ETM Experimental and Therapeutic Medicine 1792-0981 1792-1015 D.A. Spandidos 10.3892/etm.2011.226 etm-02-03-0537 Articles Analysis of estrogen receptor isoforms and variants in breast cancer cell lines AL-BADERMAIE1 FORDCHRISTOPHER2 AL-AYADHYBUSHRA3 FRANCISISSAM3 Departments of Physiology, Surgery, and Pathology, Faculty of Medicine, Kuwait University, Safat 13110, Kuwait Correspondence to: Dr Maie Al-Bader, Department of Physiology, Faculty of Medicine, Kuwait University, P.O. Box 24923, Safat 13110, Kuwait, E-mail: albader@hsc.edu.kw May-June 2011 10 3 2011 2 3 537 544 22 11 2010 14 2 2011 Copyright © 2011, Spandidos Publications 2011

In the present study, the expression of estrogen receptor (ER)α and ERβ isoforms in ER-positive (MCF7, T-47D and ZR-75-1) and ER-negative (MDA-MB-231, SK-BR-3, MDA-MB-453 and HCC1954) breast cancer cell lines was investigated. ERα mRNA was expressed in ER-positive and some ER-negative cell lines. ERα Δ3, Δ5 and Δ7 spliced variants were present in MCF7 and T-47D cells; ERα Δ5 and Δ7 spliced variants were detected in ZR-75-1 cells. MDA-MB-231 and HCC1954 cells expressed ERα Δ5 and Δ7 spliced variants. The ERβ1 variant was expressed in all of the cell lines and the ERβ2 variant in all of the ER-positive and some ER-negative cell lines (MDA-MB-231, MDA-MB-453 and SK-BR-3). MCF7, ZR-75-1, MDA-MB-453, HCC1954 and T-47D cells expressed ERβ5. All cell lines expressed an ERα 66-kDa protein band, and some expressed the truncated 42-kDa variant. ERβ1 was detected in all of the cell lines in addition to a 38–44 kDa variant. The results indicate that breast cancer cell lines widely used in research and reported as being ER-negative express ERα and/or ERβ mRNA and protein.

 breast cancer cell lines estrogen receptor α estrogen receptor β Introduction

Estrogen receptor (ER)α was first cloned in rats by Koike et al (1); almost 10 years later, a gene encoding a second type of ER, ERβ, was cloned in rats (2), humans (3) and mice (4), prompting the re-evaluation of estrogen signaling systems. ERα and ERβ are homologous, particularly in the DNA binding domain (95%) and in the C-terminal ligand binding domain (55%) (2–4). The genes for both ERα and ERβ are encoded by eight exons, located on different chromosomes, with ERα found on the long arm of chromosome 6q25.1 and ERβ on chromosome 14q22-24 (5). This confirms that each receptor is the product of independent genes. ERs have six functional domains: domain A/B, containing the N-terminal activation function-1 (AF-1); domain C, the DNA binding domain; domains D/E, bearing both the activation function-2 (AF-2) and the ligand binding domains; and finally, domain F, the C-terminal domain (6,7).

The actions of estrogens are mediated by binding to ERs (ERα and/or ERβ). These receptors, which are co-expressed in a number of tissues, form functional homodimers or heterodimers. When bound to estrogens as homodimers, the transcription of target genes is activated (8,9), while as heterodimers, ERβ exhibits an inhibitory action on ERα-mediated gene expression and, in many instances, opposes the actions of ERα (7,9). Estrogen binding to ERβ also inhibits gene transcription via AP1 sites, while binding to ERα leads to their activation (8,10,11). Thus, as several ER-negative breast cancer cell lines respond to estrogens and anti-estrogens, this suggests that these compounds may act through an alternative mechanism, not the classical ERα pathway (12), or that ER-negative cell lines are not truly ER-negative.

Much of our knowledge on breast carcinomas is based on in vitro studies performed with various breast cancer cell lines. These cell lines provide a source of homogenous self replicating material, free of contaminating stromal cells, that can be grown in culture in standard media. Cell lines that have retained the luminal epithelial phenotype of breast cells include MCF7, T-47D and ZR-75-1; those with a weak luminal epithelial-like phenotype include MDA-MB-453 and SK-BR-3; finally, those that do not express epitheloid markers, but exhibit a high level of vimentin (a marker found in mesenchymal cells), include MDA-MB-231 (13). Although rare, there have been reports of ER-positive cell lines converting to an ER-negative phenotype (13). However, certain breast cancer cell lines reported as being negative for ERα have since been shown to express ERβ at least at the mRNA level. In addition to the aforementioned ER isoforms, several ER variants have been identified for both receptors. A summary of the reported ERα and ERβ isoforms and their variants to date is shown in Tables I and II, respectively.

There have been some discrepancies between the results of researchers studying the mitogenic effects of estradiol and various estrogen agonists and/or antagonists using a number of breast cancer cell lines (both ER-positive and ER-negative). Although this can be attributed to many factors, in this study we aimed to determine the true ER status of breast cancer cells by studying ERβ isoform expression in breast cancer cell lines that have been reported, in the literature, to be ER-positive (MCF7, T-47D and ZR-75-1) or ER-negative (MDA-MB-231, SK-BR-3, MDA-MB-453 and HCC1954). Additionally, we aimed to determine the expression of ERα and ERβ variants in these cell lines using reverse transcriptase polymerase chain reaction (RT-PCR) and Western blotting. Our results revealed that ER-positive and ER-negative cell lines used extensively in breast cancer research have variable degrees of expression of ERα and/or ERβ isoforms and variants at the mRNA and/ or protein level.

