42/2562) and the Institute of Molecular Biosciences (matching fund). Introduction

Breast cancer is one of the most common invasive cancers among women and has a high mortality rate. Globally, 2.3 million women were diagnosed with breast cancer in 2020, and 685,000 deaths were reported due to breast cancer (1). Breast cancer is classified into four subtypes based on the expression of the estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor 2 (HER2). These four subtypes include luminal A (ER+/PR+/HER2−), luminal B (ER+/PR+/HER2+ or ER+/PR+/HER2−), HER2 (ER−/PR−/HER2+), and triple negative breast cancer (TNBC) or basal-like (ER−/PR−/HER2−) breast cancer. These subtypes possess different abilities to metastasize to the distal organs, with luminal A having the longest survival time followed by luminal B, HER2, and TNBC, respectively (2). Remarkably, TNBC accounts for 10–20% of all cases (3) and is associated with high metastasis, which leads to poor prognosis and high mortality (4). Patients with the TNBC subtype do not respond well to hormonal therapies, such as HER2-targeted therapy (3), which is a significant challenge for the successful treatment of patients with TNBC. Therefore, the development of novel biomarkers for the identification of the TNBC subtype is crucial.

The two breast cancer cell lines, MCF-7 and MDA-MB-231 have been well characterized for their low and high metastatic phenotypes, respectively. The MCF-7 cell line represents the luminal A subtype, while the MDA-MB-231 cell line represents the TNBC subtype (5). The MCF-7 cell line can form only the primary tumor and can be suppressed following treatment by tamoxifen, an ER antagonist, while the MDA-MB-231 cell line can induce metastasis and is resistant to tamoxifen (5).

MicroRNAs (miRs/miRNAs) are small non-coding RNAs (snRNA) 18–22 nucleotides in length, which regulate several biological processes in tumorigenesis including proliferation, stress response, cell adhesion, motility and apoptosis (6). Previous studies have reported aberrant expression of certain miRNAs in TNBC. For example, Fang et al (7) reported that miR-21 was upregulated in MDA-MB-468 cells and that it supported proliferation and invasion. Similarly, miR-25-3p has been reported to be overexpressed in TNBC where it promotes proliferation both in vitro and in vivo (8). Previous studies have also reported that elevated expression of miR-93 (9) and miR-455-3p (10) induced proliferation, invasion and metastasis in TNBC. Downregulation of certain miRNAs has also been reported in TNBC; they have been demonstrated to regulate proliferation, migration and invasion in TNBC (6). These data support the roles of miRNAs in maintaining the invasive phenotype of TNBC and therefore hold promise for their potential application as diagnostic and prognostic biomarkers.

A previous study indicated that miR-222 expression was elevated in breast cancer tissues compared with that of normal tissues, which suggested that it could be a promising biomarker for breast cancer diagnosis (11). miR-222 expression in breast cancer tissues exhibited prognostic significance in lymph node (LN) negative breast cancer, which suggested that it could be used as a differential biomarker between LN negative and positive patients (12). Although miR-222 was highly expressed in breast cancer tissues, it remains unclear whether this miRNA is highly expressed in TNBC. The present study aimed to study miRNAs associated with breast cancer metastasis using two breast cancer cell lines, the low-metastatic MCF-7 cell line and the highly metastatic MDA-MB-231 cell line. The expression of one candidate miRNA, miR-222-3p, was validated. Suppression of miR-222-3p expression was performed to study its roles in MDA-MB-213 cells. The data indicated the crucial roles of miR-222-3p in supporting growth and migration in TNBC.

 Materials and methods <sec> <title>Cell culture

The breast cancer MCF-7 (HTB22; American Type Culture Collection) and MDA-MB-231 (HTB26; American Type Culture Collection) cell lines were cultured in DMEM high glucose (HyClone™; Cytiva) supplemented with 10% (v/v) FBS (Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin at 37°C, in the presence of 5% CO2. For the anoikis resistance assay, 700 µl of 20 mg/ml poly-2-hydroxyethyl methacrylate (polyHEMA) diluted in 95% ethanol was applied to a 6-well plate and dried for 2 days. Breast cancer cells were plated (5×105 cells/well for MCF-7 and 1×106 cells/well for MDA-MB-231) in a polyHEMA-coated 6-well plate.

 RNA extraction, complementary DNA (cDNA) synthesis and miRNA array

RNA was extracted from the adherent and anoikis-resistant MCF-7 and MDA-MB-231 cells using TRIzol® reagent according to the manufacturer's protocol (Invitrogen; Thermo Fisher Scientific, Inc.). A total of 200 ng RNA from each cell line was used to synthesize cDNA using the miRCURY LNA RT Kit (cat. no. 339340; Qiagen, Inc.) according to the manufacturer's protocol. To determine the miRNA expression profiles, an miRNA array was performed using miRCURY LNA miRNA focus panel (cat. no. 339325; Qiagen, Inc.) coated with specific primers for 84 miRNAs associated with cancer. The miRNA target sequences are presented in Table SI. The miRCURY LNA SYBR Green PCR Kit(cat no. 339345; Qiagen, Inc.) was used for qPCR reactions. The 96-well plate of the miRNA array was subjected to PCR using a real-time PCR machine. The PCR cycling conditions were: Initial heat activation at 95°C for 2 min, and 40 cycles of denaturation at 95°C for 10 sec and annealing/extension at 56°C for 60 sec. The relative expression was determined using the 2−∆∆Cq method (13).

