WASJ World Academy of Sciences Journal 2632-2900 2632-2919 D.A. Spandidos WASJ-5-4-00199 10.3892/wasj.2023.199 Articles Association of LPL and ADRB2 polymorphisms with the risk of developing hypertriglyceridemia ShakhanovaAizhan 1 AukenovNurlan 2 NurtazinaAlma 1 ZhumadilovaZauresh 1 MassabayevaMeruyert 1 KozhakhmetovaDana 1 Department of Internal Diseases and Rheumatology, Semey Medical University, Semey 071400, Kazakhstan Department of Health and Human Resources, Ministry of Health of the Republic of Kazakhstan, Astana 010000, Kazakhstan Correspondence to: Dr Aizhan Shakhanova, Department of Internal Diseases and Rheumatology, Semey Medical University, 103 Abay Kunanbayev Street, Semey 071400, Kazakhstan aizhanshakhanova@gmail.com doctortts@yahoo.com Jul-Aug 2023 07 08 2023 5 4 22 30 05 2023 31 07 2023 Copyright: © Shakhanova et al. 2020 This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, reproduction and adaptation in any medium and for any purpose provided that it is properly attributed. For attribution, the original author(s), title, publication source (PeerJ) and either DOI or URL of the article must be cited.

The measurement of lipid metabolism indicators is an integral part of the assessment and control of the risk of developing atherosclerosis and cardiovascular diseases. Triglyceride levels are of particular importance as they are the main component of fat cells. The objective of the present study was to determine the association between hypertriglyceridemia and the polymorphisms of genes of β2-adrenergic receptor (ADRB2) and lipoprotein lipase (LPL). The present study was a case-control study. A total of 460 subjects participated in the study. Plasma total cholesterol, triglyceride, high-density lipoprotein, low-density lipoprotein, apolipoprotein B and apolipoprotein A1 levels were examined in all subjects. Quantitative PCR was performed to detect the LPL rs328, ADRB2 rs1042714 gene polymorphisms, which were found to be previously associated with susceptibility to obesity-related phenotypes and dyslipidemia. The results revealed a significant association of the rs1042714 polymorphism of the ADRB2 gene with triglyceride levels (P=0.04). The C allele and the association of the C/C and C/G genotypes of the rs1042714 polymorphism of the ADBR2 gene were more frequent in individuals with elevated triglyceride levels compared with those with normal triglyceride levels. The G allele and the G/G genotype of the rs1042714 polymorphism of the ADBR2 gene were protective and were associated with a reduced risk of developing hypertriglyceridemia (odds ratio, 0.72; 95% CI, 0.52-0.98 P=0.038). The LPL rs328 alleles were not associated with a significantly increased risk of developing hypertriglyceridemia. On the whole, the findings of the present study indicated that the ADRB2 rs1042714 allele G was associated with a decreased risk of developing hypertriglyceridemia. Polymorphisms of the LPL rs328 gene were not associated with hypertriglyceridemia and haplotype combinations were not associated with hypertriglyceridemia.

 LPL Ser447Ter (rs328) gene polymorphism ADRB2 Gln27Glu (rs1042714) gene polymorphism hypertriglyceridemia Funding: The present study was supported as part of an intra-university startup project of NCJSC ‘Medical University of Semey’. The Ministry of Healthcare of the Republic of Kazakhstan (grant no. ID0118РКИ0541) ‘Development of markers for predicting the risk of metabolic syndrome development in the Kazakh population’. Introduction

The diagnosis of lipid metabolism is part of the assessment and control of the risk of atherosclerosis and cardiovascular diseases (CVD); in this context, levels of triglycerides are of particular importance, as they are a major component of fat cells (1). Triglycerides are mainly found in chylomicrons, very low-density lipoproteins (VLDLs) and the intermediate fraction of lipoproteins (2). Lipoproteins are formed from nuclei that consist of triglycerides and cholesterol esters, and are surrounded by phospholipids, free cholesterol on the outside (1,3). The lipid part is associated with apolipoproteins, which are specific proteins that determine the physical and biological properties of lipoproteins. The solubility of lipids in plasma is achieved by apolipoproteins (2). Lipid transport involving lipoproteins consists of the transport of triglycerides from the intestine and liver to adipose tissue and muscle, and the transport of cholesterol to peripheral tissues for the cell membrane biosynthesis of steroid hormones and to the liver for synthesis (1). The triglycerides that are derived from food in the intestine are hydrolyzed into free fatty acids, and mono- and diglycerides, and are further absorbed with exogenous cholesterol in enterocytes and are transported through lymphatic vessels to the liver (1). Lipoprotein lipase (LPL) found in adipocytes and muscles hydrolyzes triglycerides into glycerol and free fatty acids; chylomicrons are then formed, which contain an intermediate fraction of lipoproteins (1). Endogenous triglycerides, which are synthesized in the liver, are then incorporated into low density lipoproteins (LDLs), together with cholesterol and apolipoproteins (1). Numerous animal and human studies have conclusively confirmed a negative association between intramuscular triglycerides and insulin sensitivity, suggesting a functional association between fatty acid levels and the pathogenesis of insulin resistance (4).