 Materials and methods Materials

All media and supplements for cell culture were obtained from Invitrogen (Paisley, UK). The ERβ polyclonal antibody used corresponds to amino acids 1-150 (H-150; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). Mouse monoclonal anti-ERα was raised against the steroid binding domain of ERα [amino acid residues 582–595 (referred to in this article as ERα-S)] (SRA-1010, clone C-542; Stressgen, Ann Arbor, MI, USA). For the detection of actin, a mouse monoclonal IgG1 anti-human actin antibody was used (Santa Cruz Biotechnology, Inc.). PVDF membranes were obtained from Amersham Pharmacia Biotech Ltd. (RPN303F; Buckinghamshire, UK). General laboratory chemicals were purchased from Merck (Dagenham, Essex, UK) and all fine chemicals were obtained from Sigma Chemical Co. Ltd. (Poole, Dorset, UK). All buffers, enzymes and reagents used in the RT-PCR experiments were purchased from Invitrogen, and reagents for real-time PCR (ReT-PCR) were purchased from Applied Biosystems (Foster City, CA, USA).

 Cell lines

All of the cell lines used in this study were obtained from the American Type Culture Collection (ATCC; Rockville, MD, USA). Seven breast cancer cell lines were used, three of which are known to be ER-positive in the literature (MCF7, T-47D and ZR-75-1) and four of which are reported to be ER-negative (MDA-MB-231, MDA-MB-453, SK-BR-3 and HCC1954). Cell lines were grown as monolayers in the following media: RPMI-1640 (T-47D, ZR-75-1 and HCC1954), Eagle’s MEM (MDA-MB-231 and MCF7), McCoy’s 5A (SK-BR-3) and Leibovitz’s (MDA-MB-453) containing 10% fetal bovine serum (FBS), penicillin (100 IU/ml) and streptomycin (100 μg/ml). Other supplements were added to the medium for some of the cell lines, as per the ATCC data sheet supplied with the cell lines. When required for assays, 5 ml of a 1:10 dilution of trypsin-EDTA in phosphate buffered saline (PBS) was added to PBS-washed monolayers, followed by incubation at 37˚C for 5–10 min. Cells were centrifuged for 7 min at 130 × g, reconstituted in the medium, and counted.

 Reverse transcription polymerase chain reaction (RT-PCR)

Total RNA was isolated from a minimum number of 5×106 cells using the method of Chomczynski and Sacchi (54). Following isolation, the RNA samples were DNase-treated, then reverse transcribed using random hexamer primers (55). PCR reactions were carried out in a programmable thermal cycler (Perkin Elmer, model 9700) in a reaction mixture consisting of 1X PCR buffer (20 mM Tris/50 mM KCl), 3 mM MgCl2, 0.5 mM dNTPs and 0.3 μM each of forward and reverse primers (primer sets are shown in Table III), 0.5 μl template and 1.25 units recombinant Taq DNA polymerase in a final volume of 25 μl. The PCR reactions were then cycled as follows: 5 min at 94˚C (1 cycle); 30 sec at 94˚C (denaturation step), 30 sec (annealing step) and 1 min (extension step) at 72˚C for the required number of cycles (Table III). Tubes were then incubated for a further 7 min at 72˚C (1 cycle).

 Protein analysis using Western blotting and immunodetection

Trypsinized cells (∼2.65×106) were centrifuged at 1,000 x g at 4˚C for 10 min to remove the medium and then washed twice with PBS buffer. The pellet was resuspended in homogenization buffer (20–50 μl) and then vortexed, sonicated for 30 min at 4˚C, and frozen for 15 min. This step was repeated twice. Finally, the samples were centrifuged at 4˚C for 30 min at 20,000 × g, the supernatant was collected, and the total protein concentration was measured (20 μg of protein was loaded per lane). Proteins were separated using SDS-PAGE. A monoclonal antibody for ERα raised against the steroid binding domain (ERα-S) and a polyclonal antibody against ERβ were used. Western blot analysis and immunodetection of total ER proteins together with analysis of protein sizes were performed as previously described (55). In preliminary experiments, the primary antibody was omitted and filters were incubated with the secondary antibody only. No bands were detected with this antibody. Once the membranes were probed with the anti-ER antibodies, they were stripped and re-probed with actin, which was present equally in all the samples (data not shown). The results obtained from this experiment were compiled for each cell line and are shown as the percentage of expression for each band per group of study.