 RT-qPCR

A candidate miRNA, miR-222-3p, from the miRNA array was assessed using RT-qPCR. RNA was extracted using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. A total of 100 ng RNA extracted from adherent or anoikis-resistant MCF-7 and MDA-MB-231 cultures was converted to cDNA using a TaqMan® Advanced MicroRNA Synthesis Kit (cat. no. A25576; Applied Biosystems; Thermo Fisher Scientific, Inc.). cDNA synthesis was performed using four steps, including Poly (A) tailing, adaptor ligation, RT and cDNA amplification reactions, according to the manufacturer's protocol. The expression levels of miR-222-3p were determined by qPCR using TaqMan Advanced MicroRNA Assays (miR-222-3p, cat. no. A25576; Applied Biosystems; Thermo Fisher Scientific, Inc.) containing forward and reverse primers and probes in a single tube and TaqMan® Fast Advanced Master Mix (cat. no. 4440038; Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The qPCR thermal conditions were: Uracil-N-glycosylase incubation at 50°C for 2 min and polymerase activation at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 60 sec. The relative expression was compared using the 2−ΔΔCq method (13) and U6 snRNA (cat. no. 4427975; Applied Biosystems; Thermo Fisher Scientific, Inc.) was used as the internal control. The miRNA sequences used in this experiment were as follows: Mature miRNA sequence of miR-222-3p, 5′-AGCUACAUCUGGCUACUGGGU-3′ (cat. no. A25576; Applied Biosystems; Thermo Fisher Scientific, Inc.); and U6 snRNA control sequence, 5′-GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT-3′ (cat. no. 4427975; Applied Biosystems; Thermo Fisher Scientific, Inc.). The forward and reverse primer sequences used in this experiment are proprietary information of Applied Biosystems; Thermo Fisher Scientific, Inc.

 Transfection of cells with the miR-222-3p inhibitor

A total of 2.5×105 MDA-MB-231 cells were plated in a 12-well plate and incubated at 37°C overnight, and 50 nM miR-222-3p inhibitor (cat. no. 339121; Qiagen, Inc.) or 50 nM negative control (cat. no. 339126; Qiagen, Inc.) was transfected into the cells using HiPerFect Transfection Reagent (cat. no. 301704, Qiagen, Inc.). The transfection was performed according to the manufacturer's protocol (Qiagen, Inc.). miR-222-3p inhibitor or negative control was diluted with 100 µl culture medium without serum. HiperFect transfection reagent (3 µl) was added, followed by mixing by vortexing. The mixtures were incubated at room temperature for 10 min to allow the formation of transfection complexes before addition to the cells. The plate was gently swirled to ensure uniform distribution of the transfection complexes. Then, the cells were incubated with the transfection complexes at 37°C for 48 h before use in further experiments. The negative control (cat. no. 339126; Qiagen, Inc.) used in this experiment was scramble-miRNA control (negative control A miRCURY LNA miRNA inhibitor control), which demonstrated no hits of >70% homology for any sequence in any organism in the NCBI (https://www.ncbi.nlm.nih.gov/) and miRBase (https://www.mirbase.org/) databases. The sequences of negative control and miR-222-3p inhibitor were 5′-TAACACGTCTATACGCCCA-3′ and 5′-CCCAGTAGCCAGATGTAGC-3′, respectively. To confirm miR-222-3p inhibition, qPCR was performed at 48 h post-transfection. The relative expression levels of miR-222-3p were compared between the miR-222-3p inhibitor and scramble control transfected cells. The expression levels of miR-222-3p of miRNA inhibitor-transfected cells were relative to those of the scramble control cells. The expression levels of the scramble control cells were set as 100%.

 Trypan blue exclusion assay

The transfected cells were collected at 48 h post-transfection and re-plated (100,000 cells/well) into 12-well plates for 5 days. The cells were incubated at 37°C in a 5% CO2 incubator and counted at days 1, 2, 3, 4 and 5. At each time point, the cells were trypsinized using 0.25% Trypsin-EDTA (Gibco; Thermo Fisher Scientific, Inc.) at 37°C for 3 min and resuspended with 900 µl culture media. Cell suspension (100 µl) was mixed with 100 µl 0.4% trypan blue (Gibco; Thermo Fisher Scientific, Inc.) to obtain a 1:2 dilution. The mixture was incubated at room temperature for 5 min to allow the trypan blue to stain the dead cells. Subsequently, the cells were counted using a hemocytometer under a light microscope. The results are presented as the mean cell density (cells/ml) ± SD.

 Migration assay

The migration assay was performed using Transwell inserts (6.5 mm diameter, polyvinylpyrrolidone-free polycarbonate filters with 8 µm pore size; Corning, Inc.). A total of 1.2×105 cells were re-suspended in 200 µl serum-free DMEM and plated into the upper chamber of the Transwell insert. A total of 600 µl DMEM supplemented with 10% (v/v) FBS (Gibco; Thermo Fisher Scientific, Inc.) was added to the lower chamber to induce cell migration. Following 6 h of incubation at 37°C, the migrated cells were fixed using 4% paraformaldehyde in 1X PBS at room temperature for 20 min and stained using 0.5% crystal violet in 25% methanol as previously described (14). The number of migrated cells was counted in 5 different randomly selected fields of view under a light microscope, and the numbers in the miR-222-3p knockdown and scrambled control groups were compared. The data are presented as the mean ± standard deviation (miR-222-3p knockdown cells vs. scrambled control cells).

 miRNA target prediction

The mRNA targets of miR-222-3p were predicted using three programs, including TargetScan 8.0 (15), miRDB (16) and PicTar (17). The total context++ score was calculated using TargetScan 8.0 (15,18), and the mRNA targets were ranked from the lowest to the highest total context++ score (Table SII).