In a recent study, it was demonstrated that high triglyceride levels and a high triglyceride-glucose index were often observed in males who had a higher body mass index (BMI) and waist/hip ratio, as well as a higher blood pressure (5). Other authors recommend determining the triglyceride levels before and after treatment, taking into account the patient's genotype (6). According to the results of these studies, 65 putative gene-environment interactions potentially caused by quantile-dependent expression of triglycerides were found. A significantly greater reduction in triglyceride levels was found following fenofibrate treatment in 44 LPL mutation carriers compared to 247 non-carriers of hypertriglyceridemia (6).

In a study on the genetic determinants of dyslipidemia and metabolic disorders, a panel of targeted sequencing ‘LipidSeq’ was developed, which allows the simultaneous assessment of monogenic and polygenic forms of dyslipidemia (7). The LipidSeq sequencing panel targets 69 genes and 185 single nucleotide polymorphisms (SNPs) associated with dyslipidemia and metabolic disorders. The developers of this panel found that the 3,262 patients studied had a majority of hypertriglyceridemia (40.1%), familial hypercholesterolemia (40.1%) and hypercholesterolemia (28.3%). According to their results, the LPL gene was associated with familial hypercholesterolemia and hypertriglyceridemia. They also described new variants of the polygenic nature of dyslipidemia, some of which were previously considered to be predominantly monogenic, thus revealing new mechanisms of disease development (7).

The LPL gene encodes for LPL, which hydrolyses triglycerides in circulating cholesterol high-density lipoproteins (HDLs) and chylomicrons, providing free fatty acids and monoacylglycerol for utilization by surrounding target tissues, particularly skeletal muscle, heart muscle and adipose tissue (8). A key enzyme in human lipid metabolism is LPL, which regulates the metabolism of triglyceride-rich lipoproteins (chylomicrons and HDL) by hydrolyzing their cores into free fats and monoacylglycerols. LDL variants are key determinants of triglyceride and HDL concentrations, and in turn, high triglyceride levels combined with low HDL levels lead to a propensity to develop arterial hypertension, glucose intolerance and abdominal obesity, which form the metabolic syndrome (9). Hypertriglyceridemia, one of the common symptoms of LPL deficiency and dysfunction, may be a risk factor for dyslipidemia, type 2 diabetes, arterial hypertension, ischemic heart disease and Alzheimer's disease. LPL gene-induced dyslipidemia and antioxidant stress dysfunction may be an intermediate process in the development of these diseases (10).

The β2-adrenergic receptor (ADRB2) gene encodes a β2-adrenoreceptor, which is activated by adrenaline and causes increased glycogenosis in muscle, increases insulin and glucagon secretion, increases heart contraction, and thereby affects lipid and carbohydrate metabolism (11). In a previous study which examined the association of ADRB2 gene polymorphisms with cardiovascular risk in Swedish males, it was found that the Arg16Gly polymorphism was significantly associated with predominantly abdominal obesity and an elevated systolic blood pressure, whereas the Glu27Glu polymorphism was associated with elevated leptin and triglyceride levels, but not with other indicators, including obesity (12). Given the regulatory role and the possible impact of LPL Ser447Ter (13,14) and ADRB2 Gln27Glu (15) on the development of hypertriglyceridemia, it was suggested that these polymorphisms may be potential risk factors for hypertriglyceridemia.

The indigenous population of the Republic of Kazakhstan-the Kazakh population has a centuries-old gene pool that differs from the gene pools of other populations (16). According to some authors, the Kazakh population is anthropologically similar to the Mongoloid race and occupies an intermediate position between the European and Asian populations (16). To enrich the population genetics database of the Kazakh group and taking into account the pathogenesis of hypertriglyceridemia, the present study selected LPL Ser447Ter, ADRB2 Gln27Glu.

The present study investigated the association between LPL Ser447Ter, ADRB2 Gln27Glu, and the level of triglycerides in the Kazakh population.

 Materials and methods <sec> <title>Study population

The present study examined a total of 460 subjects of Kazakh ethnicity, aged 18 to 65 years, residing in Semey, Kazakhstan, during the period between 2018 and 2020 (17,18). In a previous study, the authors investigated the associations of four SNPs with the risk of hyperinsulinemia and insulin resistance (17). In the present study, the effects of two SNPs on the risk of dyslipidemia were examined. The exclusion criteria included cancer, cardiovascular and renal failure, mental diseases, pregnancy, or lactation. Each participant was informed of the purpose and methods of the study and signed a written informed consent to participate in the study (according to the Declaration of Helsinki of the World Medical Organization, 1964). The Ethics Committee of Semey Medical University approved the research protocol (Protocol no. 11 from 09.27.2017).

 Data collection

Demographic and clinical characteristics were recorded, including systolic and diastolic arterial blood pressure, height, weight, BMI and waist circumference. Arterial blood pressure was measured twice following 5 min of rest with the subjects in a seated position. BMI was defined as the weight (kg)/height (m2). Fasting venous blood samples were obtained from all participants in the morning.

 SNP selection

SNPs were searched using the data from the 1000 Genomes Browser project (https://www.ncbi.nlm.nih.gov/genome/gdv/browser/genome/?id=GCF_000001405.40) and The Text-mined Hypertension, Obesity and Diabetes candidate gene database (T-HOD). The 1000 Genomes Browser Project includes an extensive international pool of human genome polymorphisms to study the association between genotype and phenotype (17,18). The candidate gene database T-HOD includes all gene polymorphisms that have been studied for hypertension, obesity and diabetes (19). References for tag SNPs, as well as positions and genotyping information are presented in the Table I.