 Results ER mRNA expression using RT-PCR

Representative images for all cell lines using the various primers are shown in Fig. 1. Overall results for all cell lines studied are shown in Table IV. The housekeeping gene β-actin was used as a control and expression was verified in all the cell lines studied. Wild-type (wt) ERα was expressed in all the ER-positive cell lines (MCF7, T-47D and ZR-75-1), as well as in the ER-negative cell lines (MDA-MB-231 and HCC1954). The ERα Δ3, Δ5 and Δ7 spliced variants were present in both the MCF7 and T-47D ER-positive cell lines. Regarding the ZR-75-1 cell line, only the ERα Δ5 and Δ7 spliced variants were detected. Concerning the ER-negative cell lines, both MDA-MB-231 and HCC1954 showed mainly weak expression of the ERα Δ5 and Δ7 spliced variants. The ERα Δ6 and Δ6+7 variants were not expressed in any of the cell lines. The ERβ1 variant was expressed in the ER-positive and ER-negative cell lines; however, ZR-75-1 and SK-BR-3 cells exhibited weak expression. The ERβ2 variant was expressed in all of the ER-positive and two of the ER-negative cell lines (MDA-MB-231 and MDA-MB-453), with very weak expression noted in SK-BR-3. MCF7, ZR-75-1, MDA-MB-453 and HCC1954 clearly expressed ERβ5, with weak expression noted only in the T-47D cell line.

 Western blotting and immunodetection

Representative images for ERα and ERβ protein expression are shown in Fig. 2. The percentage of positivity for ERα and ERβ in all the samples studied is shown in Table V. All cell lines (ER-positive and ER-negative) expressed a ∼66 kDa protein corresponding to ERα (reported size for ERα). Smaller molecular weight bands (<66 kDa) were noted in some of the ER-positive and ER-negative cell lines. These may be spliced variants of ERα, as spliced variants have been reported for this gene (27,29,56). All of the cell lines were found to express a 52–54 kDa protein (the reported size for ERβ1). Certain cell lines also expressed a smaller molecular weight band that may be an ERβ spliced variant (46,57–59).

 Discussion

It has been reported that breast cancer cell lines from different laboratories may differ in their sensitivity to estradiol (13). This discrepancy may be attributed to lack of proper investigation of the ER status. We demonstrated that all of the cell lines used in this study express cytoplasmic and/or membrane ER when analyzed by flow cytometry (unpublished data). In this study, we demonstrated that cell lines that have been known to be positive or negative for classical ER (ERα) show various degrees of positivity for the ERβ isoform and for the ERα and ERβ variants at both the protein and mRNA levels. This is important, as the presence of the ERβ isoforms together with the ERα isoforms in a tissue may have functional implications for binding and response to a particular ligand.

As several variants have been shown to exist for ERα (Table I) differences in estrogen responsiveness of cell lines may be due to varying ratios of wild-type to variant ER mRNA. The Δ1 variant lacking exon 1 (N terminal AF1 region) results in a 46-kDa protein that heterodimerizes with the wild-type ERα, suppressing its activity (33), and the Δ3 (60), Δ4 (61) and Δ7 variants (16) also inhibit gene transcription by interfering with the ability of the wild-type ER to initiate transcription (15,16,18). Conversely, the Δ5 variant acts in a dominant-positive manner to activate the gene transcription of an ER-regulated gene (15,16,18). Certain cell lines, misclassified as ER-negative, exhibit the Δ5 variant, which activates gene transcription in the absence of the hormone and inhibits wild-type activity by competing for steroid receptor co-activator-1e (SRC-1e) (62). Thus, the presence of this variant may explain hormone independence and tamoxifen-resistance, and may contribute to the hormone-independent proliferation of ER-negative cell lines (16).

Although the presence of variants in cell lines has been reported by several investigators, a complete analysis of variant expression has not been attempted. Two of the ER-positive cell lines, MCF7 and ZR-75-1, have been shown to exhibit the ERα wild-type Δ5 and Δ7 variants (63). However, the present results also show that in addition to these variants, MCF7 cells express Δ3, in agreement with previous reports (34,37). Strom et al (64) reported that the predominant ER in T-47D cell lines is ERα (9:1 with ERβ) and that estradiol stimulates growth of T-47D cells, while anti-estrogens do not induce proliferation. As we demonstrated, T-47D expresses ERα Δ5, Δ7 and Δ3 (albeit little of this variant) and ERβ (explained below), and these variants may act to inhibit or enhance wild-type ERα action. As Δ3 and Δ7 act in a dominant-negative fashion to suppress ERα wild-type activity, and Δ5 acts to enhance gene transcription, investigation of the relative expression of these variants in comparison to the wild-type gene is of critical importance. The presence of these variants may be the cause of reported discrepancies in results between different laboratories.

Reports that the MDA-MB-453 cell line is negative for ERα wild-type mRNA are in agreement with our results; however, MDA-MB-231 was found to exhibit positivity for wild-type ERα. This was confirmed by using three different sets of primers that detect the wild-type ERα and different variants. Although ERα was not expressed at the transcript level, it was detected in both cell lines at the protein level both by Western blotting, as indicated above, and by using flow cytometry (unpublished data). This may be due to a high turnover of mRNA and protein accumulation. HCC1954 was also positive for wild-type ERα and for the Δ5 and Δ7 variants. ERα Δ7 is able to form heterodimers with ERα and ERβ in a ligand-independent manner resulting in a dominant-negative effect on both ER isoforms (65,66), and the presence of ERα Δ5, which has AF-1 activity and DNA binding ability, leads to a constitutively active receptor (65). This may explain resistance to tamoxifen and hormone-independent proliferation in ER-negative cell lines (67).