 Statistical analysis

The results were obtained from two independent experiments, each in duplicate. All values are presented as mean ± standard deviation. The statistical analysis was performed using unpaired Student's t-test, Mann-Whitney test and one-way ANOVA followed by Tukey's multiple comparison test. Statistical analysis was performed using GraphPad Prism version 5.0 software (Dotmatics). P<0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Differential miRNA expression profiles in MCF-7 and MDA-MB-231 cell lines

To determine the miRNA expression profiles associated with the invasive phenotype, an miRNA array was used to assess the MCF-7 and MDA-MB-231 breast cancer cell lines. Due to the different characteristics of the two cell lines, notably the degree of metastatic potential, it was hypothesized that miRNAs involved in metastasis would be highly expressed in MDA-MB-231 cells. A total of 46 miRNAs were demonstrated to be differentially expressed between these two cell lines. A total of 16 miRNAs were upregulated and 30 miRNAs were downregulated in MDA-MB-231 cells compared with MCF-7 cells (Fig. 1). Details of the upregulated and downregulated miRNAs are presented in Tables I and II, respectively.

 Expression levels of miR-222-3p are upregulated in MDA-MB-231 breast cancer cells

Based on the miRNA array, there were 16 upregulated miRNAs in highly metastatic MDA-MB-231 cells compared with low-metastatic MCF-7 cells, indicating that these miRNAs may be associated with breast cancer metastasis (Table I). One candidate miRNA, miR-222-3p, was validated in the present study. The miRNA array results indicated that the miRNA expression levels of miR-222-3p were upregulated in the MDA-MB-231 cell line; the levels were ~15-fold higher than those noted in the MCF-7 cell line. Therefore, miR-222-3p may be associated with the invasive phenotype of MDA-MB-231 cells. The miRNA expression levels of miR-222-3p were further assessed in MDA-MB-231 and MCF-7 cell lines using RT-qPCR. The miR-222-3p expression levels in MDA-MB-231 cells were 250-fold higher than those demonstrated in MCF-7 cells (Fig. 2E). The expression levels of miR-222-3p were also determined under anoikis resistance conditions. The anoikis-resistant cells were generated to mimic the phenotype of those cancer cells which survive following detachment from the primary site and remain in the circulation. MCF-7 and MDA-MB-231 cells were cultured in an anti-adhesive polymer (polyHEMA)-coated plate, which resulted in loss of cell attachment. The cells which survived and proliferated in an anchorage-independent manner were considered to be anoikis-resistant cells (19). The adherent MCF-7 and MDA-MB-231 cells had epithelial-like morphologies. MCF-7 cells formed a monolayer and their shape was dome-like (Fig. 2A) and MDA-MB-231 cells were spindle-shaped (long and thin) (Fig. 2B). The morphologies of MCF-7 and MDA-MB-231 anoikis-resistant cells were round with spheroid shape compared with their parental cell lines (Fig. 2C and D). Following two days of cell culture under anoikis conditions, the anoikis-resistant cells were collected to determine the expression levels of miR-222-3p. Under anoikis-resistance conditions, MDA-MB-231 cells expressed miR-222-3p at a similar level as that noted following cell culture under the adherent conditions (Fig. 2E). The mRNA targets of miR-222-3p were predicted using TargetScan 8.0 (15), miRDB (16) and PicTar (17). TargetScan 8.0, miRDB and PicTar predicted 254, 619, and 177 mRNA targets, respectively. A total of 25 mRNA targets were commonly identified by all three programs (Fig. S1). Certain of these 25 mRNA targets were associated with key proteins involved in cell proliferation and metastasis, such as cyclin-dependent kinase inhibitor 1B (CDKN1B), eukaryotic translation initiation factor 5A2 (EIF5A2), iroquois homeobox 5 (IRX5), ADP-ribosylation factor 4 (ARF4), Bcl2 modifying factor (BMF), and estrogen receptor 1 (ESR1). The 25 common mRNA targets ranked from the lowest to the highest total context++ score calculated using TargetScan 8.0 (15,18) are presented in Table SII.

 Suppression of miR-222-3p reduces proliferation in the MDA-MB-231 breast cancer cell line

The miRNA expression levels of miR-222-3p were elevated in the MDA-MB-231 cell line compared with those of the MCF-7 cell line (Fig. 2E). This miRNA may contribute to the proliferative ability of MDA-MB-231 cells. Therefore, the present study assessed whether the suppression of miR-222-3p expression in MDA-MB-231 cells affected their proliferation. Transfection of the cells with the miR-222-3p inhibitor markedly reduced the expression levels of miR-222-3p by 94% (Fig. 3A). At 48 h post-transfection, the proliferative rate of miR-222-3p-knockdown MDA-MB-231 cells was assessed for 5 days. MDA-MB-231 cells transfected with the miR-222-3p inhibitor indicated a significant, 20–40%, reduction in cell viability from day 2 onward (Fig. 3B).

 Suppression of miR-222-3p reduces migration in highly metastatic breast cancer MDA-MB-231 cells

As the miRNA expression levels of miR-222-3p were elevated in MDA-MB-231 cells, it was hypothesized that this miRNA may be involved in the migratory ability of this cell line. Endogenous miR-222-3p expression in MDA-MB-231 cells was suppressed using a miR-222-3p inhibitor. At 48 h post-transfection, miR-222-3p-knockdown-MDA-MB-231 cells demonstrated a significant, 30% reduction in migration (Fig. 4).