 DNA analysis

Whole blood samples were obtained from each of the participants and were collected into vacuum tubes with K2/K3 EDTA. The present study examined two genes, LPL Ser447Ter and ADRB2 Gln27Glu for genetic research. Genomic DNA was extracted from blood samples (40 ng) using a ready-made commercial kit (GeneJET Mini kit; Thermo Fisher Scientific, Inc.). The DNA concentration was evaluated using the Qubit 4 Fluorometer (Thermo Fisher Scientific, Inc.). The extracted DNA was frozen and stored at -20˚C.

All 460 blood samples were genotyped using quantitative PCR (qPCR) using CFX 96 (Bio-Rad Laboratories, Inc.) with mixed primers and TaqMan samples. A total of 20 µl TaqMan Genotyping Mastermix reagent and 10 ng DNA were used as a template with a final volume of 25 µl in 96-well plates. The amplification program included a pre-denaturation step at 95˚C for 3 min followed by 48 cycles of reaction at 95˚C for 10 sec and 60˚C for 40 sec for SNP [reagents for ADRB2 Gln27Glu (rs1042714), manufactured by Syntol ADRB2 Gln27Glu (rs1042714) FCGTCACGCAGGAAAGGGACGA (forward) and ADRB2 Gln27Glu (rs1042714) RGCAGTGCGTCCTTTCCCTGCT (reverse)]. For SNP LPL Ser447Ter (rs328), the amplification program included a pre-denaturation step at 93-denaturation step at 95˚C for 3 min followed by 48 cycles of reaction at 95˚C for 10 sec and 60˚C for 1 min followed by 35 reaction cycles at 93˚C for 10 sec, 64˚C for 10 sec and 72˚C for 20 sec (LPL Ser447Ter (rs328) reagent from Lytech Co. Ltd. LPL Ser447Ter (rs328) FAATAAGAAGTCAGGCTGGTGA (forward) and LPL Ser447Ter (rs328) RTTATTCTTCAGTCCGACCACT (reverse). Data were analyzed using the 2-ΔΔCq method (20).

 Concentration measurements

Total cholesterol, triglycerides, HDL, LDL, apolipoprotein B and apolipoprotein A1 levels were measured using Cobas 8000 analyzers (Roche Diagnostics GmbH) according to instructions of the manufacturer. Reference values were as follows: Total cholesterol, 2.9-5.2 mmol/l; HDL, 0.78-2.2 mmol/l; LDL, 2.33-5.31 mmol/l; triglycerides, 1.7-2.25 mmol/l; apolipoprotein A1, 1.04-2.02 g/l (for males) and 1.08-2.25 g/l (for females); apolipoprotein B, 0.66-1.33 g/l (for males) and 0.6-1.17 g/l (for females).

 Statistical analysis

All statistical analyses were performed using IBM SPSS Statistics Version 20 (International Business Machines Corp.) and SNPStat (SNPStats: your web tool for SNP analysis). All variables were examined to determine whether they were normally distributed. Non-parametric tests were used for non-normally distributed data. These were the Mann-Whitney test for comparisons between two groups and the Kruskal-Wallis test for co-dominant, dominant, and recessive models for differences in phenotypic variables for genotype. The χ2 test and logistic regression analysis were used for comparing differences in allele frequencies of SNPs between subjects with hypertriglyceridemia (was defined using the dichotomous qualitative trait of triglycerides, ≤2.25 and triglycerides, >2.25) and the control subjects. In a single test, P#x003C;0.05 was considered to indicate a statistically significant difference. Following Bonferroni's correction for multiple testing, again, P#x003C;0.05 was considered to indicate a statistically significant difference.

 Results <sec> <title>Comparisons of the study subjects and general information

The study population comprised 231 males [age: Median (Q1-Q3), 48 years (39-57)]; and 229 females [age: Median (Q1,-Q3), 45 years (38-53)], P=0.03. Males had a significantly higher BMI than females [median (Q1,-Q3), 26.42 (23.87-29.35) and median (Q1,-Q3), 25.86 (22.65-28-41)], respectively P=0.04. In total, 83 males (18.04%) and 102 females (22.17%) had a healthy weight, 107 males (23.26%) and 86 females (18.69%) were overweight, and 41 males (8.92%) and 41 females (8.92%) were obese (P=0.12) (Table II). The demographic and laboratory finding of the study population between two groups are presented in Table III. The group with hypertriglyceridemia had a significantly higher BMI (kg/m2) than the group with normal levels of triglycerides. The mean levels of HDL (mmol/l) and apolipoprotein B (g/l) were significantly higher in the group with hypertriglyceridemia. There were no statistically significant differences between the two groups as regards the levels of total cholesterol, LDL and apolipoprotein A1 (Table III).