Five spliced isoforms of the human ERβ, designated ERβ1-5, were cloned by Moore et al (10). The amino acid sequences diverge at amino acid 469 within the ligand binding domain and extend to the C-terminus (42). Longer forms of the ERβ – 485, 530 and 548 aa – have also been reported (5,10,11,68,69). In addition to the expression of wild-type ERβ of various lengths due to the use of alternative transcription start sites, a number of ERβ variants have been identified (Table II) arising from alternative splicing (10,41,42,70). As with ERα, these spliced variants, when expressed with the wild-type ERβ, alter the response of the wild-type to estradiol; thus, the relative expression levels of the wild-type vs. variant ERβ is of significance in predicting cellular responsiveness to various estrogen and anti-estrogen therapies (59,71,72).

Tumors that express ERβ2 (or ERβcx), a splice variant of ERβ that utilizes an alternative exon 8, show a poor response to tamoxifen (48,72). The ERβ2 variant does not bind ligands and heterodimerizes with ERα, having an overall dominant-negative effect on ERα reporter gene activity (10,73). In the present study, ERβ1, ERβ2 and ERβ5 mRNA expression in the cell lines was investigated; however, we did not study ERβ3 and ERβ4, as it has been indicated that they are barely detectable in breast tumor samples. However, the expression of the ERβ4 variant cannot be ruled out in breast cancer cell lines; Tong et al (47) used a different primer set and were able to amplify ERβ4 in MCF7, T-47D, ZR-75-1, MDA-MB-231 and SK-BR-3 cells (MDA-MB-453 and HCC1954 were not studied), although its expression was very low in comparison to the other variants, and thus it may have limited physiological significance.

The ER-positive cell lines MCF7, T-47D and ZR-75-1 were positive for ERβ1, ERβ2 and ERβ5. Other investigators have shown that MCF7 contains high levels of the ERβ2 and ERβ5 isoforms (51), and that the T-47D cell line is positive for ERβ1 and ERβ2 and negative for ERβ5 (47). Conversely, our results showed very weak ERβ5 expression in this cell line. Moreover, Tong et al showed that SK-BR-3 was negative for ERβ1 and positive for ERβ2 and ERβ5, while we detected some ERβ1 and ERβ2 expression. The MDA-MB-231 cell line has been reported to express ERβ1, ERβ2 and ERβ5 (47), while our results confirm expression of ERβ1 and ERβ2 only, in agreement with other reports (42,46,51). Others have been unable to detect ERβ in SK-BR-3 (74), but in the present study SK-BR-3 cells were found to express ERβ by flow cytometry (unpublished data), as well as to express the ERβ 268 and 214-bp products at the mRNA level, and the 52–54 and 38–44 kDa products at the protein level.

Many of the ERα and ERβ variants have been shown to be translated into proteins (Tables I and II). In the present study, all of the cell lines showed wild-type ERα and ERβ1 expression, albeit to varying degrees. In addition, some cell lines clearly exhibited a 42-kDa variant that could be the translated protein product of the exon 5-deleted ERα variant. The expression of a smaller (38-44 kDa) ERβ variant by all cell lines, the significance of which is not clear at this stage, demonstrates that our level of understanding of the expression of ER variants at the functional level requires further investigation.

The authors would like to acknowledge the skillful technical assistance of Dr Beryl G. Rego and Mrs. Ani Mathew for handling the cell culture aspect of the project, and Dr Sureikah S. Mohan, Mrs. Lizamma Jacob and Ms. Jocelin Jacob for the processing of samples for protein and gene analysis. Financial support for this study was provided by the Kuwait University Grant no MY01/02. The authors would also like to acknowledge the support of the Department of Physiology, Faculty of Medicine.