 Discussion

miRNAs serve a crucial role in tumorigenesis including proliferation, stress responses, cell adhesion, motility and apoptosis (6). numerous miRNAs have been reported to regulate metastasis in certain types of human cancer (20). In the present study, miRNA expression profiles were assessed in the highly metastatic MDA-MB-231 cells and compared with those in the low-metastatic MCF-7 cells. A total of 16 miRNAs were highly expressed in the highly metastatic MDA-MB-231 cell line; however, their expression levels were low in the MCF-7 cell line, which suggested that these miRNAs may be associated with the aggressive breast cancer phenotype. A total of 30 miRNAs were downregulated in MDA-MB-231 cells compared with MCF-7 cells. From the miRNA expression profiles, these miRNAs could be considered as biomarkers for metastatic breast cancer in the future. However, further studies are required to validate the expression of these candidate miRNAs in breast cancer cell lines and samples from patients with different stages of breast cancer.

miR-221/222 has been previously reported to be an onco-miR or a tumor suppressor miRNA, depending on the cellular context (21). miR-222 has been reported as an onco-miR in gastric cancer, bladder cancer, lung cancer, colorectal cancer, cervical cancer and ovarian cancer; whereas, it has been reported to act as a tumor suppressor miRNA in tongue squamous cell carcinoma (TSCC), colorectal cancer, and ovarian cancer (21). The onco-miRs regulate tumor suppressor genes to promote cancer development, while the tumor suppressor miRNAs target oncogenes to inhibit cancer progression (22). In oral TSCC (OTSCC), miR-222 serves a role as a tumor suppressor miRNA, which inhibits OTSCC cell invasion by regulating matrix metalloproteinase 1 (MMP1) expression. This is mediated by the targeting of MMP1 mRNA and indirectly controlling its gene expression via the targeting of manganese superoxide dismutase 2 (23). miR-222 serves oncogenic roles in gastric cancer. Upregulation of miR-222 induces the cell proliferation and invasion of the gastric cancer cell line SGC7901, whereas suppression of miR-222 reverses these phenotypes via induction of PTEN, a direct target of miR-222 (24). In colorectal cancer, miR-222 directly targets a disintegrin and metalloprotease 17, which is downregulated in multidrug-resistant colorectal cancer cells and increases cancer cell apoptosis (25). In contrast to these reports, miR-222 acts as an onco-miRNA in colorectal cancer cells by the direct targeting of mammalian Ste20-like protein kinase 3 (26), and MIA SH3 domain ER export factor 3 (27) to promote cancer cell migration and invasion.

The association of miR-222 and breast cancer has not been clearly elucidated. A limited number of studies that examined the expression of miR-222 in breast cancer have reported the roles of miR-222 to be coupled with miR-221. Li et al (28) reported that the miRNA expression levels of miR-221/222 were elevated in cisplatin-resistant MDA-MB-231 cells and in patients with cisplatin-resistant breast cancer. Suppression of miR-221/222 in MDA-MB-231 cells increased their sensitivity to cisplatin in vitro and induced apoptosis, which suggested that the combination of anti-miR-221 and anti-miR-222 produced the synergistic effects noted following cisplatin treatment (28). Therefore, the present study further evaluated the expression and functions of miR-222.

The miRNA array results indicated that miR-222-3p expression was upregulated in MDA-MB-231 compared with MCF-7 cells. The results from RT-qPCR analysis were consistent with the miRNA array results, which indicated that miR-222 was expressed at higher levels in MDA-MB-231 compared with MCF-7 cells. A previous study also reported that miR-222 expression was upregulated in breast cancer tissues compared with those in non-cancerous breast tissues (11). Moreover, miR-222-3p expression was previously reported to be elevated in the sera of patients with breast cancer, which suggested that it could be used as a non-invasive biomarker for human breast cancer. However, this miRNA cannot be used as a biomarker to differentiate between early stage and advanced stage breast cancer because the subjects of the previous study were only from stages II and III of the disease; in addition, the expression level of miR-222-3p was not significantly different between stage II and stage III tumors (29). The results of the present study, that a higher expression level of miR-222-3p was detected in invasive breast cancer cells, were in line with a previous report that the miR-222 level was elevated in patients with breast cancer with lymphatic metastasis (30). It should be noted that the present study indicated that miR-222-3p expression was significantly higher in MDA-MB-231 cells, which represented the highly metastatic model of breast cancer, compared with the corresponding levels demonstrated in the non-metastatic MCF-7 cells. This indicated the potential of miR-222-3p as a prognostic biomarker for breast cancer metastasis. The present study further examined other functions of this miRNA, including in anoikis-resistance, proliferation and migration in the highly metastatic MDA-MB-231 breast cancer cell line. Inhibition of miR-222-3p in MDA-MB-231 cells suppressed the high proliferation and migration, which are related to breast cancer metastasis. Numerous miRNAs have been reported to promote or suppress anoikis in certain types of cancer. miR-31, miR-220b and miR-200c have been previously reported to enhance anoikis, while miR-181a promotes anoikis-resistance in breast cancer (31). miR-141 has been reported to promote anoikis resistance in ovarian cancer cells and was highly expressed in anchorage-independent ovarian cancer cell lines compared with anchorage-dependent cells (32). However, the results of the present study demonstrated that the expression levels of miR-222-3p in MDA-MB-231 cells under anoikis-resistance condition were not higher than those in the adherent MDA-MB-231 cells. Similarly, the levels of miR-222-3p in anoikis-resistant MCF-7 cells were not higher than those in the adherent MCF-7 cells. These results indicated that miR-222-3p was not associated with the anoikis resistance of breast cancer.