 Genotype and allele analysis LPL Ser447Ter and ADRB2 Gln27Glu genes polymorphisms

The present we genotyped all 460 subjects. Only LPL Ser447Ter deviated from the Hardy-Weinberg equilibrium (P=0.0001). The frequencies of the C/C, C/G and G/G genotypes of LPL Ser447Ter were 76.95, 18.69 and 4.36%, respectively (Table IV). The frequencies of the C/C, C/G and G/G genotypes of ADRB2 Gln27Glu were 49.35, 41.52 and 9.13%, respectively (Table IV). The present study found a significant association of the Gln27Glu (rs1042714) polymorphism of the ADRB2 gene with triglycerides levels (P=0.04; Table III). When analyzing the link between SNPs and the level of triglycerides, it was found that risk of developing hypertriglyceridemia was significantly associated with ADRB2 Gln27Glu [odds ratio (OR), 0.72; 95% confidence interval (CI), 0.52-0.98; P=0.038]; the values for the C/G and G/G genotypes were as follows: OR, 0.88; 95% CI, 0.56-1.36; and OR, 0.42; 95% CI, 0.21-0.84, respectively (Table V).

 Logistic regression analysis between the levels of triglycerides and LPL Ser447Ter and ADRB2 Gln27Glu gene polymorphisms

Logistic regression analysis revealed that the risk of developing hypertriglyceridemia was significantly lower in carriers of the ADRB2 Gln27Glu G allele than in those with the C/C genotype (C/G + C/C vs. G/G: Adjusted OR, 0.42; 95% CI, 0.21-0.84; P=0.05 in the codominant model) (Table V). As shown in Table V, the C allele and the association of the C/C and C/G genotypes of the Gln27Glu (rs1042714) polymorphism of the ADBR2 gene were more frequent in individuals with elevated triglyceride levels compared with those with normal triglyceride levels. Conversely, the G allele and the G/G genotype are more common in the group with normal TG levels. The C allele and C/C and C/G genotypes of the Gln27Glu (rs1042714) polymorphism of the ADBR2 gene were associated with an increased risk of developing hypertriglyceridemia in the study sample. By contrast, the G allele and the G/G genotype of the Gln27Glu (rs1042714) polymorphism of the ADBR2 gene were protective and were associated with a reduced risk of hypertriglyceridemia (OR, 0.72; 95% CI, 0.52-0.98; P=0.038) in this sample. Genotyping of the Gln27Glu (rs1042714) polymorphism of the ADRB2 gene revealed that in a recessive model, C/C and C/G increased the risk of hypertriglyceridemia in the study sample, whereas the presence of the G/G genotype reduced the risk of hypertriglyceridemia 0.45-fold (OR, 0.45; 95% CI, 0.23-0.86; P=0.018).

 Multiple-SNP analysis

Multiple-SNP analyses were performed between the two SNPs for gene-gene interactions, and the D' value between LPL Ser447Ter (rs328) and ADRB2 Gln27Glu (rs1042714) was 0.003 (P=0.56) (Table VI). The haplotype containing two SNPs was not associated with the risk of developing hypertriglyceridemia. The results of the haplotype analysis are shown Table VII.

 Discussion

The levels of triglycerides are dependent on genetic and exogenous factors (race, age, sex, dietary habits and physical activity) (2). A small increase in the levels of triglycerides reflects an increase in the concentration of LDL and its residues and, in some cases, an increase in the concentration of LDL and HDL (2). The levels of triglycerides can also be used to assess therapy to reduce the risk of atherosclerotic CVDs and cardiovascular events (21), as the reduction in plasma triglyceride levels is due to a reduction in triglycerides in lipoproteins. Elevated levels of triglycerides are more often accompanied by low HDL and high LDL levels; therefore, the determination of the levels of triglycerides is critical in assessing the risk of cardiovascular events (1).

In the present study, the level of triglycerides was associated with a higher BMI, and higher apolipoprotein B and HDL levels. These results are similar to those of other researchers (1). The association of abdominal obesity with triglyceride levels is explained by the involvement of adipocytes in triglyceride metabolism. Plasma triglyceride concentrations reflect apolipoprotein B-containing lipoproteins (22). Similar findings have been reported in other studies; for example, Ference et al (23) argued that the effect of triglycerides on the risk of atherosclerotic CVD was related not to triglyceride itself, but to the concentration of apolipoprotein B-containing lipoproteins. Some authors have argued that increased lipogenesis in the liver result in hypertriglyceridemia, which decreases HDL levels (24). This is also consistent with the data of other researchers. Patwardhan et al (25) found that triglyceride and HDL levels were associated with the initial manifestations of insulin resistance. They argued that the timely treatment of dyslipidemia may be a prevention for insulin resistance (25).

Xie et al (10) reviewed the molecular structure, expression and function of the LPL gene for its association with dyslipidemia, type 2 diabetes, arterial hypertension, ischemic heart disease and Alzheimer's disease. They found that the insufficient synthesis or dysfunction of LPL reduced the hydrolysis of chylomicrons and VLDL, interfered with lipid consumption and led to the accumulation of lipoproteins in plasma (10). Liu et al (26) demonstrated that in the presence of the Ser447Ter polymorphism of the LPL gene, there was a high concentration of triglycerides and/or a low concentration of HDL, which was associated with a high systolic blood pressure and pulse pressure in patients with arterial hypertension. When studying the role of genes in the development of arterial hypertension Chen et al (27) found that polymorphisms of the LPL gene not only contributed to the development of arterial hypertension, but also influenced the increase in triglyceride levels. Matsunaga et al (28) noted that the heterozygous rs328 genotype of the LPL gene polymorphism was more common in patients with hypertriglyceridemia. They argued that multiple gene variations and environmental factors were the main causes of severe hypertriglyceridemia (29). In the presents study, it was found that the LPL Ser447Ter alleles were not associated with a statistically increased risk of hypertriglyceridemia.