 References KoikeSSakaiMMuramatsuMMolecular cloning and characterization of rat estrogen receptor cDNANucleic Acids Res15249925131987 KuiperGGEnmarkEPelto-HuikkoMNilssonSGustafssonJACloning of a novel receptor expressed in rat prostate and ovaryProc Natl Acad Sci USA93592559301996 MosselmanSPolmanJDijkemaRER beta: identification and characterization of a novel human estrogen receptorFEBS Lett39249531996 TremblayGBTremblayACopelandNGGilbertDJJenkinsNALabrieFGiguereVCloning, chromosomal localization, and functional analysis of the murine estrogen receptor betaMol Endocrinol113533651997 EnmarkEPelto-HuikkoMGrandienKHuman estrogen receptor beta-gene structure, chromosomal localization, and expression patternJ Clin Endocrinol Metab82425842651997 MontanoMMMullerVTrobaughAKatzenellenbogenBSThe carboxy-terminal F domain of the human estrogen receptor: role in the transcriptional activity of the receptor and the effectiveness of antiestrogens as estrogen antagonistsMol Endocrinol98148251995 PetterssonKDelaunayFGustafssonJAEstrogen receptor beta acts as a dominant regulator of estrogen signalingOncogene19497049782000 PaechKWebbPKuiperGGNilssonSGustafssonJKushnerPJScanlanTSDifferential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sitesScience277150815101997 CowleySMParkerMGA comparison of transcriptional activation by ER alpha and ER betaJ Steroid Biochem Mol Biol691651751999 MooreJTMcKeeDDSlentz-KeslerKCloning and characterization of human estrogen receptor beta isoformsBiochem Biophys Res Commun24775781998 OgawaSInoueSWatanabeTThe complete primary structure of human estrogen receptor beta (hER beta) and its heterodimerization with ER alpha in vivo and in vitroBiochem Biophys Res Commun2431221261998 CoradiniDBiffiACappellettiVDi FronzoGActivity of tamoxifen and new antiestrogens on estrogen receptor positive and negative breast cancer cellsAnticancer Res14105910641994 LacroixMLeclercqGRelevance of breast cancer cell lines as models for breast tumours: an updateBreast Cancer Res Treat832492892004 GrahamMLKrettNLMillerLAT47DCO cells, genetically unstable and containing estrogen receptor mutations, are a model for the progression of breast cancers to hormone resistanceCancer Res50620862171990 FuquaSAFitzgeraldSDChamnessGCVariant human breast tumor estrogen receptor with constitutive transcriptional activityCancer Res511051091991 FuquaSAFitzgeraldSDAllredDCInhibition of estrogen receptor action by a naturally occurring variant in human breast tumorsCancer Res524834861992 McGuireWLChamnessGCFuquaSAAbnormal estrogen receptor in clinical breast cancerJ Steroid Biochem Mol Biol432432471992 CastlesCGFuquaSAKlotzDMHillSMExpression of a constitutively active estrogen receptor variant in the estrogen receptor-negative BT-20 human breast cancer cell lineCancer Res53593459391993 KoehorstSGJacobsHMThijssenJHBlankensteinMAWild type and alternatively spliced estrogen receptor messenger RNA in human meningioma tissue and MCF7 breast cancer cellsJ Steroid Biochem Mol Biol452272331993 PfefferUFecarottaECastagnettaLVidaliGEstrogen receptor variant messenger RNA lacking exon 4 in estrogenresponsive human breast cancer cell linesCancer Res537417431993 ZhangQXBorgAFuquaSAAn exon 5 deletion variant of the estrogen receptor frequently coexpressed with wild-type estrogen receptor in human breast cancerCancer Res53588258841993 DaffadaAAJohnstonSRSmithIEDetreSKingNDowsettMExon 5 deletion variant estrogen receptor messenger RNA expression in relation to tamoxifen resistance and progesterone receptor/pS2 status in human breast cancerCancer Res552882931995 LeygueERWatsonPHMurphyLCEstrogen receptor variants in normal human mammary tissueJ Natl Cancer Inst882842901996 PfefferUFecarottaEArenaGForlaniAVidaliGAlternative splicing of the estrogen receptor primary transcript normally occurs in estrogen receptor positive tissues and cell linesJ Steroid Biochem Mol Biol56991051996 PinkJJWuSQWolfDMBilimoriaMMJordanVCA novel 80 kDa human estrogen receptor containing a duplication of exons 6 and 7Nucleic Acids Res249629691996 ZhangQXHilsenbeckSGFuquaSABorgAMultiple splicing variants of the estrogen receptor are present in individual human breast tumorsJ Steroid Biochem Mol Biol592512601996 DesaiAJLuqmaniYAWaltersJEPresence of exon 5-deleted oestrogen receptor in human breast cancer: functional analysis and clinical significanceBr J Cancer75117311841997 HuangALeygueERSnellLMurphyLCWatsonPHExpression of estrogen receptor variant messenger RNAs and determination of estrogen receptor status in human breast cancerAm J Pathol150182718331997 GallacchiPSchoumacherFEppenberger-CastoriSvon LandenbergEMKuengWEppenbergerUMuellerHIncreased expression of estrogen-receptor exon-5-deletion variant in relapse tissues of human breast cancerInt J Cancer7944481998 MurphyLCDotzlawHLeygueECouttsAWatsonPThe pathophysiological role of estrogen receptor variants in human breast cancerJ Steroid Biochem Mol Biol651751801998 OhlssonHLykkesfeldtAEMadsenMWBriandPThe estrogen receptor variant lacking exon 5 has dominant negative activity in the human breast epithelial cell line HMT-3522S1Cancer Res58426442681998 FascoMJKeyomarsiKArcaroKFGierthyJFExpression of an estrogen receptor alpha variant protein in cell lines and tumorsMol Cell Endocrinol1661561692000 FlouriotGBrandHDengerSIdentification of a new isoform of the human estrogen receptor-alpha (hER-alpha) that is encoded by distinct transcripts and that is able to repress hER-alpha activation function 1EMBO J19468847002000 PoolaIKoduriSChatraSClarkeRIdentification of twenty alternatively spliced estrogen receptor alpha mRNAs in breast cancer cell lines and tumors using splice targeted primer approachJ Steroid Biochem Mol Biol722492582000 PowellCESotoAMSonnenscheinCIdentification and characterization of membrane estrogen receptor from MCF7 estrogen-target cellsJ Steroid Biochem Mol Biol77971082001 FerroPForlaniAMuselliMPfefferUAlternative splicing of the human estrogen receptor alpha primary transcript: Mechanisms of exon skippingInt J Mol Med123553632003 HanFMiksicekRClarkeRConradSEExpression of an estrogen receptor variant lacking exon 3 in derivatives