Due to the high miRNA expression level of miR-222 in patients with breast cancer and lymphatic metastasis and in the MDA-MB-231 cell line, this miRNA may serve crucial roles in cell proliferation and motility, which are the pre-requisites for cancer progression. The present study demonstrated that proliferation of miR-222-3p knockdown cells was suppressed by 20–40%, which indicated that this miRNA supported the proliferative ability of MDA-MB-231 cells. Moreover, suppression of miR-222-3p inhibited the migratory ability of MDA-MB-231 cells by ~30%, which indicated that this miRNA induced the migration of MDA-MB-231 cells. The migratory results correlated with those of a previous study on the function of exosomal miR-222, which reported that suppression of miR-222 reduced the migratory ability of MDA-MB-231 cells (30). The study also reported the decreased invasive ability of miR-222 knockdown MDA-MB-231 cells (30). The present study demonstrated the role of miR-222-3p in supporting cancer cell proliferation and to a lesser extent migration. The increased expression of miR-222-3p in the highly metastatic breast cancer cell line may also support other breast cancer phenotypes, such as chemoresistance. According to the functions of this miRNA in cell proliferation and migration in breast cancer, the mRNA targets of miR-222-3p were predicted using bioinformatics analysis (Fig. S1); however, these require validation in future studies. Some of the 25 mRNA targets were reported to be involved in cell proliferation and metastasis in cancer. For example, CDKN1B/p27 has been reported as the target of miR-221 which functions as an oncogenic miRNA in hepatocarcinogenesis by promoting cell proliferation and regulating the expression of cell-cycle inhibitors (33). In addition, the EIF5A2 gene has been reported as a direct target of miR-221-3p and its expression level was decreased in medulloblastoma cell lines (34). Overexpression of miR-221-3p in these cell lines reduced their proliferation (34). The suppressive effect of miR-221-3p on cell proliferation was reported to be alleviated by the restoration of EIF5A2 in miR-221-3p-overexpressing DAOY cells (34). Aberrant expression of IRX5 was previously reported in TSCC tissues and cell lines. Overexpression of IRX5 promoted proliferation, migration, and invasion of TSCC cells, whereas knockdown of IRX5 expression caused the opposite effects (35). BMF was reported as a target regulated by miR-221 using the dual-luciferase reporter gene assay. The inhibition of miR-221 expression significantly increased BMF expression in ovarian cancer SKOV3 cells, accompanied by decreased cell proliferation and increased cell apoptosis (36). ESR1 has been reported as the target of miR-222/221 and its expression levels were reported to be markedly higher in ESR1 negative breast cancer cells. In clinical samples, miR-222 expression was reported only in TNBC, whereas miR-222 was absent in luminal A breast cancer, which indicated that this miRNA acted cooperatively to decrease ERα expression (37). ARF4 is one of the putative targets of miR-221-3p. Overexpression of miR-221-3p inhibited the proliferation and migration of epithelial ovarian cancer (EOC) cells in vitro. The negative correlation between ARF4 and miR-221-3p levels was previously reported in EOC specimens, which suggested that the tumor suppressive role of miR-221-3p in EOC may be via the direct targeting of ARF4 (38).

The analysis of additional upregulated miRNAs demonstrated upregulation of miR-100-5p and 146a-5p in MDA-MB-231 cells compared with the corresponding miRNA expression levels demonstrated in MCF-7 cells. Elevated miRNA expression levels of miR-100-5p in post-neoadjuvant chemotherapy samples was reported to be significantly correlated with improved event-free survival and overall survival compared with the effects noted in normal samples or samples with lower miRNA expression levels (39), which suggested its potential application as a biomarker for predicting the outcome in patients with early breast cancer. High miRNA expression levels of miR-100-5p in insulin-like growth factor binding protein 6-knockdown MDA-MB-231 cells were reported to be correlated with the decrease of insulin receptor and cyclin D1 genes which were associated with the insulin-like growth factor signaling pathway and the proliferative and migratory activity during the metastatic cascade in breast cancer (40). Upregulation of miR-146a-5p expression modulated by the methyltransferase 14, N6-adenosine-methyltransferase subunit promoted cell migration and invasion by breast cancer cells (41). Downregulation of miR-130a-3p was previously evaluated in TNBC cells and was compared with the expression noted in normal cells (42), while the present study showed that miR-130a-3p expression was upregulated in TNBC MDA-MB-231 cells compared with the MCF-7 luminal A subtype cells (ER+/PR+/HER2−). Overexpression of miR-130a-3p was reported to reduce the proliferation, anchorage-independent growth and migratory activity by downregulating the Wnt signaling cascade in TNBC cells (42). Therefore, the function of miR-130a-3p warrants further evaluation.

With regard to the downregulated miRNAs, the present study identified certain downregulated miRNAs, including miR-141-3p and miR-205-5p, which have been reported to be associated with pathogenic roles in previous studies. The expression levels of miR-141-3p were downregulated in breast cancer compared with the corresponding levels noted in adjacent non-tumor tissues (43). Overexpression of miR-141-3p has been reported to inhibit cell proliferation, migration and invasion in MCF-7 and MDA-MB-231 cells (43). The expression of miR-205-5p was also reported to be downregulated in breast cancer compared with normal breast tissues. miR-205-5p exhibited tumor suppressive functions by inhibiting tumor growth and metastasis in breast cancer (44). miR-205-5p was expressed at the lowest level in TNBCs compared with other subtypes (44). A limitation of the present study was the limited number of miRNAs detected on the miRNA array, additional miRNAs that are involved in cancer metastasis may not have been detected by the miRNA array used in the present study.

In summary, the present study indicated that miR-222-3p expression was upregulated in the highly metastatic breast cancer MDA-MB-231 cell line, suggesting that this miRNA may be considered as a potential biomarker of metastatic breast cancer in the future. Suppression of miR-222-3p lowered proliferation and the migratory ability of MDA-MB-231 cells, which highlighted the possible roles of miR-222-3p in supporting these processes during cancer progression in high metastatic breast cancer. The present study provided miRNA profiles that require further evaluation for the determination of their functions in MDA-MB-231 cells.