Some authors have investigated the association between the Gln27Glu (rs1042714) polymorphism of the ADRB2 gene and obesity-related parameters (30) and found it to be associated with levels of triglycerides and HDL. A recent study demonstrated that the ADRB2 homozygous Gln27Glu variant was associated with type 2 diabetes, a risk factor that may have been associated with the risk of visceral fat accumulation and the development of type 2 diabetes in males, but not in females (29). In the present study, it was found that alleles of the Gln27Glu polymorphism (rs1042714) of the ADRB2 gene were associated with a high risk of developing hypertriglyceridemia. El-Menyar et al (31) stated that patients with the homozygous G/G genotype of the ADRB2 gene were more likely to have acute coronary syndrome with severe coronary artery stenosis. In addition, patients with type 2 DM with the G/G genotype of the ADRB2 gene had an increased risk of significant coronary stenosis (31).

The present study focused only on the association between ADRB2 Gln27Glu and triglycerides level. It was found that a higher risk of developing hypertriglyceridemia was associated with the ADRB2 Gln27Glu-C allele, but not with the G/G genotype. It was also found that a lower risk of developing hypertriglyceridemia was related to the ADRB2 Gln27Glu-G allele and the recessive model of the ADRB2 Gln27Glu polymorphism (C/C + C/G vs. G/G) was associated with a lower risk of developing hypertriglyceridemia (OR, 0.45; 95% CI, 0.23-0.86; P=0.0018). At the same time, polymorphisms of the LPL Ser447Ter (rs328) gene were not associated with hypertriglyceridemia in the present study population. There was no significant gene interaction between LPL Ser447Ter and ADRB2 Gln27Glu. These data are consistent with the aforementioned researches. As previously reported, SNP ADRB2 Gln27Glu affects the levels of triglycerides and HDL (30). A recent study demonstrated that ADRB2 Gln27Glu homozygous variant is associated with type 2 diabetes mellitus (30). In males it was a risk factor that possibly influences the accumulation of visceral fat and the development of type 2 diabetes mellitus, but not in females.

In identifying the major candidate genes that increase the risk of obesity, Lee et al (32) found that the ADRB2 gene polymorphism in combination with smoking and overeating was strongly associated with obesity, and the chance of developing obesity was 11.7-fold higher in smokers compared to non-smokers. In evaluating the combined effect of rs9930501, rs9930506 and rs9932754 polymorphisms of the FTO gene, and the rs1042713 and rs1042714 polymorphisms of the ADRB2 gene on risk of obesity and cardiometabolic parameters, Tan and Mitra (15) demonstrated that individuals with a high frequency of risk alleles were more likely to be obese compared to those who had fewer risk alleles.

In their study, Wang et al (33) compared Han, Uyghur and Kazakh males, in terms of BMI, waist circumference, systolic blood pressure, diastolic blood pressure and HDL. They stated that Kazakh males had the highest BMI, waist circumference, blood pressure, HDL and lowest triglyceride levels among the three groups (33). In the present study, BMI also differed between the hypertriglyceridemia and healthy triglycerides groups. In addition, the levels of HDL, apolipoprotein B and BMI were significantly higher in the hypertriglyceridemia group than in the healthy triglyceride group. This can b explained by the high meat and carbohydrate intake and low fruit and vegetable intake in the Kazakh population. A high-calorie diet leads to dyslipidemia. No significant gene interaction was also found between LPL Ser447Ter and ADRB2 Gln27Glu.

There were several limitations to the present study. First, the significance of the association with hypertriglyceridemia was only observed for the recessive model (P=0.018) and the allele frequency of the LPL Ser447Ter gene. The P-value of 0.038 of the genetic predisposition to hypertriglyceridemia in the subjects with a C allele, was higher than the significance level estimated from Bonferroni's correction (P=0.025). Moreover, the LPL Ser447Ter polymorphism was associated with the dichotomous categorization of triglycerides groups as a qualitative trait.

On this basis, the C allele and the C/C and C/G genotypes of the Gln27Glu (rs1042714) polymorphism of the ADBR2 gene were associated with an increased risk of developing hypertriglyceridemia in the study sample. In turn, the G allele and G/G genotype of the Gln27Glu (rs1042714) polymorphism of the ADBR2 gene was associated with a reduced risk of developing hypertriglyceridemia in the present study sample. According to the results, the Ser447Ter (rs328) polymorphism of the LPL gene was not informative as a genetic determinant of the risk of dyslipidemia in this sample.

In conclusion, the present study indicates that the ADRB2 Gln27Glu polymorphism is associated with a risk of developing hypertriglyceridemia. In the Kazakh population, the ADRB2 Gln27Glu allele G was associated with a decreased risk of developing hypertriglyceridemia, whereas the LPL Ser447Ter alleles exhibited no association. The findings suggested that the levels of triglycerides were associated with higher levels of BMI, apolipoprotein B and HDL. However, further investigations are required to confirm these findings in a larger population in prospective longitudinal research.