of MCF-7 cells with acquired estrogen independence or tamoxifen resistanceJ Mol Endocrinol329359452004 RazandiMPedramAMerchenthalerIGreeneGLLevinERPlasma membrane estrogen receptors exist and functions as dimersMol Endocrinol18285428652004 PenotGLePCMerotYThe human estrogen receptor-alpha isoform hERalpha46 antagonizes the proliferative influence of hERalpha66 in MCF7 breast cancer cellsEndocrinology146547454842005 DerooBJKorachKSEstrogen receptors and human diseaseJ Clin Invest1165615702006 VladusicEAHornbyAEGuerra-VladusicFKLupuRExpression of estrogen receptor beta messenger RNA variant in breast cancerCancer Res582102141998 LeygueEDotzlawHWatsonPHMurphyLCExpression of estrogen receptor beta1, beta2, and beta5 messenger RNAs in human breast tissueCancer Res59117511791999 FuquaSASchiffRParraIExpression of wild-type estrogen receptor beta and variant isoforms in human breast cancerCancer Res59542554281999 SpeirsVAdamsIPWaltonDSAtkinSLIdentification of wild-type and exon 5 deletion variants of estrogen receptor beta in normal human mammary glandJ Clin Endocrinol Metab85160116052000 MannSLauciricaRCarlsonNEstrogen receptor beta expression in invasive breast cancerHum Pathol321131182001 PoolaIAbrahamJLiuAEstrogen receptor beta splice variant mRNAs are differentially altered during breast carcinogenesisJ Steroid Biochem Mol Biol821691792002 TongDSchusterESeifertMCzerwenkaKLeodolteSZeillingerRExpression of estrogen receptor beta isoforms in human breast cancer tissues and cell linesBreast Cancer Res Treat712492552002 SajiSOmotoYShimizuCExpression of estrogen receptor (ER) (beta)cx protein in ER(alpha)-positive breast cancer: specific correlation with progesterone receptorCancer Res62484948532002 SaundersPTMillarMRWilliamsKExpression of oestrogen receptor beta (ERbeta1) protein in human breast cancer biopsiesBr J Cancer862502562002 ShawJAUdokangKMosqueraJMChauhanHJonesJLWalkerRAOestrogen receptors alpha and beta differ in normal human breast and breast carcinomasJ Pathol1984504572002 GiraultIAndrieuCTozluSSpyratosFBiecheILidereauRAltered expression pattern of alternatively spliced estrogen receptor beta transcripts in breast carcinomaCancer Lett2151011122004 Esslimani-SahlaMSimony-LafontaineJKramarAEstrogen receptor beta (ER beta) level but not its ER beta cx variant helps to predict tamoxifen resistance in breast cancerClin Cancer Res10576957762004 ParkBWKimKSHeoMKThe changes of estrogen receptor-beta variant expression in breast carcinogenesis: decrease of estrogen receptor-beta2 expression is the key event in breast cancer developmentJ Surg Oncol935045102006 ChomczynskiPSacchiNSingle-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extractionAnal Biochem1621561591987 Al-BaderMDEstrogen receptors alpha and beta in rat placenta: detection by RT-PCR, real time PCR and Western blottingReprod Biol Endocrinol4132006 BukovskyACekanovaMCaudleMRWimalasenaJFosterJSHenleyDCElderRFExpression and localization of estrogen receptor-alpha protein in normal and abnormal term placentae and stimulation of trophoblast differentiation by estradiolReprod Biol Endocrinol1132003 ChoiIKoCPark-SargeOKNieRHessRAGravesCKatzenellenbogenBSHuman estrogen receptor beta-specific monoclonal antibodies: characterization and use in studies of estrogen receptor beta protein expression in reproductive tissuesMol Cell Endocrinol1811391502001 LaVoieHADeSimoneDCGillio-MeinaCHuiYYCloning and characterization of porcine ovarian estrogen receptor beta isoformsBiol Reprod666166232002 PoolaIAbrahamJBaldwinKIdentification of ten exon deleted ERbeta mRNAs in human ovary, breast, uterus and bone tissues: alternate splicing pattern of estrogen receptor beta mRNA is distinct from that of estrogen receptor alphaFEBS Lett5161331382002 WangYMiksicekRJIdentification of a dominant negative form of the human estrogen receptorMol Endocrinol5170717151991 ParkWChoiJJHwangESLeeJHIdentification of a variant estrogen receptor lacking exon 4 and its coexpression with wild-type estrogen receptor in ovarian carcinomasClin Cancer Res2202920351996 BolligAMiksicekRJAn estrogen receptor-alpha splicing variant mediates both positive and negative effects on gene transcriptionMol Endocrinol146346492000 CastlesCGKlotzDMFuquaSAHillSMCoexpression of wild-type and variant oestrogen receptor mRNAs in a panel of human breast cancer cell linesBr J Cancer719749801995 StromAHartmanJFosterJSKietzSWimalasenaJGustafssonJAEstrogen receptor beta inhibits 17beta-estradiolstimulated proliferation of the breast cancer cell line T47DProc Natl Acad Sci USA101156615712004 HerynkMHFuquaSAEstrogen receptor mutations in human diseaseEndocr Rev258698982004 Garcia PedreroJMZuazuaPMartinez-CampaCLazoPSRamosSThe naturally occurring variant of estrogen receptor (ER) ERDeltaE7 suppresses estrogen-dependent transcriptional activation by both wild-type ERalpha and ERbetaEndocrinology144296729762003 ChaidarunSSAlexanderJMA tumor-specific truncated estrogen receptor splice variant enhances estrogen-stimulated gene expressionMol Endocrinol12135513661998 BhatRAHarnishDCStevisPELyttleCRKommBSA novel human estrogen receptor beta: identification and functional analysis of additional N-terminal amino acidsJ Steroid Biochem Mol Biol672332401998 WilkinsonHADahllundJLiuHIdentification and characterization of a functionally distinct form of human estrogen receptor betaEndocrinology143155815612002 HansteinBLiuHYancisinMCBrownMFunctional analysis of a novel estrogen receptor-beta isoformMol Endocrinol131291371999 IwaoKMiyoshiYEgawaCIkedaNNoguchiSQuantitative analysis of estrogen receptor-beta mRNA and its variants in human breast cancersInt J Cancer887337362000 SajiSOmotoYShimizuCClinical impact of assay of estrogen receptor beta cx in breast cancerBreast Cancer93033072002 OgawaSInoueSWatanabeTOrimoAHosoiTOuchiYMuramatsuMMolecular cloning and characterization of human estrogen receptor betacx: a potential inhibitor ofestrogen action in humanNucleic Acids Res26350535121998 VladusicEAHornbyAEGuerra-VladusicFKLakinsJLupuRExpression and regulation of estrogen receptor beta in human breast tumors and cell linesOncol Rep71571672000 Figures and Tables