 Supplementary Material Supporting Data Supporting Data Acknowledgements

The authors would like to thank Professor Shaun R. McColl (University of Adelaide, Adelaide, South Australia) for providing the cell lines used in the present study. The authors would also like to thank Professor Saovaros Svasti (Head of Thalassemia Research Center, Institute of Molecular Biosciences, Mahidol University, Nakhon Pathom, Thailand)for her general support for this project.

 Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

 Authors' contributions

PP designed and performed the experiments and drafted the manuscript. CA provided suggestions regarding the experimental design and data interpretation, discussed the results and edited the manuscript. SJ contributed to the conception, design of the works, provided advice and suggestions, and edited the manuscript for important intellectual content. PP and CA confirm the authenticity of all the raw data. All authors read and approved the final manuscript.

 Ethics approval and consent to participate

Not applicable.

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 Abbreviations miR/miRNA

microRNA

 MCF-7

Michigan Cancer Foundation-7

 MDA-MB-231

M.D. Anderson-Metastatic Breast 231

 TNBC

triple-negative breast cancer

 PR

progesterone receptor

 ER

estrogen receptor

 HER2

human epidermal growth factor receptor 2

 polyHEMA

poly-2-hydroxyethyl methacrylate

 LN

lymph node

 cDNA

complementary DNA

 RT-qPCR

reverse transcription-quantitative PCR

 CDKN1B

cyclin-dependent kinase inhibitor 1B

 EIF5A2

eukaryotic translation initiation factor 5A2

 IRX5

iroquois homeobox 5

 ARF4

ADP-ribosylation factor 4

 BMF

Bcl2 modifying factor

 ESR1

estrogen receptor 1

 has

Homo sapiens

 TSCC

tongue squamous cell carcinoma

 OTSCC

oral tongue squamous cell carcinoma

 MMP1

matrix metallo-proteinase 1

 EOC

epithelial ovarian cancer

 References Breast cancerWorld Health Organization2021[updated 26 March 2021]. Available from:https://www.who.int/news-room/fact-sheets/detail/breast-cancer KenneckeHYerushalmiRWoodsRCheangMCUVoducDSpeersCHNielsenTOGelmonKMetastatic behavior of breast cancer subtypesJ Clin Oncol2832713277201010.1200/JCO.2009.25.982020498394 Al-MahmoodSSapiezynskiJGarbuzenkoOBMinkoTMetastatic and triple-negative breast cancer: Challenges and treatment optionsDrug Deliv Transl Res814831507201810.1007/s13346-018-0551-329978332 MayerIAAbramsonVGLehmannBDPietenpolJANew strategies for triple-negative breast cancer-deciphering the heterogeneityClin Cancer Res20782790201410.1158/1078-0432.CCR-13-058324536073 HollidayDLSpeirsVChoosing the right cell line for breast cancer researchBreast Cancer Res13215201110.1186/bcr288921884641 XuJWuKJJiaQJDingXFRoles of miRNA and lncRNA in triple-negative breast cancerJ Zhejiang Univ Sci B21673689202010.1631/jzus.B190070932893525 FangHXieJZhangMZhaoZWanYYaoYmiRNA-21 promotes proliferation and invasion of triple-negative breast cancer cells through targeting PTENAm J Transl Res9953961201728386324 ChenHPanHQianYZhouWLiuXMiR-25-3p promotes the proliferation of triple negative breast cancer by targeting BTG2Mol Cancer174201810.1186/s12943-017-0754-029310680 HuJXuJWuYChenQZhengWLuXZhouCJiaoDIdentification of microRNA-93 as a functional dysregulated miRNA in triple-negative breast cancerTumour Biol36251258201510.1007/s13277-014-2611-825238878 LiZMengQPanAWuXCuiJWangYLiLMicroRNA-455-3p promotes invasion and migration in triple negative breast cancer by targeting tumor suppressor EI24Oncotarget81945519466201710.18632/oncotarget.1430728038450 AminiSAbakAEstiarMAMontazeriVAbhariASakhiniaEExpression analysis of MicroRNA-222 in breast cancerClin Lab64491496201810.7754/Clin.Lab.2017.17100229739090 FalkenbergNAnastasovNRapplKBraselmannHAuerGWalchAHuberMHöfigISchmittMHöflerHMiR-221/-222 differentiate prognostic groups in advanced breast cancers and influence cell invasionBr J Cancer10927142723201310.1038/bjc.2013.62524129242 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.126211846609 PhannasilPThuwajitCWarnnissornMWallaceJCMacDonaldMJJitrapakdeeSPyruvate carboxylase is up-regulated in breast cancer and essential to support growth and invasion of MDA-MB-231 cellsPLoS One10e0129848201510.1371/journal.pone.012984826070193 McGearySELinKSShiCYPhamTMBisariaNKelleyGMBartelDPThe biochemical basis of microRNA targeting efficacyScience366eaav1741201910.1126/science.aav174131806698 ChenYWangXmiRDB: An online database for prediction of functional microRNA targetsNucleic Acids Res48D1D127D131202010.1093/nar/gkz75731504780 KrekAGrünDPoyMNWolfRRosenbergLEpsteinEJMacMenaminPDa PiedadeIGunsalusKCStoffelMRajewskyNCombinatorial microRNA target predictionsNat Genet37495500200510.1038/ng153615806104 AgarwalVBellGWNamJWBartelDPPredicting effective microRNA target sites in mammalian mRNAsElife4e05005201510.7554/eLife.0500526267216 AkekawatchaiCRoytrakulSKittisenachaiSIsarankura-Na-AyudhyaPJitrapakdeeSProtein profiles associated with anoikis resistance of metastatic MDA-MB-231 breast cancer