 Acknowledgements

The authors would like to extend special gratitude to Karaganda Medical University, Karaganda, the Republic of Kazakhstan for providing assistance with genotyping.

 Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

 Authors' contributions

AS and MM were the major contributors to the research, and performed the sequencing data analysis and were responsible for the clinical samples. NA, AS, AN, ZZ, DK and MM made substantial contributions to the conception and design of the study. AS and MM contributed to the qPCR analysis. MM, NA, ZZ and were responsible for the whole project. AS, DK and MM were involved in the writing of the manuscript. AS, MM, DK confirm the authenticity of all the raw data. NA, AN, DK and ZZ given final approval of the version to be published. All authors have read and approved the final manuscript.

 Ethics approval and consent to participate

All participants provided written informed consent to participate in the study (according to the Declaration of Helsinki of the World Medical Organization). The Ethics Committee of Semey Medical University approved the research protocol (Protocol no. 11 from 27.09.2017).

 Patient consent for publication

Not applicable.

 Competing interests

The authors declare that they have no competing interests.

 References SolnicaBSygitowiczGSitkiewiczDCybulskaBJóźwiakJOdrowąż-SypniewskaGBanachM2020 Guidelines of the Polish Society of Laboratory Diagnostics (PSLD) and the Polish Lipid Association (PoLA) on laboratory diagnostics of lipid metabolism disordersArch Med Sci1623725220203219013310.5114/aoms.2020.93253 ZhuJRGaoRLZhaoSPLuGPZhaoDLiJJ2016 Chinese guidelines for the management of dyslipidemia in adultsJ Geriat Cardiol1512920182943462210.11909/j.issn.1671-5411.2018.01.011 LimSYSteinerJMCridgeHLipases: It's not just pancreatic lipase! Am J VeterinaryRes8334835820223589579610.2460/ajvr.22.03.0048 GilbertMRole of skeletal muscle lipids in the pathogenesis of insulin resistance of obesity and type 2 diabetesJ Diabetes Investig121934194120213413249110.1111/jdi.13614 YanYWangDSunYMaQWangKLiaoYChenCJiaHChuCZhengWTriglyceride-glucose index trajectory and arterial stiffness: Results from Hanzhong Adolescent Hypertension Cohort StudyCardiovasc Diabetol213320223521661410.1186/s12933-022-01453-4 WilliamsPTGene-environment interactions due to quantile-specific heritability of triglyceride and VLDL concentrationsSci Rep10448620203216130110.1038/s41598-020-60965-9 DronJSWangJMcIntyreADIacoccaMARobinsonJFBanMRCaoHHegeleRASix years' experience with LipidSeq: Clinical and research learnings from a hybrid, targeted sequencing panel for dyslipidemiasBMC Med Genomics132320203204161110.1186/s12920-020-0669-2 PetrieJRGuzikTJTouyzRMDiabetes, hypertension, and cardiovascular disease: Clinical insights and vascular mechanismsCan J Cardiol3457558420182945923910.1016/j.cjca.2017.12.005 BeisiegelULipoprotein metabolismEur Heart J19 (Suppl A)A20A2319989519338 XieCWangZCLiuXFYangMSThe common biological basis for common complex diseases: Evidence from lipoprotein lipase geneEur J Hum Genet183720101963902110.1038/ejhg.2009.134 OlefskyJMGlassCKMacrophages, inflammation, and insulin resistanceAnn Rev Physiol7221924620102014867410.1146/annurev-physiol-021909-135846 RosmondRUkkolaOChagnonMBouchardCBjörntorpPPolymorphisms of the beta2-adrenergic receptor gene (ADRB2) in relation to cardiovascular risk factors in menJ Intern Med24823924420001097179110.1046/j.1365-2796.2000.00721.x WillerCJSchmidtEMSenguptaSPelosoGMGustafssonSKanoniSGannaAChenJBuchkovichMLMoraSDiscovery and refinement of loci associated with lipid levelsNat Genet451274128320132409706810.1038/ng.2797 TeslovichTMMusunuruKSmithAVEdmondsonACStylianouIMKosekiMPirruccelloJPRipattiSChasmanDIWillerCJBiological, clinical and population relevance of 95 loci for blood lipidsNature46670771320102068656510.1038/nature09270 TanPYMitraSRThe combined effect of polygenic risk from FTO and ADRB2 Gene variants, odds of obesity, and post-hipcref diet differencesLifestyle Genomics13849820203210187210.1159/000505662 SikhayevaNTalzhanovYIskakovaADzharmukhanovJNugmanovaRZholdybaevaERamanculovEType 2 diabetes mellitus: Distribution of genetic markers in Kazakh populationClin Interv Aging1337738820182955189210.2147/CIA.S156044 ShakhanovaAAukenovNNurtazinaAMassabayevaMBabenkoDAdiyevaMShaimardonovNAssociation of polymorphism genes LPL, ADRB2, AGT and AGTR1 with risk of hyperinsulinism and insulin resistance in the Kazakh populationBiomed Rep133520203284396310.3892/br.2020.1342 1000 Genomes Project ConsortiumAutonABrooksLDDurbinRMGarrisonEPKangHMKorbelJOMarchiniJLMcCarthySMcVeanGAAbecasisGRA global reference for human genetic variationNature526687420152643224510.1038/nature15393 DaiHJWuJCYTsaiRTHPanWHHsuWLT-HOD: A literature-based candidate gene database for hypertension, obesity and diabetesDatabase (Oxford2013bas06120132340679310.1093/database/bas061 LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) methodMethods2540240820011184660910.1006/meth.2001.1262 BastienMPoirierPLemieuxIDesprésJPOverview of epidemiology and contribution of obesity to cardiovascular diseaseProg Cardiovasc Dis5636938120142443872810.1016/j.pcad.2013.10.016 MachFBaigentCCatapanoALKoskinasKCCasulaMBadimonLChapmanMJDe BackerGGDelgadoVFerenceBA2019 ESC/EAS Guidelines for the management of dyslipidaemias: Lipid modification to reduce cardiovascular riskEur Heart J4111118820203150441810.1093/eurheartj/ehz455 FerenceBAKasteleinJJPRayKKGinsbergHNChapmanMJPackardCJLaufsUOliver-WilliamsCWoodAMButterworthASAssociation of triglyceride-lowering LPL variants and LDL-C-lowering LDLR variants with risk of coronary heart diseaseJAMA32136437320193069431910.1001/jama.2018.20045 LechnerKMcKenzieALKränkelNVon SchackyCWormNNixdorffULechnerBScherrJWeingärtnerOKraussRMHigh-risk atherosclerosis and metabolic phenotype: The roles of ectopic adiposity, atherogenic dyslipidemia, and inflammationMetab Syndr Relat Disord1817618520203211980110.1089/met.2019.0115 PatwardhanVKhadilkarAChiplonkarSKhadilkarVDyslipidemia and Fat Distribution in Normal Weight Insulin Resistant MenJ Assoc Physicians India672629201931559764 LiuALeeLZhanSCaoWLvJGuoXHuYThe S447X polymorphism of the lipoprotein lipase gene is associated with lipoprotein lipid and blood pressure levels in Chinese patients with essential hypertensionJ Hypertens221503150920041525717210.1097/01.hjh.0000125456.28861.e4 ChenPJouYSFannCSChenJWChungCMLinCYWuSYKangMJChenYCJongYSLipoprotein lipase variants associated with an endophenotype of hypertension: Hypertension combined with elevated triglyceridesHum Mutat30495520091864938910.1002/humu.20812 MatsunagaANagashimaMYamagishiHSakuKVariants of Lipid-related genes in adult japanese patients with severe hypertriglyceridemiaJ Atheroscler Thromb271264127720203211548710.5551/jat.51540 Gonzalez SanchezJLProenzaAMMartinez LarradMTRamisJMFernandez PerezCPalouASerrano RíosMThe glutamine 27 glutamic acid polymorphism of the beta2-adrenoceptor gene is associated with abdominal obesity and greater risk of impaired glucose tolerance in men but not in women: A population-based study in SpainClin Endocrinol (Oxf)5947648120031451091010.1046/j.1365-2265.2003.01871.x ApalasamyYDMingMFRampalSBulgibaAMohamedZGender-dependent association of a β(2)-adrenergic gene variant with obesity parameters in malaysian malaysAsia Pac J Public Health27NP154NP16520152219915510.1177/1010539511430250 El-MenyarARizkNMAsimMAl-ThaniHElgendyAAl-SuwaidiJAssociation of β-adrenergic receptor gene polymorphisms with acute coronary syndrome and cardiovascular risk factors in an arab populationAngiology6776277120162660275110.1177/0003319715618039 LeeSKimCMKimHJParkHSInteractive effects of main genotype, caloric intakes, and smoking status on risk of obesityAsia Pac J Clin Nutr20563571201122094842 WangYZhangJMaYSongXLiSZhanXWuLDifferent lipid profiles, insulin sensitivity, and insulin resistance among Han, Uygur, and Kazak men with normal glucose tolerance in Xinjiang, ChinaLipids Health Dis1720920183019357810.1186/s12944-018-0863-9