RT-PCR results. Representative ethidium bromide-stained gels for all positive and negative cell lines showing ERα and ERβ isoform and variant expression. The migration of the 100-bp marker (M) is shown at the left-hand side, and the expected size of the product is indicated at the right-hand side of the gel. Both RT and water samples were negative (data not shown). (A) All the cell lines expressed a 201-bp product for actin. Expression of the (B) ERα wild-type (281 bp) and Δ3 (165 bp) variant; (C) ERα wild-type (466 bp) and Δ5 (328 bp) variant; (D) ERα wild-type (452 bp) and Δ7 (268 bp) variant; (E) ERβ1 (268 bp) variant; (F) ERβ2 (214 bp) and ERβ5 (295 bp) variants. For more details, refer to Table IV.

Results of the Western blotting. (A) Representative blot for ERα, (B) ERβ and (C) actin. The calculated size of the band is indicated at the right-hand side of the gel.

Reported ERα variants in breast tissue and breast cancer cell lines.

Origin ERα mRNA status ERβ protein status Refs.
T-47D+ cell line Δ2, 3 or 7 14
MCF7+ cell line Δ5 15
Breast cancer ER−/PgR+; ER+/PgR− Δ7 16
Breast cancer ER−/PgR+; ER+/PgR− (review) Δ3, 5 or 7 17
BT-20 (negative cell lines) Δ5 42 kDa 18
MCF7+ cell line Δ4 and 7 19
MCF7+ cell line Δ4 and 7 20
Breast cancer ER+/PgR+; ER+/PgR−; T-47D; ZR-75-1 (positive cell lines) Δ5 21
Breast cancer Δ5 22
Breast cancer Δ7, Δ4, Δ4+7 and Δ3+4 23
Breast cancer Δ4 24
MCF7+ cell line Duplication of exons 6 and 7 80 kDa 25
Human breast cancer Δ2, Δ3, Δ4, Δ5 and Δ7 26
Breast cancer Δ5 40 kDa 27
Breast cancer ERα clone4 28
Breast cancer (relapse) Δ5 40 kDa 29
Breast cancer Δ4, Δ3+4, Δ5, Δ7, Δ4–7, clone 4 Δ4=54, Δ3+4=49, Δ5=40, Δ7=51, Δ4–7=39 and clone 4=24 kDa 30
Human breast epithelial cell line HMT-3522 Δ5 42 kDa 31
MCF7, T-47D and ZR-75-1 (positive cell lines) Δ7 and 7P Δ7=52 and 7P=60 kDa 32
MCF7+ cell line Δ1 46 kDa 33
MCF-7, T-47D, ZR-75-1, LCC1, LCC2 and LCC9 (positive cell lines) Δ2, Δ3, Δ2+3, Δ4, Δ5, Δ6 and Δ7 34
MDA-MB-435, MDA-MB-235 and LCC6 (negative cell lines) Δ2 and Δ4 only in MDA-MB-453 34
MCF7+ cell line 130, 110, 92 and 67 kDa 35
MCF7+ cell line Δ4 36
MCF7+ cell line Δ3 61 kDa 37
Breast cancer 67+67≈134 kDa 38
MCF7+ cell line 66, 46 kDa 39
Review Δ2, Δ3, Δ4, Δ5, Δ6 and Δ7 Δ2=17, Δ3=62.3, Δ4=54.1, Δ5=41.6, Δ6=53 and Δ7=52.2 kDa 40

Reported ERβ variants in breast tissue and breast cancer cell lines.