cellsAsian Pac J Cancer Prev17581590201610.7314/APJCP.2016.17.2.58126925647 McGuireABrownJAKerinMJMetastatic breast cancer: The potential of miRNA for diagnosis and treatment monitoringCancer Metastasis Rev34145155201510.1007/s10555-015-9551-725721950 SongQAnQNiuBLuXZhangNCaoXRole of miR-221/222 in tumor development and the underlying mechanismJ Oncol20197252013201910.1155/2019/725201331929798 ZhangBPanXCobbGPAndersonTAmicroRNAs as oncogenes and tumor suppressorsDev Biol302112200710.1016/j.ydbio.2006.08.02816989803 LiuXYuJJiangLWangAShiFYeHZhouXMicroRNA-222 regulates cell invasion by targeting matrix metalloproteinase 1 (MMP1) and manganese superoxide dismutase 2 (SOD2) in tongue squamous cell carcinoma cell linesCancer Genomics Proteomics6131139200919487542 Chun-ZhiZLeiHAn-LingZYan-ChaoFXiaoYGuang-XiuWZhi-FanJPei-YuPQing-YuZChun-ShengKMicroRNA-221 and microRNA-222 regulate gastric carcinoma cell proliferation and radioresistance by targeting PTENBMC Cancer10367201010.1186/1471-2407-10-36720618998 XuKLiangXShenKSunLCuiDZhaoYTianJNiLLiuJMiR-222 modulates multidrug resistance in human colorectal carcinoma by down-regulating ADAM-17Exp Cell Res31821682177201210.1016/j.yexcr.2012.04.01422677042 LuoFZhouJWangSSunZHanQBaiCmicroRNA-222 promotes colorectal cancer cell migration and invasion by targeting MST3FEBS Open Bio9901913201910.1002/2211-5463.1262331034165 GaoHCongXZhouJGuanMMicroRNA-222 influences migration and invasion through MIA3 in colorectal cancerCancer Cell Int1778201710.1186/s12935-017-0447-128855850 LiSLiQLüJZhaoQLiDShenLWangZLiuJXieDChoWCTargeted inhibition of miR-221/222 promotes cell sensitivity to cisplatin in triple-negative breast cancer MDA-MB-231 cellsFront Genet101278202010.3389/fgene.2019.0127832010177 SaidMNMuawiaSHelalAFawzyAAllamRMShafikNFRegulation of CDK inhibitor p27 by microRNA 222 in breast cancer patientsExp Mol Pathol123104718202110.1016/j.yexmp.2021.10471834752733 DingJXuZZhangYTanCHuWWangMXuYTangJExosome-mediated miR-222 transferring: An insight into NF-κB-mediated breast cancer metastasisExp Cell Res369129138201810.1016/j.yexcr.2018.05.01429778754 MalagobadanSNagoorNHEvaluation of MicroRNAs regulating anoikis pathways and its therapeutic potentialBiomed Res Int2015716816201510.1155/2015/71681626587543 MakCSYungMMHuiLMLeungLLLiangRChenKLiuSSQinYLeungTHLeeKFMicroRNA-141 enhances anoikis resistance in metastatic progression of ovarian cancer through targeting KLF12/Sp1/survivin axisMol Cancer1611201710.1186/s12943-017-0582-228095864 FornariFGramantieriLFerracinMVeroneseASabbioniSCalinGAGraziGLGiovanniniCCroceCMBolondiLNegriniMMiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinomaOncogene2756515661200810.1038/onc.2008.17818521080 YangYCuiHWangXDownregulation of EIF5A2 by miR-221-3p inhibits cell proliferation, promotes cell cycle arrest and apoptosis in medulloblastoma cellsBiosci Biotechnol Biochem83400408201910.1080/09168451.2018.155360430551723 HuangLSongFSunHZhangLHuangCIRX5 promotes NF-κB signalling to increase proliferation, migration and invasion via OPN in tongue squamous cell carcinomaJ Cell Mol Med2238993910201810.1111/jcmm.1366429761910 XieXHuangYChenLWangJmiR-221 regulates proliferation and apoptosis of ovarian cancer cells by targeting BMFOncol Lett1666976704201830405811 CochraneDRCittellyDMHoweENSpoelstraNSMcKinseyELLaParaKEliasAYeeDRicherJKMicroRNAs link estrogen receptor alpha status and Dicer levels in breast cancerHorm Cancer1306319201010.1007/s12672-010-0043-521761362 WuQRenXZhangYFuXLiYPengYXiaoQLiTOuyangCHuYMiR-221-3p targets ARF4 and inhibits the proliferation and migration of epithelial ovarian cancer cellsBiochem Biophys Res Commun49711621170201810.1016/j.bbrc.2017.01.00228057486 FusoPDi SalvatoreMSantonocitoCGuarinoDAutilioCMulèAArciuoloDRinninellaAMignoneFRamundoMLet-7a-5p, miR-100-5p, miR-101-3p, and miR-199a-3p hyperexpression as potential predictive biomarkers in early breast cancer patientsJ Pers Med11816202110.3390/jpm1108081634442460 PoloznikovAANikulinSVRaigorodskayaMPFomichevaKAZakharovaGSMakarovaYAAlekseevBYChanges in the metastatic properties of MDA-MB-231 cells after IGFBP6 gene knockdown is associated with increased expression of miRNA genes controlling INSR, IGF1R, and CCND1 genesBull Exp Biol Med166641645201910.1007/s10517-019-04409-z30903488 YiDWangRShiXXuLYilihamuYSangJMETTL14 promotes the migration and invasion of breast cancer cells by modulating N6-methyladenosine and has-miR-146a-5p expressionOncol Rep4313751386202032323801 PoodinehJSirati-SabetMRajabibazlMMohammadi-YeganehSMiR-130a-3p blocks Wnt signaling cascade in the triple-negative breast cancer by targeting the key players at multiple pointsHeliyon6e05434202010.1016/j.heliyon.2020.e0543433225091 SunSMaJXiePWuZTianXHypoxia-responsive miR-141-3p is involved in the progression of breast cancer via mediating the HMGB1/HIF-1α signaling pathwayJ Gene Med22e3230202010.1002/jgm.323032436353 XiaoYHumphriesBYangCWangZMiR-205 dysregulations in breast cancer: The complexity and opportunitiesNoncoding RNA553201931752366