Description of two SNPs and primers.

Gene Tag SNP Chromosome Major/minor alleles Forward Reverse
LPL Ser447Ter rs328 8:19962213 C/G FAATAAGAAGTCA GGCTGGTGA RTTATTCTTCAGTCCGAC CACT
ADRB2 Gln27Glu rs1042714 5:148826910 C/G FCGTCACGCAGG AAAGGGACGA RGCAGTGCGTCCTTTCCC TGCT

SNPs, single nucleotide polymorphisms; LPL, lipoprotein lipase; ADRB2, β2-adrenergic receptor.

Comparison of the clinical characteristics of the patients.

  Sex  
  Males (n=231), median (Q1,-Q3) Females (n=229), median (Q1,-Q3) P-value
Age, years 48 (39-57) 45 (38-53) 0.03a
BMI, (kg/m2) 26.42 (23.87-29.35) 25.86 (22.65-28-41) 0.04a
Healthy weight, (n) 83 (18.04%) 102 (22.17%) 0.12b
Overweight, (n) 107 (23.26%) 86 (18.69%)  
Obese, (n) 41 (8.92%) 41 (8.92%)  

Data are presented as the median (Q1-Q3) for age and BMI. Data were analyzed using the

aMann-Whitney test or

bχ2 test. P-values #x003C;0.05 were considered to indicate a statistically significant difference. BMI, body mass index.