Origin ERβ mRNA status ERβ protein status Refs.
MCF7 and MDA-MB-231 ERβ and ERβΔ5 in MCF7, ERβ Δ5 in MDA-MB-231 41
Breast tissue ERβ1, 2, 4, 5 ERβ1=54.2 kDa; ERβ2=55.5 kDa 42
Breast cancer 58–60 kDa + low mol wt (4–5 kDa); predicted 62 kDa from sequence data 43
Normal human mammary gland ERβΔ5 44
Breast cancer 55 and 50 kDa 45
Breast – normal and cancer and cell lines Δ2; Δ2 and Δ5–6; Δ4; Δ5; Δ5 and Δ2; Δ6; Δ6 and Δ2, Δ6 and Δ2–3; and exons Δ5–6 46
Breast cancer ERβ1, 2, 4, 5 47
Breast cancer ERβcx 48
Breast cancer 59, 53 and 32–45 kDa 49
Breast – normal and cancer 62, 58, 56 and 54kDa 50
Breast – normal, cancer and cell lines ERβ1, 2, 5 51
Breast cancer ERβcx 52
Breast cancer 59+59=118 kDa 38
Breast cancer ERβ1, 2, 4, 5 ERβ1=54.2 kDa; ERβ2=55.5 kDa 53

Primers used for RT-PCR, expected PCR product sizes, annealing temperatures and cycle numbers.

Gene Primers Expected product size Refs. Annealing temperature (˚C) Cycle no.
β-actin Forward: GTCCTGTGGCATCCACGAAACT 201 bp (26) 53 24
Reverse: TACTTGCGCTCAGGAGGAGCAA
ERαΔ3 Forward: ATGGAATCTGCCAAGAAGACT 281 bp, wt; (26) 45 35
Reverse: GCGCTTGTGTTTCAACATTCT 165 bp, Δ3
ERαΔ5 Forward: CTCATGATCAAA CGCTCTAAG 466 bp, wt; (26) 42 32
Reverse: ATAGATTTGAGGCACACAAAC 328 bp, Δ5
ERαΔ6, 7, 6+7 Forward: GCTCCTAACTTGCTCTTGG 452 bp, wt; (26) 53 32
Reverse: ACGGCTAGTGGGCGCATGTA 318 bp, Δ6;
268 bp, Δ7;
134 bp, Δ6+7
ERβ-I Forward: CGATGCTTTGGTTTGGGTGAT 268 bp, ERβ1 (42) 51 35
Reverse: GCCCTCTTTGCTTTTACTGTC
ERβ-II Forward: CGATGCTTTGGTTTGGGTGAT 214 bp, ERβ2; (42) 51 35
Reverse: CTTTAGGCCACCGAGTTGATT 295 bp ERβ5

RT-PCR results for ERα and ERβ isoforms (and/or variants) and actin gene expression for various ER-positive and ER-negative cell lines.

Cells β-actin ERα Δ3 primer ERα Δ5 primer ERα Δ6, 7, 6+7 primer sets ERβ1, 2, 5 primer
201 bp wt 281 bp Δ3 165 bp wt 466 bp Δ5 328 bp wt 452 bp Δ6 318 bp Δ7 268 bp Δ6+7 134 bp β1 268 bp β2 214 bp β5 295 bp
MCF7 ++ + +/F + + + - + - + + ++
MCF7 ++ + - + VF + - F - +/F ++ -
MCF7 + F - - - - - - - + ++ -/+?
MCF7 ++ + +/VF ++ + + - +/F - + + ++
MCF7 ++ + +/VF + F + - +/F - + + +
T-47D ++ ++ VF ++ F ++ - + - + + -
T-47D ++ +++ VF ++ + +++ - + - + + F
T-47D ++ + F ++ + +++ - + - + + F
T-47D + ++ VF ++ + +++ - + - + + VF
ZR-75-1 + + - - - - - - - - - -
ZR-75-1 ++ + - ++ + ++ + - -? + ++
ZR-75-1 + + - + - + - + - +/F +/F ++
ZR-75-1 + + - ++ +/VF? + - + - +/F +/F +
MDA-MB-231 + + - + -? F F - - + ++ F
MDA-MB-231 ++ + - + VF + - VF - + ++ -
MDA-MB-231 ++ + - + VF + - VF - + ++ -
MDA-MB-231 ++ - - - - VF - - - + ++ -
MDA-MB-453 ++ - - VF - - - - - ++ +/F ++
MDA-MB-453 + - - - - - - - - - - +
MDA-MB-453 ++ - - - - - - - - ++ + ++
MDA-MB-453 ++ - - - - - - - - ++ + ++
SK-BR-3 + - - - - - - - - - - -
SK-BR-3 + - - - - F - - - + + -
SK-BR-3 ++ - - - - - - - - - - -
SK-BR-3 ++ - - VVVF VVVF - - - - + VVF VVF
HCC1954 ++ VVF - - - - - - - - - +
HCC1954 ++ +/F - + +/F + - + - ++ - +
HCC1954 + +/F - + +/F + - + - ++ - +

Each experiment was repeated at least three times for each cell line, and the results are expressed as follows: +, ++ and +++, intensity of band evident; -, no band noted. F, faint; VF, very faint; VVF, very, very faint; VVVF, very, very, very faint.

Percentage of positive expression of ERα and ERβ isoform/variant protein determined by Western blotting.

Cell line ERαS ERβ
66a 40–44a 52–54a 38–44a
MCF7 90% 20% 30% 70%
T-47D 71% 29% 43% 43%
ZR-75-1 60% 40% 40% 40%
MDA-MB-231 50% 10% 40% 50%
MDA-MB-453 50% 25% 50% 50%
SK-BR-3 60% 60% 40% 40%
HCC1954 75% 25% 50% 25%

Approximate size in kDa.