Scatter plot of miRNA expression profiles of the highly invasive breast cancer (MDA-MB-231) and comparison with the non-invasive breast cancer (MCF-7) cell line. miRNAs that showed 2-fold higher or lower expression in MDA-MB-231 cells compared with MCF-7 cells were defined as upregulated miRNAs (red dots) and downregulated miRNAs (green dots), respectively. Black dots indicate miRNAs with unchanged expression levels in MDA-MB-231 cells compared with MCF-7 cells. miRNA, microRNA.

Morphology and miR-222-3p expression of adherent and anoikis-resistant MCF-7 and MDA-MB-231 cells. Representative micrographs of adherent (A) MCF-7 and (B) MDA-MB-231 cells cultured in complete growth medium. The anoikis-resistant (C) MCF-7 and (D) MDA-MB-231 cells were cultured on a poly 2-hydroxyethyl methacrylate plate for two days under the same conditions as the adherent cells. Scale bar, 100 µm. (E) The miRNA expression levels of miR-222-3p in adherent MCF-7 and MDA-MB-231 cells, and anoikis-resistant MCF-7 and MDA-MB-231 cells assessed using reverse transcription-quantitative PCR. The Y-axis Expression levels of miR-222-3p were indicated relative to MCF-7 cells. The results are indicative of two independent experiments. **P<0.01. miR-222-3p expression was significantly higher in MDA-MB-231 cells under both adherent and anoikis-resistant conditions. miR/miRNA, microRNA; ns, not significant.

Suppression of miR-222-3p expression reduces proliferation of MDA-MB-231 cells. (A) miR-222-3p expression levels were assessed using reverse transcription-quantitative PCR two days post-transfection. (B) Suppression of miR-222-3p reduced the proliferative ability of MDA-MB-231 cells. MDA-MB-231 cells were transiently transfected with 50 nM miR-222-3p inhibitor or SC siRNA. A total of 2 days post-transfection, the transfected cells were re-plated and counted for 5 days. Data were obtained from two independent experiments, each in duplicate and are presented as mean ± SD. *P<0.05 and ***P<0.001 vs. SC. miR/miRNA, microRNA; SC, scrambled control.

Suppression of miR-222-3p in MDA-MB-231 cells reduces migration of MDA-MB-231 cells. MDA-MB-231 cells were transiently transfected with miR-222 inhibitor or SC. On 2 day-post transfection, the transfected cells were re-plated for use in the migration assay. (A) Representative images of the migrated miR-222-3p knockdown (miR-222 inhibitor) or scrambled control cells (control). (B) The number of migrated cells was counted in 5 different randomly selected fields of view and are presented as mean ± SD. The results were obtained from two independent experiments, each in duplicate. *P<0.05. miR/miRNA, microRNA; SC, scrambled control.

Up-regulated miRNAs in the highly invasive MDA-MB-231 breast cancer cell line compared with the non-invasive MCF-7 breast cancer cell line.

miRNA name Fold change
hsa-miR-100-5p 32.51
hsa-miR-106a-5p 2.19
hsa-miR-125b-5p 18.4
hsa-miR-130a-3p 47.45
hsa-miR-10b-5p 5.06
hsa-miR-146a-5p 42.31
hsa-miR-17-5p 2.11
hsa-miR-18a-5p 2.86
hsa-miR-10a-5p 4.83
hsa-miR-20a-5p 2.19
hsa-miR-221-3p 26.09
hsa-miR-222-3p 15.85
hsa-miR-29a-3p 10.22
hsa-miR-29b-3p 4.50
hsa-miR-29c-3p 6.16
hsa-miR-30c-5p 2.48

hsa, Homo sapiens; miR/miRNA, microRNA.

Down-regulated miRNAs in the highly invasive MDA-MB-231 breast cancer cell line compared with the non-invasive MCF-7 breast cancer cell line.

miRNA name Fold change
hsa-miR-200a-3p −23.78
hsa-let-7f-5p −2.29
hsa-miR-101-3p −4.57
hsa-miR-106b-5p −4.02
hsa-miR-126-3p −3.38
hsa-miR-141-3p −1,201.53
hsa-miR-145-5p −3.78
hsa-miR-26a-5p −2.66
hsa-miR-15a-5p −2.17
hsa-miR-149-3p −7.22
hsa-miR-16-5p −2.04
hsa-miR-182-5p −11.20
hsa-miR-191-5p −3.95
hsa-miR-192-5p −4.31
hsa-miR-148a-3p −2.58
hsa-miR-194-5p −6.19
hsa-miR-195-5p −21.28
hsa-miR-196a-5p −127.68
hsa-miR-200b-3p −16.14
hsa-miR-200c-3p −102.39
hsa-miR-205-5p −225.92
hsa-miR-21-5p −5.75
hsa-miR-215-5p −4.70
hsa-miR-25-3p −3.66
hsa-miR-26b-5p −4.28
hsa-miR-34a-5p −9.75
hsa-miR-7-5p −9.92
hsa-miR-9-5p −4.77
hsa-let-7e-5p −2.56
hsa-miR-93-5p −3.32

hsa, Homo sapiens; miR/miRNA, microRNA.