Comparison of the triglyceride levels between the two groups as regards clinical characteristics.

  Triglycerides (mmol/l)  
Characteristic ≤2.25 (n) ≥2.25 (n) P-value
Age, years 46 (38-55) 48 (41-56) 0.055a
Sex (total) 336 124 0.88b
     Male 168 63  
     Female 168 61  
BMI (kg/m2) 25.94 (23.12-28.4) 27.14 (23.76-29.74) 0.007a
Total cholesterol (mmol/l) 3.34 (2.41-2.53) 3.45 (2.66-2.17) 0.1a
HDL (mmol/l) 0.92 (0.76-1.18) 1.12 (0.96-1.2) 0.01a
LDL (mmol/l) 1.8 (1.3-2.53) 1.88 (1.31-2.2) 0.91a
Apolipoprotein B (g/l) 0.92 (0.76-1.14) 1.12 (0.96-1.29) 0.0001a
Apolipoprotein A1 (g/l) 1.5 (1.33-1.72) 1.47 (1.28-1.65) 0.17a

Data are presented as the median (Q1-Q3) for age, sex, BMI, total cholesterol, triglycerides, HDL, LDL, apolipoprotein B and apolipoprotein A1. P-values #x003C;0.05 were considered to indicate statistically significant differences. Data were analyzed using the

aMann-Whitney test or

bχ2 test. BMI, body mass index; HDL, high-density lipoprotein; LDL, low-density lipoprotein.

Frequency of genotypes and alleles of each gene polymorphism in total, triglycerides ≤2.25, and triglycerides ≥2.25.

Gene polymorphism Genotypes Allele P-valuea
LPL Ser447Ter C/C C/G G/G C G 0.33
     Total 354 86 20 794 126  
     Triglycerides ≤2.25, no. of patients 263 61 12 587 41  
     Triglycerides ≥2.25, no. of patients 91 25 8 207 85  
ADRB2 Gln27Glu C/C C/G G/G C G 0.04
     Total 227 191 42 645 275  
     Triglycerides ≤2.25, no. of patients 172 140 24 484 188  
     Triglycerides ≥2.25, no. of patients 55 51 18 161 87  

aData were analyzed using the χ2 test. LPL, lipoprotein lipase; ADRB2, β2-adrenergic receptor.

Genotype and allele frequencies of 2 SNP associations with response levels of triglycerides.

Model Genotype Triglycerides ≤2.25, no. of patients Triglycerides ≥2.25, no. of patients OR (95% CI) P-value AIC BIC
LPL Ser447Ter
Codominant C/C 91 263 1.00 0.34 542 558.6
  C/G 25 61 0.84 (0.50-1.42)      
  G/G 8 12 0.51 (0.20-1.30)      
Dominant C/C 91 263 1.00 0.27 540.9 553.3
  C/G-G/G 33 73 0.76 (0.47-1.23)      
Recessive C/C-C/G 116 324 1.00 0.19 540.5 552.8
  G/G 8 12 0.53 (0.21-1.34)      
Overdominant C/C-G/G 99 275 1.00 0.62 541.9 554.3
  C/G 25 61 0.88 (0.52-1.47)      
Log-additive   - - 0.77 (0.53-1.11) 0.17 540.3 552.7
ADRB2 Gln27Glu
Codominant C/C 55 172 1.00 0.05 538.3 554.8
  C/G 51 140 0.88 (0.56-1.36)      
  G/G 18 24 0.42 (0.21-0.84)      
Dominant C/C 55 172 1.00 0.19 540.5 552.9
  C/G-G/G 69 164 0.76 (0.50-1.15)      
Recessive C/C-C/G 106 312 1.00 0.018 536.6 549
  G/G 18 24 0.45 (0.23-0.86)      
Overdominant C/C-G/G 73 196 1.00 0.92 542.2 554.6
  C/G 51 140 1.02 (0.67-1.55)      
Log-additive   - - 0.72 (0.52-0.98) 0.038 537.9 550.3

The data were adjusted by sex. LPL, lipoprotein lipase; ADRB2, β2-adrenergic receptor; OR, odds ratio; 95% CI, 95% confidence interval.

Multiple-SNP analyses between the two SNPs for gene-gene interactions.

  SNP LPL Ser447Ter
D statistic ADRB2 Gln27Glu 0.003
D' statistic   0.03
r statistic   0.019
P-values   0.56

Haplotype association with response levels of triglycerides.

Haplotype Frequency  
LPL Ser447Ter ADRB2 Gln27Glu Triglycerides ≤2.25, no. of patients Triglycerides ≥2.25, no. of patients OR (95% CI) P-value
C C 0.6309 0.5452 1.00 -
C G 0.2427 0.2895 0.72 (0.51-1.03) 0.074
G C 0.0894 0.104 0.78 (0.45-1.36) 0.39
G C 0.0371 0.0613 0.54 (0.25-1.15) 0.11

The data were adjusted by sex. Global haplotype association P-value: 0.1. LPL, lipoprotein lipase; ADRB2, β2-adrenergic receptor; OR, odds ratio; 95% CI, 95% confidence interval.